CN113493756A

CN113493756A - Genetically engineered bacterium and application thereof

Info

Publication number: CN113493756A
Application number: CN202010262649.6A
Authority: CN
Inventors: 吴燕; 陈宇恒; 冀勇良; 徐争; 田振华
Original assignee: Ecolab Biotechnology Shanghai Co Ltd
Current assignee: Ecolab Biotechnology Shanghai Co Ltd
Priority date: 2020-04-03
Filing date: 2020-04-03
Publication date: 2021-10-12

Abstract

The invention discloses a genetic engineering bacterium, which is an engineering bacterium constructed by expressing CYP genes, ferredoxin reductase genes and dehydrogenase genes in cells; wherein, the amino acid sequence coded by the CYP gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO. 11. The invention also discloses application of the gene engineering bacteria in preparation of calcitriol and/or calcitriol. When the engineering bacteria are applied to the synthesis of the calcitriol and the calcifediol, the yield is obviously improved, the cost is lower when the engineering bacteria are applied to industrial production, the reaction specificity is high, the reaction condition is mild, the environment is friendly, and the industrial production requirements of the calcitriol and the calcifediol are met.

Description

Genetically engineered bacterium and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a genetic engineering bacterium and application thereof in synthesis of calcitriol and calcifediol.

Background

Calcitriol (calceriol), also known as calcitriol, dihydroxycholecalciferol, is vitamin D in humans₃The active form of (b), also a hormone in the body, has important effects in regulating blood calcium and phosphorus concentrations. Calcitriol was developed by roche and was marketed in switzerland in 1978, and was first registered in china in 1988. Calcitriol can increase calcium level in blood by increasing calcium ion absorption in intestinal tract, can increase calcium release in bone and increase blood calcium level, and can be clinically used for treating hypocalcemia, hypoparathyroidism (adult), osteomalacia, rickets (infant), chronic kidney disease, renal osteopathy, osteoporosis and preventing osteoporosis caused by glucocorticoid according to the action principle. The chemical structural formula of calcitriol is shown below:

at present, the synthesis of calcitriol mainly adopts chemical synthesis and microbial fermentation methods. The chemical synthesis needs to consider the specific introduction of hydroxyl groups at positions C1 and C25 in regioselectivity and stereoselectivity, and has higher reaction difficulty and more complex process. For example, in the chemical synthesis, vitamin D is used as a starting material, and multiple reactions such as esterification protection, cyclization, oxidation, ring opening, purification and the like are required, and multiple steps of group protection and deprotection are required, and the reactions of light irradiation, ring opening and isomerization are applied, so that the steps are complicated, the separation and purification are complicated, and the yield is low, and is about 10%.

Calcifediol, also known as 25-hydroxyvitamin D₃[25(OH)VD₃]Is vitamin D₃A biologically active derivative of (1). 25-hydroxyvitamin D in human plasma tissue₃In a stable concentration range, i.e., 10-40 ng/mL. 25(OH) VD₃The metabolism in human body is regulated and controlled by the calcium balance of human body, the demand of calcium ion is increased, and a large amount of 1 alpha, 25(OH) VD is required to be generated₃，25(OH)VD₃The speed of the subsequent hydroxylation at the 1 alpha position is increased, and when the calcium ion enrichment demand is reduced, 25(OH) VD₃Degradation is mainly by hydroxylation at position 24. Animal experiments show that the calcifediol has obvious effect on metabolic bone diseases such as osteoporosis, rickets, osteomalacia and the like, and can be used for treating hypocalcemia caused by hemodialysis. Can also be used as raw materials of health food and feed additives, and has wide application in health food, medicine field, feed additives and other fields. At present, the ossification glycol can be synthesized by a chemical method, but the chemical synthesis method has the defects of multiple reaction steps, low conversion rate, complex separation and purification process and the like, and is not beneficial to large-scale industrial production. In recent years, with the screening of enzyme-producing strains and the development of genetically engineered bacteria, the production of the calcifediol by converting vitamin D3 through microorganisms becomes a research hotspot, and the production of the calcifediol through a microbial conversion method has the advantages of low production cost, high reaction specificity, mild reaction conditions, environmental friendliness and the like, and is a research focus for producing the calcifediol in the future.

In order to solve many problems in chemical synthesis, it is necessary to develop a new production process. It has been reported in the prior art that vitamin D can be used₃(VD₃) For the substrate, the selective introduction of hydroxyl at C25 position is catalyzed by P450 enzyme to synthesize the ossifying glycol (25-hydroxy vitamin D)₃) (ii) a Or selectively introducing two hydroxyl groups into C1 and C25 positions to synthesize calcitriol (1 alpha, 25-dihydroxy vitamin D)₃) For example, it is reported in biochem, biophysis, res, cummun, 320,156-164,2004 that P450 enzymes (CYP105a1) can catalyze VD3 to obtain calcitriol and calcitriol as follows:

it is reported in the patent US 8,148,119B2 that VDH (VD hydroxylase, SEQ ID NO: 2) from Pseudonocardia autotropica can catalyze VD₃Synthesizing ossifying diol, and using VDH and thcCD (ferrite reductase gene thcC and ferrite reductase gene thcD) in Rhodococcus erythropolis (rhodococcus erythropolis) orIs a co-expression mode in Escherichia coli (Escherichia coli), the production of the calcifediol is improved, but the production of the calcifediol is still low, and the production of the calcifediol is lower than 250 mug/mL (according to VD) as shown in FIGS. 10 and 11₃Calculated for 50% conversion). Tamura et al (ChemBiochem 2013,14,2284-2291) modify P450 enzyme from Pseudomonas autotropica (mutation such as T107A) and perform heterologous expression in Rhodococcus, improve the permeability of cell membrane by adding nisin, reduce the mass transfer resistance of VD3 substrate, and finally obtain the ossification diol by catalyzing VD3 for 2 hours with the yield reaching 573 mug/mL, but the yield of the ossification diol is still to be improved. Journal of Fermentation and Bioengineering, Vol.78, No.5,380-382,1994 reported that Amycolatata autotrophica microorganism catalyzed VD3 can simultaneously obtain calcifediol and calcitriol, wherein the amount of calcifediol is up to 137. mu.g/ml and the amount of calcitriol is up to 24.3. mu.g/ml, and the production of calcitriol is very low.

Therefore, finding a suitable method to increase the production of calcitriol and calcifediol is the key to the industrial production of calcitriol and calcifediol.

Disclosure of Invention

The invention aims to solve the technical problem of providing a genetic engineering bacterium and application thereof aiming at the defects of low yield and the like in the method for preparing calcitriol and calcifediol in the prior art. When the gene engineering bacteria are applied to the synthesis of the calcitriol and the calcitriol, the yield of the obtained calcitriol and/or the calcitriol is remarkably improved, the production cost is lower when the gene engineering bacteria are applied to industrial production, the reaction specificity is high, the reaction condition is mild, the environment is friendly, and the industrial production requirements of the calcitriol and the calcitriol are met.

The present inventors have studied a large number of CYPs (cytochrome P450 superfamily) in the prior art and screened a large number of electron transport systems, and have surprisingly found through a large number of experiments that when a genetically engineered bacterium obtained by combining a specific CYP with a specific electron transport system and transforming a dehydrogenase into a specific host bacterium is used to produce calcitol and/or calcitriol, the yield of the obtained calcitol and/or calcitriol is very high.

The first aspect of the invention provides a genetically engineered bacterium, which is constructed by expressing CYP genes, ferredoxin reductase genes and dehydrogenase genes in cells; wherein, the amino acid sequence coded by the CYP gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO.11 or a sequence with 98 percent, preferably 99 percent or more homology with the CYP gene (namely the sequences).

Preferably, the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.21 or a sequence having 98%, preferably 99% or more homology thereto, and the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.23 or a sequence having 98%, preferably 99% or more homology thereto.

Preferably, the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.25 or a sequence having 98%, preferably 99% or more homology thereto, and the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.27 or a sequence having 98%, preferably 99% or more homology thereto.

In the present invention, the sequence having 98% homology, preferably 99% or more homology means that the sequence has insertion, deletion or substitution of several amino acids or nucleotides. Since it is well known in the art that ferredoxin reductases with which a ferredoxin can be associated are not the only ferredoxin reductases with which a ferredoxin can be associated, those skilled in the art can infer that a ferredoxin can be associated with any ferredoxin reductase with an amino acid/nucleotide sequence homology of 98% or 99% or more.

In the present invention, the sequence of the genes is not limited in general.

Preferably, the cell is e.coli, preferably e.coli BL21(DE3), C2566 or Rosseta.

Preferably, the nucleotide sequence of the CYP gene is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10 or SEQ ID NO. 12.

Preferably, the nucleotide sequence of the ferredoxin gene is shown as SEQ ID NO.22 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene, and the nucleotide sequence of the ferredoxin reductase gene is shown as SEQ ID NO.24 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene.

Preferably, the nucleotide sequence of the ferredoxin gene is shown as SEQ ID NO.26 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene, and the nucleotide sequence of the ferredoxin reductase gene is shown as SEQ ID NO.28 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene.

Preferably, the dehydrogenase generally comprises a coenzyme NAD⁺Enzymes for carrying out the reduction reaction, such as glucose dehydrogenase, alcohol dehydrogenase and/or formate dehydrogenase, wherein the glucose dehydrogenase may preferably be a glucose dehydrogenase having NCBI accession No. NP _ 388275.1; wherein, the alcohol dehydrogenase can be preferably alcohol dehydrogenase with Genbank accession number BAN 05992.1; among them, the formate dehydrogenase may preferably be a formate dehydrogenase having Genbank accession number XP _ 001525545.1.

Preferably, in the genetically engineered bacterium, the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are located on a recombinant expression vector, or the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are integrated in a genome.

Preferably, the recombinant expression vector has a backbone of plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a and/or pET28 a.

Preferably, the CYP gene, ferredoxin reductase gene, and dehydrogenase gene are located on the same recombinant expression vector.

Preferably, the CYP gene, ferredoxin reductase gene and dehydrogenase gene are located on different recombinant expression vectors, preferably on two or three recombinant expression vectors.

In a preferred embodiment of the present invention, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and are constructed, for example, as pRSFDuet1-CYP 6-AciFdx; the ferredoxin reductase gene and the dehydrogenase gene are positioned on another recombinant expression vector to construct, for example, pACYCDuet 1-AciFdR-GDH; in addition, another recombinant expression vector such as pBAD-CYP6 can be included to increase the expression level of CYP 6; in addition, a promoter such as the T7 promoter (typically the promoter is located upstream of the gene but downstream of other genes if present upstream thereof) of the expression cassette of the dehydrogenase gene may be further deleted on a recombinant expression vector (e.g., pacycuet 1-AciFdR-GDH) comprising the ferredoxin reductase gene and the dehydrogenase gene, e.g., pacycuet 1-AciFdR-GDH-DT7, constructed to reduce the expression of the dehydrogenase gene.

In a preferred embodiment of the present invention, the CYP gene and the dehydrogenase gene are located on the same recombinant expression vector, and the ferredoxin gene and the ferredoxin reductase gene are located on the other recombinant expression vector.

In a preferred embodiment of the present invention, the CYP gene, the ferredoxin gene and the ferredoxin reductase gene are located on the same recombinant expression vector, and the dehydrogenase gene is located on another recombinant expression vector.

In a preferred embodiment of the present invention, the CYP genes are located on one recombinant expression vector, constructed, for example, as pBAD-CYP6 or pRSFDuet1-CYP6, and the dehydrogenase genes, the ferredoxin genes and the ferredoxin reductase genes are located on another recombinant expression vector.

Preferably, the dehydrogenase gene is a low-expressed dehydrogenase gene.

In the present invention, the low expression is a meaning generally understood in the art, and generally means an expression amount lower than a normal level.

In a second aspect, the present invention provides a gene combination comprising a CYP gene, a ferredoxin reductase gene and a dehydrogenase gene; wherein, the amino acid sequence coded by the CYP gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO.11 or a sequence with 98 percent, preferably 99 percent or more homology with the CYP gene.

In the present invention, the sequence of the genes is not limited in general.

Preferably, the recombinant expression vector is a multi-recombinant expression vector, preferably a double-recombinant expression vector or a triple-recombinant expression vector, and the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are located on different recombinant expression vectors, preferably two or three recombinant expression vectors.

In a preferred embodiment of the present invention, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and are constructed, for example, as pRSFDuet1-CYP 6-AciFdx; the ferredoxin reductase gene and the dehydrogenase gene are positioned on another recombinant expression vector to construct, for example, pACYCDuet 1-AciFdR-GDH; in addition, another recombinant expression vector such as pBAD-CYP6 can be included to increase the expression level of CYP 6; in addition, a promoter such as the T7 promoter (typically the promoter is located upstream of the gene but downstream of other genes if present upstream thereof) of the expression cassette of the dehydrogenase gene may also be deleted on a recombinant expression vector (e.g., pacycuet 1-AciFdR-GDH) comprising the ferredoxin reductase gene and the dehydrogenase gene, e.g., paccyuet 1-AciFdR-GDH-DT7, constructed to reduce the expression of the dehydrogenase gene.

In a preferred embodiment of the present invention, the CYP genes are located on a recombinant expression vector constructed, for example, as pBAD-CYP6 or pRSFDuet1-CYP 6; the dehydrogenase gene, the ferredoxin gene, and the ferredoxin reductase gene are located on another recombinant expression vector.

In the present invention, the expression vector of the multiple groups generally means that a plurality of genes are expressed on a plurality of recombinant expression vectors in the same host.

Preferably, the nucleotide sequence of the CYP gene is preferably shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10 or SEQ ID NO. 12.

Preferably, the nucleotide sequence of the ferredoxin gene is shown as SEQ ID No.22 or a sequence with 98% homology, preferably 99% homology or more with the ferredoxin gene, and the nucleotide sequence of the ferredoxin gene is shown as SEQ ID No.24 or a sequence with 98% homology, preferably 99% homology or more with the ferredoxin gene.

Preferably, the nucleotide sequence of the ferredoxin gene is shown as SEQ ID No.26 or a sequence with 98% homology, preferably 99% homology or more with the ferredoxin gene, and the nucleotide sequence of the ferredoxin gene is shown as SEQ ID No.28 or a sequence with 98% homology, preferably 99% homology or more with the ferredoxin gene.

Preferably, the dehydrogenase is a glucose dehydrogenase, an alcohol dehydrogenase and/or a formate dehydrogenase. Wherein, the glucose dehydrogenase may be preferably glucose dehydrogenase having NCBI accession number NP-388275.1; wherein, the alcohol dehydrogenase can be preferably alcohol dehydrogenase with Genbank accession number BAN 05992.1; among them, the formate dehydrogenase may preferably be a formate dehydrogenase having Genbank accession number XP _ 001525545.1.

Preferably, the dehydrogenase gene is a low-expressed dehydrogenase gene.

In a third aspect, the present invention provides a recombinant expression vector or a combination of recombinant expression vectors comprising a combination of genes according to the second aspect of the invention.

The fourth aspect of the present invention provides the use of the gene combination according to the second aspect of the present invention or the recombinant expression vector combination according to the third aspect of the present invention in the preparation of a genetically engineered bacterium that produces calcitriol and/or calcitriol.

In a fifth aspect, the invention provides an application of the genetically engineered bacterium according to the first aspect in preparing calcitriol and/or calcitriol.

Preferably, in the application, the genetically engineered bacteria catalyze the vitamin D3 to perform hydroxylation reaction to obtain the calcitriol and/or the calcitriol.

In a sixth aspect, the present invention provides a method for preparing a calcitriol and/or a calcitriol, comprising the steps of: in a reaction solvent, oxidized coenzyme NAD⁺/NADP⁺And in the presence of a hydrogen donor, catalyzing vitamin D3 to perform hydroxylation reaction by the genetically engineered bacteria according to the first aspect of the invention.

Preferably, the vitamin D3 is cosolvent pre-dissolved vitamin D3; the co-solvent preferably comprises one or more of DMSO, tween 80, Triton X100, methanol, ethanol and DMF (N, N-dimethylformamide).

Preferably, the preparation method further comprises the step of adding hydroxypropyl-beta-cyclodextrin to the reaction solvent before the hydroxylation reaction is carried out; the hydroxypropyl-beta-cyclodextrin accounts for 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3% or 0.4% of the reaction system by mass volume.

Preferably, the reaction temperature is 20-33 ℃, for example, 22 ℃,25 ℃, 28 ℃ or 30 ℃. The inventors have found during the course of experiments that the yield of the product obtained is reduced when the temperature is outside the range specified in the present invention.

Preferably, the pH of the reaction is 6.0 to 8.0, such as 6.2, 6.6, 7.0, 7.4 or 7.8. The inventors have found during the course of experiments that the yield of the product obtained is reduced when the pH is outside the range specified in the present invention.

Preferably, the enzyme activity concentration of the genetically engineered bacteria is 4750U/L-94900U/L, preferably 14940U/L-18980U/L, such as 17420U/L.

Preferably, the concentration of vitamin D3 is 0.5g/L to 3g/L, such as 1.0g/L, 1.2g/L, 1.4g/L, 1.6g/L, or 1.8 g/L. The inventor finds that when the concentration of VD3 is too high, the VD cannot be dissolved or a substrate possibly inhibits enzyme activity, and the reaction is incomplete; when the concentration of VD3 is too low, the yield of the obtained product is also low.

Preferably, the NAD⁺/NADP⁺The hydrogen donor and the vitamin D3 are added into the reaction system in batches.

Preferably, the NAD⁺/NADP⁺The molar ratio to the vitamin D3 was 0.001: 1-0.5: 1, e.g. 0.1: 1.

Preferably, the genetically engineered bacteria exist in the form of bacterial sludge of the genetically engineered bacteria or bacterial sludge extracts of the genetically engineered bacteria.

Preferably, the hydrogen donor is glucose, isopropanol or formate; more preferably, when the dehydrogenase expressed in the genetically engineered bacterium is alcohol dehydrogenase, the hydrogen donor is isopropanol; when the dehydrogenase expressed in the genetic engineering bacteria is glucose dehydrogenase, the hydrogen donor is glucose; when the dehydrogenase expressed in the genetic engineering bacteria is formate dehydrogenase, the hydrogen donor is formate.

The invention also provides a crude enzyme solution, which is prepared by washing, homogenizing and crushing the genetic engineering bacteria of the first aspect of the invention. In a preferred embodiment of the present invention, the engineered bacteria can be washed twice with 0.1M phosphate buffer pH7.4, followed by the following steps: the buffer (i.e., 0.1M phosphate buffer pH 7.4) was homogenized at a ratio of 1:5(w/v) at low temperature and high pressure, and the resulting homogenate was centrifuged to remove the precipitate, and the resulting supernatant was a crude enzyme solution containing each recombinant enzyme.

In the present invention, the CYP is Cytochrome P450 oxidase (Cytochrome P450).

The positive progress effects of the invention are as follows:

when the gene engineering bacteria are applied to the synthesis of the calcitriol and the calcitriol, the yield of the obtained calcitriol and/or the calcitriol is remarkably improved, the production cost is lower when the gene engineering bacteria are applied to industrial production, the reaction specificity is high, the reaction condition is mild, the environment is friendly, and the industrial production requirements of the calcitriol and the calcitriol are met. In a preferred embodiment of the invention, when the strain is applied to the synthesis of the calcifediol, the yield can reach 1.024 g/L; in another preferred embodiment of the invention, the strain is applied to the synthesis of calcitriol, and the yield can reach 0.719 g/L; in another preferred embodiment of the invention, the vitamin D3 and NAD are obtained by mixing the substrates⁺/NADP⁺The yield of the calcifediol can reach 5.9g/L by adding the hydrogen donor and the calcifediol in batches.

Drawings

FIG. 1 is a graph showing the results of the time and concentration of the synthesis of calcifediol by batch addition of substrate.

FIG. 2 is a graph showing the results of the assay after 6 hours of reaction in the case of synthesizing calcifediol by adding the substrate in portions.

FIG. 3 is a map of the VD3 control in section 9.6 of example 9.

Figure 4 is a map of the calcifediol control of section 9.6 of example 9.

Figure 5 is a map of calcitriol control in section 9.6 of example 9.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

pET21a, pET28a, pRSFDuet1, pACYCDuet1, pBAD were purchased from Novagen; DpnI, NdeI, HindIII enzymes were purchased from Thermo Fisher; exnase II enzyme purchased from Nanjing Novozam Biotech Ltd; coli BL21(DE3) competent cells were purchased from Changsheng biotechnology, LLC of Beijing ancient cooking; NAD (nicotinamide adenine dinucleotide)⁺the/NADH was purchased from Shenzhen Bangtai bioengineering, Inc.; the plasmid extraction kit is purchased from bio-engineering (Shanghai) corporation; vitamin D3 (VD)₃) Purchased from Shanghai Demer medicine science and technology, Inc.; calcitriol and calcitriol are purchased from national standards material network.

The HPLC analysis method of the product is as follows:

chromatographic conditions are as follows: poroshell EC-C18(4.0 μm, 4.6X 150 mm); detection wavelength: 265 nm; flow rate: 1 mL/min; column temperature: 35 ℃; sample introduction volume: 10 μ L. The gradient elution procedure was as follows: 0-8min, H₂O: acetonitrile 85:15 (v/v); 8-20min, H₂O acetonitrile 0:100 (v/v); 20-21min, H₂O: acetonitrile 85:15 (v/v); 21-27min, H₂O: acetonitrile 85:15 (v/v).

Example 1 screening of Cytochrome P450 enzymes (CYP, Cytochrome P450 proteins)

1.1CYP acquisition and expression

CYP genes were synthesized from the gene sequences SEQ ID NO.2, 4, 6, 8, 10, 12, 14, 16 which encode cytochrome P450 enzymes (amino acid sequences are shown in SEQ ID NO.1, 3, 5, 7, 9, 11, 13, 15, respectively) of Table 1 below. The gene synthesis company is Suzhou Jinweizhi Biotechnology GmbH (Suzhou Industrial park Star lake street 218 Bionanotechnology park, C3).

TABLE 1

Composition of LB liquid medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl, dissolving with deionized water, fixing the volume, and sterilizing at 121 ℃ for 20min for later use.

The synthesized CYP genes are respectively connected to a pET28a vector, enzyme cutting sites NdeI & HindIII, and the enzyme-connected vector is transformed into a host E.coli BL21(DE3) competent cell to obtain an engineering strain containing the CYP genes.

After the engineering bacteria containing the CYP gene are activated by plating and streaking, a single colony is selected and inoculated into 5ml LB liquid culture medium containing 50 mu g/ml kanamycin, and shake culture is carried out for 12h at 37 ℃. Transferred to 50ml of fresh LB liquid medium containing 50. mu.g/ml kanamycin at an inoculum size of 2% (v/v), and shake-cultured at 37 ℃ to OD₆₀₀When the concentration reached about 0.8, IPTG was added to a final concentration of 0.1mM, and induced culture was carried out at 25 ℃ for 22 hours. After the culture is finished, the culture solution is centrifuged at 10000rpm for 10min, the supernatant is discarded, and thalli are collected to obtain each cytochrome P450 enzyme bacterial mud.

Example 2 acquisition and expression of CYP Electron transport chain Gene

The CYP reaction requires nad (p) H to supply electrons and an electron transfer chain to transfer electrons. The electron transport chain genes of 3 sets of CYP were synthesized from the gene sequences SEQ ID NO.18, 20, 22, 24, 26, 28 of the genes encoding the enzymes shown in the amino acid sequences SEQ ID NO.17, 19, 21, 23, 25, 27 of Table 2 below. Wherein, adx (adronodoxin) is cortical ferredoxin, adr (adronodoxin reductase) is cortical ferredoxin reductase, fdx (ferredoxin) is ferredoxin, and fdr (ferredoxin reductase) is ferredoxin reductase.

TABLE 2

Enzyme numbering	Origin of genes	NCBI accession number	Amino acid sequence	Nucleotide sequence
					boAdx	Bos taurus	BAA00362.1	SEQ ID NO.17	SEQ ID NO.18
boAdR	Bos taurus	BAA11921.1	SEQ ID NO.19	SEQ ID NO.20
					AciFdx	Acinetobacter sp.OC4	BAE78451.1	SEQ ID NO.21	SEQ ID NO.22
AciFdR	Acinetobacter sp.OC4	BAE78453.1	SEQ ID NO.23	SEQ ID NO.24
					SpiFdx	Spinacia oleracea	AAA34028.1	SEQ ID NO.25	SEQ ID NO.26
SpiFdR	Spinacia oleracea	CAA30791.1	SEQ ID NO.27	SEQ ID NO.28

The synthesized gene related to the electron transfer chain is connected to a pET21a vector, enzyme cutting sites NdeI & HindIII are adopted, and the enzyme-connected vector is transformed into host E.coli BL21(DE3) competent cells to obtain engineering strains containing each gene.

After the engineering bacteria containing each electron transfer chain gene are activated by plate streaking, a single colony is selected and inoculated into 5ml LB liquid culture medium containing 100 mug/ml ampicillin, and shake culture is carried out for 12h at 37 ℃. Transferred to 50ml of fresh LB liquid medium containing 100. mu.g/ml ampicillin in an inoculum size of 2% (v/v), and shake-cultured at 37 ℃ to OD₆₀₀When the concentration reached about 0.8, IPTG was added to a final concentration of 0.1mM, and induction culture was carried out at 25 ℃ for 16 hours. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, and collecting thalli to obtain boAdx and boAdR bacterial sludge, AciFdx and AciFdR bacterial sludge, and SpiFdx and SpiFdR bacterial sludge respectively.

Example 3 acquisition and expression of Glucose Dehydrogenase (GDH) Gene

The glucose dehydrogenase gene was synthesized from the glucose dehydrogenase gene sequence derived from Bacillus subtilis 168(NCBI accession NP-388275.1).

Glucose dehydrogenase gene pET21a, enzyme cutting site NdeI&HindIII, and transforming the enzyme-linked vector into host E.coli BL21(DE3) competent cells to obtain an engineering strain containing glucose dehydrogenase gene. Activating engineering bacteria containing glucose dehydrogenase gene by plating and streakingThen, a single colony was inoculated into 5ml of LB liquid medium containing 100. mu.g/ml ampicillin, and shake-cultured at 37 ℃ for 12 hours. Transferred into 50ml of fresh LB liquid medium containing 100. mu.g/ml ampicillin in an inoculum size of 2% (v/v), and shaken to OD at 37 ℃₆₀₀When the concentration reached about 0.8, IPTG was added to a final concentration of 0.5mM, and induced culture was carried out at 18 ℃ for 16 hours. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting thalli (namely glucose dehydrogenase bacterial sludge), and storing in a refrigerator at the temperature of-20 ℃ for later use.

Example 4 in vitro Synthesis of calcifediol and calcitriol by cytochrome P450 enzymes

The sludge was washed twice with 0.1M phosphate buffer pH7.4 as described in example 1, SpiFdx and SpiFdR sludge prepared in example 2, and glucose dehydrogenase sludge prepared in example 3, and then the sludge was homogenized and disrupted at low temperature and high pressure according to the ratio of sludge to buffer (i.e., 0.1M phosphate buffer pH 7.4) of 1:5(w/v), and the disruption solution was centrifuged to remove the precipitate, and the resulting supernatant was a crude enzyme solution containing each recombinase.

The concentration of each crude enzyme solution of CYP (cytochrome P450) was measured by CO difference spectroscopy. The determination method comprises the following steps: 1mL of the crude enzyme solution of each cytochrome P450 was put in 2 10mL centrifuge tubes, which were labeled as a control tube and a sample tube. The sample is taken to a fume hood, a centrifuge tube is firstly taken to be filled with a proper amount of water, a CO pipeline is inserted into the water, and a three-way valve is adjusted until the CO gas outlet speed is about 1 second and one bubble is formed. 1mg of sodium hydrosulfite powder is added into the control tube and the sample tube respectively, and the solution is inverted repeatedly to dissolve the sodium hydrosulfite completely and mixed evenly. Respectively transferring the liquid of the control tube and the liquid of the sample tube into a cuvette, and scanning an absorbance value of 400-500nm on an ultraviolet spectrophotometer.

Calculating the enzyme concentration:

C_P450＝(ΔA450-ΔA490)/(ε₄₅₀·L)

wherein:

C_P450the concentration of the P450 enzyme in the sample to be tested, in nmol/mL;

ΔA450，A450_{sample (I)}-A450_ControlA difference of (d);

ΔA490，A490_{sample (I)}-A490_ControlA difference of (d);

ε₄₅₀the molar absorptivity of P450 is 0.091mL/nmol^-1·cm^-1。

L, optical path length, 1 cm.

The results of the measurement are shown in table 3 below:

adding 80 μ L of each CYP crude enzyme solution, 100 μ L of SpiFdx crude enzyme solution, 50 μ L of SpiFdR crude enzyme solution, 15 μ L of GDH crude enzyme solution and VD as a substrate into a 300 μ L reaction system₃Final concentration 100mg/L (methanol pre-dissolved, VD)₃Mother liquor concentration 10g/L), NAD⁺Final concentration 1mM, final glucose concentration 3mM, and final addition of 0.1M pH7.4 phosphate buffer to a final volume of 300 μ L. The reaction was carried out at 220rpm for 6h at 30 ℃. The reaction solution was extracted 3 times with equal volume of ethyl acetate and analyzed by HPLC for substrate and product concentrations. The results of in vitro synthesis of calcifediol/calcitriol by each CYP are shown in table 3.

TABLE 3

*: theoretical yield of calcitriol or calcifediol when the concentration of crude CYP enzyme solution is calibrated to the concentration of crude CYP6 enzyme solution

As can be seen from table 3, only CYP6 gave higher yields of both calcitriol and calcitriol. Wherein, when the concentration of the CYP4 crude enzyme solution is calibrated to that of CYP6, the yield of the calcitriol synthesized by CYP6 is equivalent to that of CYP4, and the yield of the calcitriol synthesized by CYP6 is obviously higher than that of CYP 4. In addition, when the crude enzyme solution concentrations of CYP1, CYP2, and CYP5 were calibrated to the crude enzyme solution concentration of CYP6, the yields of ossified glycol synthesized by CYP1, CYP2, and CYP5 were significantly higher than CYP 4.

Example 5 selection of CYP6 Electron transport systems

The volume of each component of the reaction system was 300. mu.L as shown in example 4, but SpiFdx and SpiFdR sludge in the reaction system were replaced by AciFdx and AciFdR sludge prepared in example 2 or boAdx and boAdR sludge prepared in example 2, and the reaction was carried out at 30 ℃ and 220rpm for 6 hours. The results of in vitro synthesis of calcitriol/diol using different electron transport systems for CYP6 are shown in table 4.

TABLE 4

	Ossifying glycol (mg/L)	Calcitriol (mg/L)
			AciFdx+AciFdR	40.9	42.2
BoAdx+BoAdR	14.6	0
			SpiFdx+SpiFdR	35.6	28.8

As can be seen from Table 4, AciFdx and AciFdr can achieve higher yields of calcitriol and calcitriol. Therefore, AciFdx and AciFdr were chosen as electron transport systems.

EXAMPLE 6 construction of KXRG Strain

In order to construct CYP6, AciFdx, AciFdR and GDH in one strain, the invention adopts 2 double expression vectors, connects four genes in series on two plasmids, and co-expresses the four genes in one host bacterium to construct the KXRG strain.

6.1 construction of pRSFDuet1-CYP6-AciFdx plasmid

The target fragment delta CYP6 is amplified by taking the original plasmid pET28a-CYP6 as a template and CYP6-F, CYP6-R as a primer. A vector fragment RSF1 of which the 5 'end and the 3' end of CYP6 have 15bP homology arms and the 3 'end and the 5' end of CYP6 have 15bP homology arms is amplified by PCR by taking pRSFDuet1 plasmid as a template and RSF-1F, RSF-1R as primers. The PCR product was digested with Dpn1 at 37 ℃ for 2 hours. After completion of the reaction,. DELTA.CYP 6 and RSF1 were recombined with the recombinase Exnase II at 37 ℃ for 0.5 hour, and the recombined product was transformed into C2566 competent cells, plated on LB medium containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ to obtain BL21-pRSFDuet1-CYP6 transformant. BL21-pRSFDuet1-CYP6 transformant was picked up and inoculated into 5mL LB liquid medium containing 50. mu.g/mL kanamycin, shake-cultured at 37 ℃ for 6 hours, and pRSFDuet1-CYP6 plasmid was extracted using plasmid extraction kit from Biotechnology engineering (Shanghai) GmbH. The primers and their sequences are shown in Table 5 (F represents the forward primer, and R represents the reverse primer).

TABLE 5

Primer name	Sequences (5 'to 3')
		CYP6-F	CATATGGCACTGACCACCACCGGTAC(SEQ ID NO.29)
CYP6-R	AAGCTTAGGCCGGTGCACCCGGTGT(SEQ ID NO.30)
		Fdx-F	GAAGGAGATATA CATATGGGTCAGATTACC(SEQ ID NO.31)
Fdx-R	CAGACTCGAGGGTACCAAGCTTACATCTGAA(SEQ ID NO.32)
		RSF-1F	CACCGGCCTAAGCTTGCGGCCGCATAATGC(SEQ ID NO.33)
RSF-1R	GGTCAGTGCCATATGGGATCCTGGCTGTGG(SEQ ID NO.34)
		RSF-2F	ATGTAAGCTTGGTACCCTCGAGTCTGGTAA(SEQ ID NO.35)
RSF-2R	TAATCTGACCCATATGTATATCTCCTTC(SEQ ID NO.36)

The PCR amplification system is shown in Table 6 below:

TABLE 6PCR amplification System

Reagent	Dosage (mu L)
		2 × PCR buffer (with high fidelity enzyme)	25
Forward primer	1
		Reverse primer	1
Form panel	1
		Deionized water	22

The PCR amplification procedure is shown in table 7 below:

TABLE 7PCR amplification procedure

The original plasmid pET21a-AciFdx is used as a template, Fdx-F, Fdx-R is used as a primer, and the delta AciFdx with the target fragment is amplified. The pRSFDuet1-CYP6 plasmid extracted above is used as a template, RSF-2F, RSF-2R is used as a primer, and a vector fragment RSF2 of which the 5 'end and the 3' end of AciFdx have 15bP homologous arms and the 3 'end and the 5' end of the AciFdx have 15bP homologous arms is amplified through PCR. The PCR product was digested with Dpn1 enzyme at 37 ℃ for 2 hours. After completion of the reaction, the.DELTA.AciFdx and RSF2 fragments were recombined with recombinase Exnase II at 37 ℃ for 0.5 hour, and the recombinant product was transformed into C2566 competent cells, plated on LB medium containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ to obtain BL21-pRSFDuet1-CYP6-AciFdx transformant. BL21-pRSFDuet1-CYP6-AciFdx transformant was picked, inoculated into 5mL LB liquid medium containing 50. mu.g/mL kanamycin, shake-cultured at 37 ℃ for 6 hours, and plasmid was extracted to obtain pRSFDuet1-CYP6-AciFdx plasmid. The plasmid extraction adopts a Shanghai biological working medium particle extraction kit. The primers and their sequences are shown in Table 5. The PCR amplification system and the amplification procedure are shown in tables 6 and 7.

6.2 construction of pACYCDuet1-AciFdR-GDH plasmid

And amplifying the target fragment delta AciFdR by using the original plasmid pET21a-AciFdR as a template and FdR-F, FdR-R as a primer. A vector fragment ACYC1, of which the 5 'end and the 3' end of AciFdR have 15bP homology arms and the 3 'end and the 5' end of AciFdR have 15bP homology arms, is amplified by taking the pACYCDuet1 plasmid as a template and ACYC-1F, ACYC-1R as a primer. The amplified fragments of Δ AciFdR and ACYC1 were digested with Dpn1 enzyme at 37 ℃ for 2 hours. After completion of the reaction, Δ AciFdR and ACYC1 were recombined with recombinase Exnase II at 37 ℃ for 0.5 hour, and the recombined product was transformed into C2566 competent cells, plated on LB medium containing 50. mu.g/mL chloramphenicol, and cultured overnight at 37 ℃ to obtain BL21-pACYCDuet1-AciFdR transformant. BL21-pACYCDuet1-AciFdR transformants are picked and inoculated into 5mL LB liquid culture medium containing 50 ug/mL chloramphenicol, shake culture is carried out at 37 ℃ for 6h, pACYCDuet1-AciFdR plasmids are extracted, and the plasmids are extracted by adopting a Shanghai biological medium plasmid extraction kit. The primers and their sequences are shown in Table 8. The PCR amplification system and the amplification procedure are shown in tables 6 and 7.

TABLE 8

Primer name	Sequences (5 'to 3')
		FdR-F	CCAGGATCCGAATTCCATATGCAGACCATTG(SEQ ID NO.37)
FdR-R	CTGTTCGACTTAAGAAGCTTAACCCATCAG(SEQ ID NO.38)
		GDH-F	GAAGGAGATATA CATATGTATCCGGATTTA(SEQ ID NO.39)
GDH-R	CTTTACCAGACTCGAGTCGAGTCATTAACCGC(SEQ ID NO.40)
		ACYC-1F	GGTTAAGCTT CTTAAGTCGAACAGAAAG(SEQ ID NO.41)
ACYC-1R	TCTGCATATG GAATTCGGATCCTGGCT(SEQ ID NO.42)
		ACYC-2F	AATGACTCGA CTCGAGTCTGGTAAAGAAAC(SEQ ID NO.43)
ACYC-2R	AATCCGGATA CATATGTATATCTCCTTC(SEQ ID NO.44)

The target gene delta GDH was amplified using pET21a-GDH as a template and GDH-F, GDH-R as a primer. And (3) amplifying a vector fragment ACYC2 of which the 5 'end and the 3' end of the GDH have 15bP homologous arms and the 3 'end and the 5' end of the GDH have 15bP homologous arms by using the pACYCDuet1-AciFdR plasmid extracted above as a template and ACYC-2F, ACYC-2R as a primer. The amplified Δ GDH and ACYC2 fragments were digested with Dpn1 enzyme at 37 ℃ for 2 hours. After completion of the reaction, Δ AciFdR and ACYC2 were recombined with the recombinase Exnase II at 37 ℃ for 0.5 hour, and the recombined product was transformed into C2566 competent cells, plated on LB medium containing 50. mu.g/mL chloramphenicol, and cultured overnight at 37 ℃ to obtain BL21-pACYCDuet1-AciFdR-GDH transformant. BL21-pACYCDuet1-AciFdR-GDH transformants were picked, inoculated into 5mL of LB liquid medium containing 50. mu.g/mL of chloramphenicol, shake-cultured at 37 ℃ for 6 hours, and plasmids were extracted to obtain pACYCDuet1-AciFdR-GDH plasmids. The plasmid extraction adopts a Shanghai biological working medium particle extraction kit. The PCR amplification system and the amplification procedure are shown in tables 6 and 7. The primers and their sequences are shown in Table 8.

Construction of 6.3KXRG01 Strain

The pRSFDuet1-CYP6-AciFdx and pACYCDuet1-AciFdR-GDH plasmids prepared above were co-transformed into host E.coli BL21(DE3) competent cells, spread on LB medium containing 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol, and cultured overnight at 37 ℃ to obtain an engineered bacterium KXRG01 containing four genes of CYP6, AciFdx, AciFdR and GDH.

A single colony of the KXRG01 engineered bacterium was inoculated into 5ml of LB liquid medium containing 100. mu.g/ml ampicillin, 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol, and shake-cultured at 37 ℃ for 12 hours. Transferred to 50ml of fresh LB liquid medium containing 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol at 2% (v/v) inoculation amount, and shaken to OD at 37 ℃₆₀₀When the concentration reached about 0.8, IPTG was added to a final concentration of 0.5mM, and induced culture was carried out at 22 ℃ for 22 hours. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting thalli (namely the KXRG01 bacterial sludge is prepared), and storing the thalli in a refrigerator at the temperature of-20 ℃ for later use.

Construction of 6.4KXRG02 Strain

The target fragment delta CYP6-2 is amplified by taking the original plasmid pET28a-CYP6 as a template and CYP6-F2 and CYP6-R2 as primers. And (3) amplifying a vector fragment BAD of which the 5 'end and the 3' end of CYP6 have 15bP homologous arms and the 3 'end and the 5' end of CYP6 have 15bP homologous arms by taking the pBAD plasmid as a template and BAD-F, BAD-R as a primer. The amplified Δ CYP6-2 and BAD fragments were digested with Dpn1 enzyme at 37 ℃ for 2 hours. After completion of the reaction, Δ CYP6-2 and BAD were recombined with recombinase Exnase II at 37 ℃ for 0.5 hour, and the recombined product was transformed into C2566 competent cells, spread on LB medium containing 100. mu.g/mL ampicillin, and cultured overnight at 37 ℃ to obtain BL21-pBAD-CYP6 transformant. The BL21-pBAD-CYP6 transformant was selected and inoculated into 5mL LB liquid medium containing 100. mu.g/mL ampicillin, shake-cultured at 37 ℃ for 6 hours, and the plasmid was extracted to obtain pBAD-CYP6 plasmid. The plasmid extraction adopts a Shanghai biological working medium particle extraction kit. The primers and their sequences are shown in Table 9. The PCR amplification system and the amplification procedure are shown in tables 6 and 7.

TABLE 9

Primer name	Sequences (5 'to 3')
		CYP6-F2	CATATGGCACTGACCACCACCG(SEQ ID NO.45)
CYP6-R2	AAGCTTAGGCCGGTGCACCCGG(SEQ ID NO.46)
		BAD-F	CACCGGCCTAAGCTTGGCTGTTTTGGCGGA(SEQ ID NO.47)
BAD-R	GGTCAGTGCCATATGGGATCCCCATCGATC(SEQ ID NO.48)

pRSFDuet1-CYP6-AciFdx, pACYCDuet1-AciFdR-GDH, and pBAD-CYP6 plasmids were co-transformed into E.coli BL21(DE3) competent cells, which were plated on LB medium containing 100. mu.g/mL ampicillin, 50. mu.g/mL kanamycin, and 50. mu.g/mL chloramphenicol, and cultured overnight at 37 ℃ to obtain a genetically engineered bacterium KXRG02 in which CYP6 is overexpressed.

A single colony of the KXRG02 engineered bacterium was inoculated into 5ml of LB liquid medium containing 100. mu.g/ml ampicillin, 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol, and shake-cultured at 37 ℃ for 12 hours. Transferred to 50ml of fresh LB liquid medium containing 100. mu.g/ml ampicillin, 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol at 2% (v/v) inoculation amount, and shaken to OD at 37 ℃₆₀₀When the concentration reaches about 0.8, adding arabinose to the final concentration of 2g/L and IPTG to the final concentration of 0.5mM, and carrying out induction culture at 22 ℃ for 22 h. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting thalli (namely the KXRG02 bacterial sludge is prepared), and storing the thalli in a refrigerator at the temperature of-20 ℃ for later use.

Construction of 6.5KXRG03 Strain

The T7 promoter of the GDH expression cassette on the pACYCDuet1-AciFdR-GDH plasmid was deleted to reduce the expression level of GDH. The method specifically comprises the following steps: PCR was performed using pACYCDuet1-AciFdR-GDH plasmid as template and DT7-F and DT7-R as primers. The PCR amplification system and the amplification procedure are shown in tables 6 and 7. The primers and their sequences are shown in Table 10.

Watch 10

Primer name	Sequences (5 'to 3')
		DT7-F	CCGCATAATCCCATCTTAGTATATTAGTTAG(SEQ ID NO.49)
DT7-R	TACTAAGATGGGATTATGCGGCCGTGTACAA(SEQ ID NO.50)

The PCR product was digested with Dpn1 enzyme at 37 ℃ for 2 hours. After completion of the reaction, the PCR product was transformed into C2566 competent cells, plated on LB medium containing 100. mu.g/mL of ampicillin, and cultured overnight at 37 ℃. The transformants were picked and inoculated into 5mL of LB liquid medium containing 100. mu.g/mL ampicillin, and shake-cultured at 37 ℃ for 6 hours to extract the plasmid, obtaining pACYCDuet1-AciFdR-GDH-DT7 plasmid. The plasmid extraction adopts a Shanghai biological working medium particle extraction kit.

The pRSFDuet1-CYP6-AciFdx, pACYCDuet1-AciFdR-GDH-DT7 and pBAD-CYP6 plasmids were co-transformed into host E.coli BL21(DE3) competent cells, plated on LB medium containing 100. mu.g/mL ampicillin, 50. mu.g/mL kanamycin and 50. mu.g/mL chloramphenicol, and cultured overnight at 37 ℃ to obtain a genetically engineered bacterium KXRG03 in which CYP6 overexpressed and the GDH expression amount was reduced.

A single colony of the KXRG03 engineered bacterium was inoculated to a strain containing 100. mu.g/ml ampicillin and 50. mu.g/ml kanamycinThe mixture was shake-cultured at 37 ℃ for 12 hours in 5ml LB liquid medium containing 50. mu.g/ml chloramphenicol. Transferred to 50ml of fresh LB liquid medium containing 100. mu.g/ml ampicillin, 50. mu.g/ml kanamycin and 50. mu.g/ml chloramphenicol at 2% (v/v) inoculation amount, and shaken to OD at 37 ℃₆₀₀When the concentration reaches about 0.8, adding arabinose to the final concentration of 2g/L and IPTG to the final concentration of 0.5mM, and carrying out induction culture at 22 ℃ for 22 h. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting thalli (namely the KXRG03 bacterial sludge is prepared), and storing the thalli in a refrigerator at the temperature of-20 ℃ for later use.

Example 7 measurement of bacterial enzyme Activity

KXRG01 bacterial sludge, KXRG02 bacterial sludge and KXRG03 bacterial sludge in example 6 are respectively homogenized by phosphate buffer solution with pH7.450mM according to a ratio of 1:10, and supernatant is collected by centrifugation and used for enzyme activity determination.

2.5mL of the reaction system were added 100. mu.L of 125mM glucose, 50. mu.L of 25mM NADH, and 100. mu.L of 25mM MgCl₂VD of 100. mu.L 146mM ₃100. mu.L of enzyme solution, 0.125g of hydroxypropyl-. beta. -cyclodextrin, 2050. mu.L of 50mM phosphate buffer pH7.4, reacted at 200rpm for 60min at 30 ℃ on a shaker. Adding 200 μ L of the reaction solution into 400 μ L of absolute ethanol, shaking for 5min, adding 400 μ L of acetonitrile, centrifuging, filtering the supernatant, and detecting by HPLC. And calculating the enzyme activity according to the ossifying glycol standard curve. The results obtained are shown in the following Table 10-1.

The enzyme activity is defined as: under the specified conditions (30 ℃, pH 7.4), the amount of enzyme required to convert 1 nanomole of substrate or to produce 1 nanomole of product in 1 minute is one activity unit (U).

TABLE 10-1

EXAMPLE 8 Synthesis of calcifediol/calcitriol by KXRG Strain

KXRG01, KXRG02 and K prepared in example 6 were weighed2g of XRG03 bacterial sludge (the enzyme activities of KXRG01, KXRG02 and KXRG03 can be calculated to be 747U/g, 871U/g and 949U/g bacterial sludge respectively from the example 7, so that the enzyme activity concentrations of KXRG01, KXRG02 and KXRG03 in the example are 14940U/L, 17420U/L and 18980U/L respectively), and VD as a substrate is added₃To a final concentration of 1g/L (methanol pre-dissolved, VD3 mother liquor concentration of 10g/L), adding glucose with 3 times of substrate molar equivalent (i.e. final concentration of 1.4g/L), adding NAD with 0.1 times of substrate molar equivalent⁺(i.e., final concentration of 0.17g/L), and finally 0.1M PBS7.4 was added to a final volume of 100 mL. 220rpm, 28 ℃ for 14h, the results are shown in Table 11.

As can be seen from Table 11, the use of KXRG01, KXRG02 and KXRG03 all lead to the synthesis of higher yields of calcifediol, all above 335 mg/L; meanwhile, the KXRG01, the KXRG02 and the KXRG03 can synthesize calcitriol with higher yield, the yield is over 78mg/L, and the yield of the calcitriol synthesized by the KXRG02 and the KXRG03 is over 152 mg/L. The KXRG03 is used as a catalyst, so that the yield of the calcitriol and the calcitriol is the highest, and the KXRG03 is selected as the catalyst for condition optimization in subsequent experiments.

TABLE 11

	Ossifying glycol (mg/L)	Calcitriol (mg/L)
			KXRG01	335	78
KXRG02	361	152
			KXRG03	393	188

Example 9 Process optimization for Synthesis of calcifediol/calcitriol with KXRG03

9.1 Co-solvent selection

Weighing 2g of KXRG03 bacterial sludge, adding a substrate VD₃To a final concentration of 1g/L (different cosolvent pre-dissolved, VD3 mother liquor concentration of 10g/L), adding glucose with 3 times of substrate molar equivalent (i.e. final concentration of 1.4g/L), adding NAD with 0.1 times of substrate molar equivalent⁺(i.e., final concentration of 0.17g/L), and finally 0.1M PBS7.4 was added to a final volume of 100 mL. 220rpm, 28 ℃ for 14 h. The effect of different co-solvents on the synthetic calcifediol/calcitriol is shown in table 12.

As can be seen from Table 12, the cosolvent DMSO, Tween 80, Triton X100, methanol, ethanol and DMF have good effect, the yield of the calcitriol is over 105mg/L, and the yield of the calcitriol is over 131 mg/L; and the yield of the calcitriol is over 335mg/L when methanol, ethanol and DMF are used, and the yield of the calcitriol is over 255 mg/L. Wherein, when methanol is used as the cosolvent, the yields of the calcitriol and the calcitriol are the highest, so the methanol is selected as the cosolvent in the subsequent experiments.

TABLE 12

	Ossifying glycol (mg/L)	Calcitriol (mg/L)
			DMSO	346	191
Tween 80	105	131
			Triton X100	257	245
Methanol	389	267
			Ethanol	335	255
DMF (N, N-dimethylformamide)	367	259

9.2 selection of hydroxypropyl-. beta. -Cyclodextrin (HP-. beta. -CD) concentration

Weighing 2g of KXRG03 bacterial sludge, adding HP-beta-CD (for assisting dissolution) with different concentrations, and adding a substrate VD₃To a final concentration of 1g/L (methanol pre-dissolved, VD3 mother liquor concentration of 10g/L), adding glucose with 3 times of substrate molar equivalent (i.e. final concentration of 1.4g/L), adding NAD with 0.1 times of substrate molar equivalent⁺(i.e., final concentration of 0.17g/L), 0.1MPBS7.4 was added to a final volume of 100 mL. 220rpm, 28 ℃ for 14 h. The effect of HP- β -CD concentration on the synthesis of calcifediol/calcitriol is shown in table 13.

As can be seen from Table 13, the production of both calcitriol and calcitriol was already high at an HP- β -CD concentration of 0, while the production of both calcitriol and calcitriol was increased when the HP- β -CD concentration was increased. The yields of calcitriol and calcitriol were highest when HP- β -CD was added to a final concentration of 0.25% (mass to volume), so that the amount of HP- β -CD added was selected in subsequent experiments to a final concentration of 0.25%.

Watch 13

HP-beta-CD concentration (%, mass volume percent)	Ossifying glycol (mg/L)	Calcitriol (mg/L)
			0	324	129
0.05	355	159
			0.1	344	325
0.15	345	382
			0.2	335	415
0.25	328	494
			0.3	279	437
0.4	272	447

9.3 selection of temperature

Weighing 2g of KXRG03 bacterial sludge, adding HP-beta-CD with the final concentration of 0.25%, and adding a substrate VD₃To a final concentration of 1g/L (methanol pre-dissolved, VD3 mother liquor concentration of 10g/L), adding glucose with 3 times of substrate molar equivalent (i.e. final concentration of 1.4g/L), adding NAD with 0.1 times of substrate molar equivalent⁺(i.e., final concentration of 0.17g/L), buffer 0.1MPBS7.4 was added to a final volume of 100 mL. 220rpm, and reacting for 14h under different temperature conditions. The effect of temperature on the synthesis of calcifediol/calcitriol is shown in table 14.

As can be seen from Table 14, with increasing reaction temperature, both the production of calcitriol and the production of calcitriol were higher; and when the temperature is 22 ℃, the yield of the calcitriol and the calcitriol is the highest, so that the temperature of 22 ℃ is selected as the reaction temperature in subsequent experiments.

TABLE 14

Temperature (. degree.C.)	Ossifying glycol (mg/L)	Calcitriol (mg/L)
			20	318	571
22	322	595
			25	288	510
28	308	513
			30	366	506
33	441	316

Selection of pH 9.4

Weighing 2g of KXRG03 bacterial sludge, adding a substrate VD₃To a final concentration of 1g/L (methanol pre-dissolved, VD3 mother liquor concentration of 10g/L), adding glucose with 3 times of substrate molar equivalent (i.e. final concentration of 1.4g/L), adding NAD with 0.1 times of substrate molar equivalent⁺(i.e., final concentration of 0.17g/L), HP- β -CD was added at a final concentration of 0.25%, and 0.1M PBS was added at various pH values to a final volume of 100 mL. 220rpm, 22 ℃ and different pH conditions for 14 h. The effect of the pH of the reaction system on the yield of synthetic calcifediol/calcitriol is shown in Table 15.

As can be seen from Table 15, with increasing pH, the production of both calcitriol and calcitriol was high, and at pH 6.2-8.0, the production of calcitriol and calcitriol tended to be stable, the production of calcitriol was substantially in the range of 268-302mg/L, and the production of calcitriol was substantially in the range of 458-622 mg/L. Among them, the yields of calcitriol and calcitriol were highest when the pH was 7.4, so that the pH of 7.4 was selected as the reaction condition in the subsequent experiments.

Watch 15

9.5 selection of substrate concentration

Weighing 2g of KXRG03 bacterial sludge, adding substrates VD with different concentrations₃(methanol pre-dissolved, concentration of VD3 mother liquor is 10g/L), glucose with 3 times of substrate molar equivalent is added, NAD with 0.1 times of substrate molar equivalent is added⁺(i.e., final concentration of 0.17g/L), HP- β -CD was added at a final concentration of 0.25%, and finally buffer 0.1M PBS7.4 was added to a final volume of 100 mL. 220rpm, 22 ℃ for 14 h. The synthetic osteogenic diol/calcitriol concentrations at different reaction substrate concentrations are shown in table 16.

TABLE 16

The results show that when the substrate concentration is increased above 1.4g/L, the amount of calcitriol produced is instead reduced and the amount of calcitriol increases, indicating that the product is mainly present as calcitriol with increasing concentration. When the substrate VD₃The concentration of (A) is 1.8g/L, and the concentration of glucose reaches 2.5g/L, NAD⁺When the concentration of the compound reaches 0.31g/L, the yield of the calcifediol reaches 1024 mg/L; when the substrate VD₃The concentration of (A) is 1.4g/L, and the concentration of glucose reaches 2.0g/L, NAD⁺When the concentration of the calcitriol reaches 0.24g/L, the yield of the calcitriol is up to 719 mg/L.

9.6 addition of substrate in portions to synthetic ossifying glycol

Weighing 2g of KXRG03 bacterial sludge, adding HP-beta-CD with the final concentration of 0.25%, and adding the substrate vitamin D3 in a batch manner (batch addition manner is not adopted in the previous experiments), wherein the method specifically comprises the following steps: each time VD with a final concentration of 2.5g/L is added₃(methanol preparation, VD3 mother liquor concentration is 50g/L), 3 batches are added in total until VD₃The final concentration was 7.5 g/L. While adding substrate each time, glucose (i.e., 0.35g) was added in an amount of 3 times the molar equivalent of the substrate, and NAD was added in an amount of 0.1 times the molar equivalent of the substrate⁺(i.e., 0.043 g). Finally buffer 0.1M PBS7.4 was added to a final volume of 100 mL. The reaction was carried out at 220rpm, 22 ℃ and samples were taken periodically to determine the substrate and product concentrations. The detection result after 6 hours of reaction is shown in figure 2, the retention time is 18.650min is VD3, 10.840min is calcifediol, and 9.040min is calcitriol. Wherein, VD3, calcifediol and calcitriol are shown in the map of the control product in figures 3, 4 and 5. As can be seen from fig. 3-5, the retention time of VD3 control was 19.020min, the retention time of calcifediol control was 10.920min, and the retention time of calcitriol control was 9.078 min. It can be seen that under the conditions of this synthesis, the product obtained is mainly calcitriol, the amount of calcitriol being very small. The results of the batch-fed synthesis of calcifediol are shown in fig. 1. By adding 3 batches of VD3, the yield of the ossification glycol is increased continuously along with the time, and the yield can reach 5.9g/L when the reaction time reaches 7 hours.

SEQUENCE LISTING

<110> Korea chess, Korea biological medicine science and technology Limited

<120> genetically engineered bacterium and application thereof

<130> P19013608C

<160> 50

<170> PatentIn version 3.5

<210> 1

<211> 210

<212> PRT

<213> Streptomyces griseolus

<400> 1

Met Thr Asp Thr Ala Thr Thr Pro Gln Thr Thr Asp Ala Pro Ala Phe

1 5 10 15

Pro Ser Asn Arg Ser Cys Pro Tyr Gln Leu Pro Asp Gly Tyr Ala Gln

20 25 30

Leu Arg Asp Thr Pro Gly Pro Leu His Arg Val Thr Leu Tyr Asp Gly

35 40 45

Arg Gln Ala Trp Val Val Thr Lys His Glu Ala Ala Arg Lys Leu Leu

50 55 60

Gly Asp Pro Arg Leu Ser Ser Asn Arg Thr Asp Asp Asn Phe Pro Ala

65 70 75 80

Thr Ser Pro Ala Phe Glu Ala Val Arg Glu Ser Pro Gln Ala Phe Ile

85 90 95

Gly Leu Asp Pro Pro Glu His Gly Thr Arg Arg Arg Met Thr Ile Ser

100 105 110

Glu Phe Thr Val Lys Arg Ile Lys Gly Met Arg Pro Glu Val Glu Glu

115 120 125

Val Val His Gly Phe Leu Asp Glu Met Leu Ala Ala Gly Pro Thr Ala

130 135 140

Asp Leu Val Ser Gln Phe Ala Leu Pro Val Pro Ser Met Val Ile Cys

145 150 155 160

Arg Leu Leu Gly Val Pro Tyr Ala Asp His Glu Phe Phe Gln Asp Ala

165 170 175

Ser Lys Arg Leu Val Gln Ser Thr Asp Ala Gln Ser Ala Leu Thr Ala

180 185 190

Arg Asn Asp Leu Ala Gly Tyr Leu Asp Gly Leu Ile Thr Gln Phe Gln

195 200 205

Thr Glu

210

<210> 2

<211> 1228

<212> DNA

<213> Streptomyces griseolus

<400> 2

catatgaccg ataccgcaac caccccgcag accacagatg caccggcatt tccgagcaat 60

cgtagctgtc cgtatcagct gccggatggt tatgcccagc tgcgtgatac cccaggtccg 120

ctgcatcgtg ttaccctgta tgatggtcgt caggcatggg ttgtgaccaa acatgaagca 180

gcacgtaaac tgctgggtga tccacgtctg tcttcaaatc gcactgatga taattttccg 240

gcaacaagcc cggcatttga agcagttcgt gaatctccgc aggcatttat tggtctggac 300

ccgccggaac atggtacacg tcgtcgtatg accattagtg aatttacagt taaacgtatt 360

aaaggtatgc gtccagaagt tgaagaagtt gttcatggtt ttctggatga aatgctggca 420

gcaggtccga ccgcagattt agtgagtcag tttgcactgc cggttccgag catggttatt 480

tgtcgcctgc tgggtgtgcc gtatgcagat catgaatttt tccaggatgc aagtaaacgt 540

ttagttcagt ctacagatgc acagtcagcc ctgacagcac gtaatgatct ggcaggttat 600

ctggatggtc tgattaccca gtttcagacc gaaccgggtg caggtctggt gggtgcactg 660

gtggcagatc agctggcaaa tggtgaaatt gatcgtgaag aactgattag caccgccatg 720

ctgctgctga ttgcaggtca tgaaaccaca gcaagtatga ccagcctgag tgttattacc 780

ctgctggatc atcctgaaca gtatgcagca ctgcgtgcag atcgcagcct ggttcctggt 840

gcagttgaag aactgctgcg ttatctggca attgcagata ttgcaggtgg tcgtgttgca 900

accgctgata ttgaagttga aggtcagctg attcgtgcag gtgaaggtgt tattgttgtt 960

aatagtattg ctaatcgtga tggtaccgtt tatgaagatc cggatgcact ggatattcat 1020

cgtagtgcac gtcatcatct ggcttttggt tttggtgttc atcagtgtct gggtcagaat 1080

ctggcacgcc tggaactgga agttattctg aatgcactga tggatcgtgt tccgaccctg 1140

cgtctggcag ttccggttga acagctggtt ctgcgtccgg gtactaccat tcagggtgtt 1200

aatgaactgc cggttacctg gtaagctt 1228

<210> 3

<211> 403

<212> PRT

<213> Bacillus megaterium

<400> 3

Met Asn Pro Lys Ala Val Lys Arg Glu Asn Arg Tyr Ala Asn Leu Ile

1 5 10 15

Pro Met Gln Glu Ile Lys Ser Val Glu Gln Gln Leu Tyr Pro Phe Asp

20 25 30

Ile Tyr Asn Ser Leu Arg Gln Glu Ala Pro Ile Arg Tyr Asp Glu Ser

35 40 45

Arg Asn Cys Trp Asp Val Phe Asp Tyr Glu Thr Val Lys Tyr Ile Leu

50 55 60

Lys Asn Pro Ser Leu Phe Ser Ser Lys Arg Ala Met Glu Glu Arg Gln

65 70 75 80

Glu Ser Ile Leu Met Met Asp Pro Pro Lys His Thr Lys Leu Arg Asn

85 90 95

Leu Val Asn Lys Ala Phe Thr Pro Arg Ala Ile Gln His Leu Glu Gly

100 105 110

His Ile Glu Glu Ile Ala Asp Tyr Leu Leu Asp Glu Val Ser Ser Lys

115 120 125

Glu Lys Phe Asp Ile Val Glu Asp Phe Ala Gly Pro Leu Pro Ile Ile

130 135 140

Val Ile Ala Glu Leu Leu Gly Val Pro Ile Gln Asp Arg Ala Leu Phe

145 150 155 160

Lys Lys Tyr Ser Asp Asp Leu Val Ser Gly Ala Glu Asn Asn Ser Asp

165 170 175

Glu Ala Phe Ala Lys Met Met Gln Lys Arg Asn Glu Gly Val Ile Phe

180 185 190

Leu Gln Gly Tyr Phe Lys Glu Ile Ile Ala Glu Arg Gln Gln Asn Lys

195 200 205

Gln Glu Asp Leu Ile Ser Leu Leu Leu Glu Ala Glu Ile Asp Gly Glu

210 215 220

His Leu Thr Glu Glu Glu Val Leu Gly Phe Cys Ile Leu Leu Leu Val

225 230 235 240

Ala Gly Asn Glu Thr Thr Thr Asn Leu Ile Thr Asn Gly Val Arg Tyr

245 250 255

Met Thr Glu Asp Val Asp Val Gln Asn Glu Val Arg Arg Asp Ile Ser

260 265 270

Leu Val Pro Asn Leu Val Glu Glu Thr Leu Arg Tyr Tyr Pro Pro Ile

275 280 285

Gln Ala Ile Gly Arg Ile Ala Ala Glu Asp Val Glu Leu Gly Glu Cys

290 295 300

Lys Ile Lys Arg Gly Gln Gln Val Ile Ser Trp Ala Ala Ser Ala Asn

305 310 315 320

Arg Asp Ser Ala Lys Phe Glu Trp Pro Asp Thr Phe Val Val His Arg

325 330 335

Lys Thr Asn Pro His Val Ser Phe Gly Phe Gly Ile His Phe Cys Leu

340 345 350

Gly Ala Pro Leu Ala Arg Met Glu Gly Lys Ile Ala Phe Thr Lys Leu

355 360 365

Leu Glu Lys Gly Gly Phe Ser Lys Val Gln Asn Gln Ser Leu Lys Pro

370 375 380

Ile Asp Ser Pro Phe Val Phe Gly Val Lys Lys Tyr Glu Ile Ala Phe

385 390 395 400

Asn Asn Ala

<210> 4

<211> 1219

<212> DNA

<213> Bacillus megaterium

<400> 4

catatgaatc cgaaagccgt gaaacgcgaa aatcgctatg ccaacctgat tccgatgcag 60

gaaattaaaa gcgttgaaca gcagctgtat ccgtttgata tttataatag cctgcgtcag 120

gaagcaccga ttcgttatga tgaatcacgt aattgttggg atgtttttga ttatgaaaca 180

gttaaatata ttctgaaaaa tccgtcactg tttagctcta aacgtgcgat ggaagaacgc 240

caggaatcaa ttctgatgat ggacccgccg aaacacacca aactgcgtaa tctggttaat 300

aaagcgttta cccctcgtgc cattcagcat ctggaaggcc atattgaaga aatcgccgat 360

tatctgctgg atgaagtgag tagcaaagaa aaatttgata ttgttgaaga ttttgcaggt 420

ccgctgccga ttattgttat tgcggaactg ctgggcgttc cgattcagga tcgtgcgctg 480

tttaaaaaat atagcgatga tctggtgagc ggcgccgaaa ataattcaga tgaagcattt 540

gcaaaaatga tgcagaaacg taatgaaggt gtgatttttc tgcagggcta ttttaaagaa 600

attattgccg aacgtcagca gaataagcag gaagatctga ttagtctgct gctggaagcc 660

gaaattgatg gtgaacatct gacagaagaa gaagttctgg gtttttgtat tctgctgctg 720

gttgccggta atgaaaccac aaccaatctg attacaaatg gcgttcgtta tatgacggaa 780

gatgtcgatg ttcagaatga agtgcgccgt gatatttcac tggtgcctaa tttagttgaa 840

gaaacactga gatattatcc tcccattcag gcaataggta gaatcgcagc cgaagatgtt 900

gaattaggtg aatgtaaaat taaacgtggc cagcaggtga ttagctgggc ggcatctgca 960

aatcgtgata gcgcaaaatt tgaatggccg gatacctttg ttgttcatcg taaaaccaat 1020

ccgcatgtta gctttggttt tggcattcat ttttgtctgg gggcaccgct ggcgcgtatg 1080

gaaggcaaaa ttgcctttac caaactgtta gaaaaaggtg gtttttctaa agttcagaat 1140

cagagcctga aaccaattga tagcccgttt gttttcggtg tgaagaaata tgagatagca 1200

tttaataacg cgtaagctt 1219

<210> 5

<211> 507

<212> PRT

<213> Mus musculus

<400> 5

Met Thr Gln Ala Val Lys Leu Ala Ser Arg Val Phe His Arg Ile His

1 5 10 15

Leu Pro Leu Gln Leu Asp Ala Ser Leu Gly Ser Arg Gly Ser Glu Ser

20 25 30

Val Leu Arg Ser Leu Ser Asp Ile Pro Gly Pro Ser Thr Leu Ser Phe

35 40 45

Leu Ala Glu Leu Phe Cys Lys Gly Gly Leu Ser Arg Leu His Glu Leu

50 55 60

Gln Val His Gly Ala Ala Arg Tyr Gly Pro Ile Trp Ser Gly Ser Phe

65 70 75 80

Gly Thr Leu Arg Thr Val Tyr Val Ala Asp Pro Thr Leu Val Glu Gln

85 90 95

Leu Leu Arg Gln Glu Ser His Cys Pro Glu Arg Cys Ser Phe Ser Ser

100 105 110

Trp Ala Glu His Arg Arg Arg His Gln Arg Ala Cys Gly Leu Leu Thr

115 120 125

Ala Asp Gly Glu Glu Trp Gln Arg Leu Arg Ser Leu Leu Ala Pro Leu

130 135 140

Leu Leu Arg Pro Gln Ala Ala Ala Gly Tyr Ala Gly Thr Leu Asp Asn

145 150 155 160

Val Val Arg Asp Leu Val Arg Arg Leu Arg Arg Gln Arg Gly Arg Gly

165 170 175

Ser Gly Leu Pro Gly Leu Val Leu Asp Val Ala Gly Glu Phe Tyr Lys

180 185 190

Phe Gly Leu Glu Ser Ile Gly Ala Val Leu Leu Gly Ser Arg Leu Gly

195 200 205

Cys Leu Glu Ala Glu Val Pro Pro Asp Thr Glu Thr Phe Ile His Ala

210 215 220

Val Gly Ser Val Phe Val Ser Thr Leu Leu Thr Met Ala Met Pro Asn

225 230 235 240

Trp Leu His His Leu Ile Pro Gly Pro Trp Ala Arg Leu Cys Arg Asp

245 250 255

Trp Asp Gln Met Phe Ala Phe Ala Gln Arg His Val Glu Leu Arg Glu

260 265 270

Gly Glu Ala Ala Met Arg Asn Gln Gly Lys Pro Glu Glu Asp Met Pro

275 280 285

Ser Gly His His Leu Thr His Phe Leu Phe Arg Glu Lys Val Ser Val

290 295 300

Gln Ser Ile Val Gly Asn Val Thr Glu Leu Leu Leu Ala Gly Val Asp

305 310 315 320

Thr Val Ser Asn Thr Leu Ser Trp Thr Leu Tyr Glu Leu Ser Arg His

325 330 335

Pro Asp Val Gln Thr Ala Leu His Ser Glu Ile Thr Ala Gly Thr Arg

340 345 350

Gly Ser Cys Ala His Pro His Gly Thr Ala Leu Ser Gln Leu Pro Leu

355 360 365

Leu Lys Ala Val Ile Lys Glu Val Leu Arg Leu Tyr Pro Val Val Pro

370 375 380

Gly Asn Ser Arg Val Pro Asp Arg Asp Ile Arg Val Gly Asn Tyr Val

385 390 395 400

Ile Pro Gln Asp Thr Leu Val Ser Leu Cys His Tyr Ala Thr Ser Arg

405 410 415

Asp Pro Thr Gln Phe Pro Asp Pro Asn Ser Phe Asn Pro Ala Arg Trp

420 425 430

Leu Gly Glu Gly Pro Thr Pro His Pro Phe Ala Ser Leu Pro Phe Gly

435 440 445

Phe Gly Lys Arg Ser Cys Ile Gly Arg Arg Leu Ala Glu Leu Glu Leu

450 455 460

Gln Met Ala Leu Ser Gln Ile Leu Thr His Phe Glu Val Leu Pro Glu

465 470 475 480

Pro Gly Ala Leu Pro Ile Lys Pro Met Thr Arg Thr Val Leu Val Pro

485 490 495

Glu Arg Ser Ile Asn Leu Gln Phe Val Asp Arg

500 505

<210> 6

<211> 1531

<212> DNA

<213> Mus musculus

<400> 6

catatgaccc aggcagttaa actggcatca cgtgtttttc atcgtattca tctgccgctg 60

cagctggatg catcactggg tagccgcggt agcgaaagtg ttctgcgtag tctgagtgat 120

attccgggtc cgagcacact gtcattttta gcagaactgt tttgtaaagg tggtctgtcc 180

cgtctgcatg aactgcaggt tcatggtgca gcacgttatg gtccgatttg gagtggtagc 240

tttggtacac tgcgtaccgt ttatgttgca gatccgaccc tggttgaaca gctgctgcgt 300

caggaaagcc attgtcctga acgttgtagc ttttcttctt gggcagaaca tcgtcgccgt 360

catcagcgtg catgtggtct gctgacagca gatggtgaag aatggcagcg tctgcgtagt 420

ctgctggcac cgctgttact gcgtccgcag gcagcagcag gctatgcggg tacactggat 480

aatgttgttc gtgatctggt gcgccgcctg cgtcgtcagc gtggtcgtgg tagtggtctg 540

ccgggtctgg ttctggatgt tgcaggtgaa ttttataaat ttggtctgga aagcattggt 600

gcagttctgt taggtagccg tctgggttgt ctggaagccg aagttccgcc ggatacagaa 660

acctttattc atgcagttgg ttcagttttt gttagcaccc tgttaacaat ggcaatgccg 720

aattggttac atcatctgat tccgggtccg tgggcacgtc tgtgtcgtga ttgggatcag 780

atgtttgcat ttgcccagcg ccatgttgaa ttacgtgaag gtgaagcagc aatgcgtaat 840

cagggtaaac cagaagaaga tatgccgtct ggtcatcatc tgacccattt tctgtttcgt 900

gaaaaagtta gtgttcagag cattgttggt aatgttaccg aactgctgct ggcaggtgtt 960

gataccgtga gtaataccct gtcatggacc ctgtatgaac tgagtagaca tccggatgtt 1020

cagaccgctc tgcatagtga aattacagca ggtacacgtg gcagctgtgc acatccgcat 1080

ggtacagcgc tgagtcagct gccgctgctg aaagcagtga ttaaagaagt tctgcgtctg 1140

tatccggttg ttccgggtaa tagtcgtgtg ccggatcgtg atattcgtgt tggtaattat 1200

gttattccgc aggataccct ggttagtctg tgtcattatg ccacctcacg tgatccgacc 1260

cagtttcctg atccgaatag ttttaatccg gcccgttggc tgggtgaagg tccgaccccg 1320

catccgtttg ccagcctgcc gtttggtttt ggtaaacgta gctgtattgg tcgccgtctg 1380

gcagaactgg aactgcagat ggcactgagt cagattctga cccattttga agtgctgccg 1440

gaaccgggtg cactgccgat taaaccgatg acccgtacag ttctggttcc ggaacgtagt 1500

attaatctgc agtttgttga tcgttaagct t 1531

<210> 7

<211> 403

<212> PRT

<213> Pseudonocardia autotrophica

<400> 7

Met Ala Leu Thr Thr Thr Gly Thr Glu Gln His Asp Leu Phe Ser Gly

1 5 10 15

Thr Phe Trp Gln Asn Pro His Pro Ala Tyr Ala Ala Leu Arg Ala Glu

20 25 30

Asp Pro Val Arg Lys Leu Ala Leu Pro Asp Gly Pro Val Trp Leu Leu

35 40 45

Thr Arg Tyr Ala Asp Val Arg Glu Ala Phe Val Asp Pro Arg Leu Ser

50 55 60

Lys Asp Trp Arg His Thr Leu Pro Glu Asp Gln Arg Ala Asp Met Pro

65 70 75 80

Ala Thr Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr

85 90 95

Arg Leu Arg Lys Leu Val Gly Arg Ser Phe Thr Val Arg Arg Met Asn

100 105 110

Glu Leu Glu Pro Arg Ile Thr Glu Ile Ala Asp Gly Leu Leu Ala Gly

115 120 125

Leu Pro Thr Asp Gly Pro Val Asp Leu Met Arg Glu Tyr Ala Phe Gln

130 135 140

Ile Pro Val Gln Val Ile Cys Glu Leu Leu Gly Val Pro Ala Glu Asp

145 150 155 160

Arg Asp Asp Phe Ser Ala Trp Ser Ser Val Leu Val Asp Asp Ser Pro

165 170 175

Ala Asp Asp Lys Asn Ala Ala Met Gly Lys Leu His Gly Tyr Leu Ser

180 185 190

Asp Leu Leu Glu Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser

195 200 205

Ser Leu Leu Ala Val Ser Asp Glu Asp Gly Asp Arg Leu Ser Gln Glu

210 215 220

Glu Leu Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr

225 230 235 240

Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro

245 250 255

Asp Gln Arg Lys Leu Leu Ala Glu Asp Pro Ser Leu Ile Ser Ser Ala

260 265 270

Val Glu Glu Phe Leu Arg Phe Asp Ser Pro Val Ser Gln Ala Pro Ile

275 280 285

Arg Phe Thr Ala Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala

290 295 300

Gly Glu Met Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Ala Asp

305 310 315 320

Trp Met Pro Glu Pro Asp Arg Leu Asp Ile Thr Arg Asp Ala Ser Gly

325 330 335

Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu

340 345 350

Ala Arg Leu Glu Gly Arg Val Ala Ile Gly Arg Leu Phe Ala Asp Arg

355 360 365

Pro Glu Leu Ala Leu Ala Val Gly Leu Asp Glu Leu Val Tyr Arg Glu

370 375 380

Ser Thr Leu Val Arg Gly Leu Ser Arg Met Pro Val Thr Met Gly Pro

385 390 395 400

Arg Ser Ala

<210> 8

<211> 1219

<212> DNA

<213> Pseudonocardia autotrophica

<400> 8

catatggcac tgaccaccac cggtaccgaa cagcatgatt tatttagtgg taccttttgg 60

cagaatccgc atccggccta tgcagcactg cgtgctgaag atccggttcg taaactggca 120

ctgccggatg gtccggtttg gctgctgacc cgttatgcag atgttcgtga agcatttgtt 180

gatccgcgtc tgagcaaaga ttggcgtcat accctgccgg aagatcagcg tgcagatatg 240

ccggcaacac cgaccccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300

aaactggttg gtcgtagctt taccgttcgt cgtatgaatg aactggaacc gcgtattact 360

gaaattgcag atggtctgct ggcaggtctg ccgaccgatg gtccggttga tctgatgcgt 420

gaatatgcat ttcagattcc ggttcaggtg atttgtgaac tgctgggtgt tccggcagaa 480

gatcgtgatg attttagcgc ctggagcagc gttctggttg atgatagccc ggcagatgat 540

aaaaatgcag caatgggtaa actgcatggt tatctgagtg atctgctgga acgtaaacgt 600

accgaaccgg atgatgcact gctgagcagc ctgctggcag ttagcgatga agatggtgat 660

cgtctgagcc aggaagaact ggttgctatg gcaatgctgc tgctgattgc aggtcatgaa 720

accaccgtta atctgattgg taatggtgtt ctggcactgc tgacccatcc ggatcagcgt 780

aaactgctgg cagaagatcc gtctctgata tctagtgccg ttgaggaatt tctgcgcttt 840

gatagccccg tgagtcaggc gccgatccgg tttactgctg aggatgtaac atatagcggc 900

gtgaccattc cggctggaga aatggtgatg ctgggccttg ccgcagcgaa ccgtgacgca 960

gattggatgc ccgaacctga ccgtctggat ataacgcggg atgcatcagg tggtgttttc 1020

tttggtcatg gtattcattt ttgtctgggt gcacagctgg cacgtctgga aggtcgtgtt 1080

gcaattggtc gtctgtttgc agatcgtccg gaactggcac tggcggttgg tctggatgaa 1140

ctggtttatc gtgaaagtac cctggttcgt ggtctgagcc gcatgccggt tacaatgggt 1200

ccgcgtagcg cataagctt 1219

<210> 9

<211> 403

<212> PRT

<213> Pseudonocardia ammonioxydans

<400> 9

Met Ala Leu Thr Thr Thr Gly Thr Glu Gln His Asp Leu Phe Ser Gly

1 5 10 15

Ala Phe Trp Gln Asp Pro His Pro Ala Tyr Thr Ala Leu Arg Asp Glu

20 25 30

Glu Pro Val Arg Lys Val Ala Leu Pro Asp Gly Glu Ala Trp Leu Ile

35 40 45

Thr Arg Tyr Ala Asp Val Arg Glu Ala Phe Val Asp Pro Arg Leu Ser

50 55 60

Lys Asp Trp Arg Tyr Arg Leu Pro Glu Asp Gln Arg Ala Gly Gln Pro

65 70 75 80

Ala Ala Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr

85 90 95

Arg Leu Arg Lys Leu Val Ser Arg Ser Phe Thr Val Arg Arg Met Asn

100 105 110

Glu Leu Arg Pro Arg Val Glu Glu Ile Ala Gln Glu Leu Leu Asp Arg

115 120 125

Leu Pro Ser Glu Gly Thr Val Asp Leu Met Arg Glu Tyr Ala Phe Gln

130 135 140

Val Pro Val Leu Val Ile Cys Glu Leu Leu Gly Leu Pro Ala Glu Asp

145 150 155 160

Arg Asp Asp Phe Ser Ala Trp Ser Ser Val Met Val Asp Glu Ser Pro

165 170 175

Ala Glu Glu Lys Phe Ala Ala Met Gly Lys Leu His Gly Tyr Leu Thr

180 185 190

Glu Leu Leu Glu Arg Lys Arg Thr Glu Pro Asp Glu Ala Leu Leu Ser

195 200 205

Ser Leu Leu Ala Val Ser Asp Met Asp Gly Asp Arg Leu Ser Ser Glu

210 215 220

Glu Leu Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr

225 230 235 240

Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro

245 250 255

Glu Gln Arg Ala Gln Leu Ala Ala Asp Pro Ser Leu Ile Thr Ser Ala

260 265 270

Val Glu Glu Phe Leu Arg Phe Glu Ser Pro Val Ser Asn Ala Pro Met

275 280 285

Arg Phe Thr Ser Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala

290 295 300

Gly Ser Thr Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Pro Glu

305 310 315 320

Trp Ala Glu Arg Pro Glu Glu Leu Asp Leu Gly Arg Asp Ser Ser Ala

325 330 335

Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu

340 345 350

Ala Arg Asn Glu Gly Arg Ala Ala Ile Gly Met Leu Leu Glu Gln Arg

355 360 365

Pro Glu Leu Ala Leu Ala Val Ala Pro Glu Glu Leu Thr Tyr Arg Arg

370 375 380

Ser Ser Leu Val Arg Gly Leu Thr Ser Met Pro Val Val Ala Gly Pro

385 390 395 400

Ala Ala Arg

<210> 10

<211> 1219

<212> DNA

<213> Pseudonocardia autotrophica

<400> 10

catatggcac tgaccaccac cggtaccgaa cagcatgatt tatttagcgg tgcattttgg 60

caagatccgc atccggcata taccgcactg cgtgatgaag aaccggttcg taaagttgca 120

ctgccggatg gtgaagcatg gctgattaca cgttatgcag atgttcgtga agcgtttgtt 180

gatccgcgtc tgagtaaaga ttggcgttat cgtctgccgg aagatcagcg cgccggccag 240

ccggcagcac cgaccccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300

aaactggttt cacgttcatt taccgttcgt cgtatgaatg aactgcgccc gcgtgttgaa 360

gaaattgcac aggaactgct ggatcgcctg ccgagtgaag gtacagttga tctgatgcgt 420

gaatatgcat ttcaggttcc ggttctggtt atttgtgaac tgctgggtct gccggcagaa 480

gatcgtgatg attttagcgc atggagtagt gttatggttg atgaaagccc ggcagaagaa 540

aaatttgctg caatgggtaa actgcatggt tatctgaccg aactgctgga acgtaaacgt 600

accgaacctg atgaagcact gctgtcttca ctgctggcgg tgagcgatat ggatggtgat 660

cgcctgtctt cagaagaact ggttgcaatg gcaatgctgc tgctgattgc aggtcatgaa 720

acgaccgtta atctgattgg taatggtgtg ctggccctgc tgacgcatcc ggaacagcgt 780

gctcagctgg cagccgatcc atctctgatt acctctgcag tagaagaatt tctgcgtttt 840

gaatctccgg ttagcaatgc accgatgcgt tttaccagcg aagatgtgac ctattctggt 900

gtgaccattc cggcgggtag taccgttatg ctgggtctgg ccgccgcgaa tcgtgatccg 960

gaatgggcag aacgtccgga agaactggat ctgggtcgtg atagttctgc cggtgttttc 1020

tttggtcatg gtattcattt ttgtctgggt gcccagctgg cacgtaatga aggtcgtgca 1080

gcaattggta tgctgctgga acagcgtccg gaactggccc tggcagttgc accggaagaa 1140

ctgacctatc gtcgtagctc tctggttcgt ggtctgacct ctatgccggt tgttgcaggt 1200

ccggcagcac gttaagctt 1219

<210> 11

<211> 402

<212> PRT

<213> Pseudonocardia sp. P2

<400> 11

Met Ala Leu Thr Thr Thr Gly Thr Glu Thr His Asp Leu Phe Ser Gly

1 5 10 15

Asp Phe Trp Thr Asp Pro His Pro Ala Tyr Ala Ala Leu Arg Thr Glu

20 25 30

Glu Pro Val Arg Glu Leu Ala Leu Pro Asp Gly Lys Val Trp Leu Ile

35 40 45

Ser Arg Tyr Ala Asp Val Arg Ala Ala Phe Val Asp Pro Arg Leu Ser

50 55 60

Lys Asp Trp Arg Tyr Arg Leu Pro Ala Asp Gln Arg Glu Gly Gln Pro

65 70 75 80

Ala Ala Pro Ile Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr

85 90 95

Arg Leu Arg Lys Leu Val Gly Arg Ser Phe Thr Val Arg Arg Met Asn

100 105 110

Asp Leu Gln Pro Arg Val Glu Glu Ile Thr Gln Glu Leu Leu Asp Ala

115 120 125

Leu Pro Ala Ala Gly Pro Val Asp Leu Met Arg Gln Tyr Ala Phe Leu

130 135 140

Val Pro Val Leu Val Ile Cys Glu Leu Leu Gly Leu Pro Ala Glu Asp

145 150 155 160

Arg Asp Lys Phe Ser Ala Trp Ser Ser Val Leu Val Asp Asp Ser Pro

165 170 175

Gln Glu Glu Lys Phe Ala Ala Met Gly Ser Leu Asn Gly Tyr Leu Ala

180 185 190

Glu Leu Ile Glu Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser

195 200 205

Gly Leu Leu Ala Val Ser Asp Met Asp Gly Asp Arg Leu Ser Ser Glu

210 215 220

Glu Leu Val Ala Met Ala Thr Leu Leu Leu Ile Ala Gly His Glu Thr

225 230 235 240

Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro

245 250 255

Glu Gln His Ala Arg Leu Lys Ala Asp Pro Ser Leu Ile Asn Ser Ala

260 265 270

Val Glu Glu Phe Leu Arg Phe Glu Ser Pro Val Ser Asn Ala Pro Met

275 280 285

Arg Phe Ala Ser Glu Asp Val Glu Tyr Ser Gly Val Thr Ile Pro Ala

290 295 300

Gly Ser Thr Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Pro Glu

305 310 315 320

Trp Leu Ala Asp Pro Asp Arg Leu Asp Ile Thr Arg Asp Ser Ser Ser

325 330 335

Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu

340 345 350

Ala Arg Thr Glu Gly Arg Val Ala Ile Gly Lys Leu Ile Ala Gln Arg

355 360 365

Pro Asp Leu Ala Leu Ala Val Asp Pro Ser Glu Leu Val Tyr Arg Arg

370 375 380

Ser Thr Leu Val Arg Gly Leu Ser Arg Leu Pro Val Thr Pro Gly Ala

385 390 395 400

Pro Ala

<210> 12

<211> 1216

<212> DNA

<213> Pseudonocardia sp. P2

<400> 12

catatggcac tgaccaccac cggtaccgaa acccatgatt tatttagtgg tgatttttgg 60

acagatccgc atccggccta tgcagcactg cgtacagaag aaccggttcg tgaactggcc 120

ctgccggatg gtaaagtttg gctgattagt cgttatgcag atgttcgtgc agcatttgtt 180

gatccgcgtc tgagtaaaga ttggcgttat cgtctgccgg cagatcagcg tgaaggtcag 240

ccggcagcac cgattccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300

aaactggttg gtcgtagttt taccgttcgc cgtatgaatg atctgcagcc gcgcgttgaa 360

gaaattaccc aggaactgct ggatgcactg ccggcagcgg gtccggttga tctgatgcgc 420

cagtatgcat ttctggttcc ggttctggtt atttgtgaac tgctgggtct gccggcagaa 480

gatcgtgata aatttagtgc atggagtagc gttctggttg atgatagccc gcaggaagaa 540

aaatttgcag caatgggttc tctgaatggt tatctggcag aactgattga acgtaaacgc 600

accgaaccgg atgatgcact gctgagcggt ctgctggcag ttagcgatat ggatggtgat 660

cgtctgagca gcgaagaact ggttgcaatg gcaaccctgc tgctgattgc aggtcatgaa 720

accactgtga atctgattgg taatggtgtt ctggcactgc tgacccatcc ggaacagcat 780

gcacgtctga aagcagatcc gagcctgatt aattctgcag ttgaagaatt tctgcgtttt 840

gaaagcccgg ttagtaatgc accgatgcgt tttgcaagtg aagatgttga atatagcggt 900

gttaccattc cggcaggtag taccgttatg ctgggtctgg cagcagcaaa tcgcgatccg 960

gaatggctgg ctgatccgga tcgtctggat attacccgtg atagcagtag tggtgttttc 1020

tttggtcatg gtattcattt ttgtctgggt gcacagctgg cacgtaccga aggtcgtgtt 1080

gcaattggta aactgattgc acagcgtcct gatctggcac tggcggttga tccgtctgaa 1140

ctggtttatc gtcgttcaac cctggttcgt ggtctgagtc gtctgccggt tacaccgggt 1200

gcaccggcct aagctt 1216

<210> 13

<211> 398

<212> PRT

<213> Pseudonocardia autotrophica

<400> 13

Met Ala Pro Thr Thr Thr Ser Gly Leu Glu Leu Phe Asp Gly Pro Phe

1 5 10 15

Trp Ser Asp Pro Tyr Pro Ala Tyr Ala Glu Leu Arg Ala Asp Glu Pro

20 25 30

Val Arg Arg Leu Asp Leu Pro Asp Gly Pro Met Trp Ile Ile Ala Arg

35 40 45

Tyr Glu Asp Ala Arg Ala Ala Phe Val Asp Ala Arg Phe Ser Lys Asp

50 55 60

Trp Arg Tyr Thr Leu Arg Ala Asp Gln Arg Ala Ala Met Pro Ala Ala

65 70 75 80

Pro Thr Pro Met Met Leu Leu Leu Asp Pro Pro Asp His Thr Arg Leu

85 90 95

Arg Lys Leu Val Ser Arg Ser Phe Thr Ala Arg Arg Met Ala Gly Leu

100 105 110

Arg Pro Arg Val Gln Glu Ile Ala Asp Asp Leu Leu Ala Asp Leu Pro

115 120 125

Ala Gly Gly Thr Val Asp Leu Met Ala His Tyr Ala Phe Leu Leu Pro

130 135 140

Val Arg Val Ile Cys Glu Leu Leu Gly Val Pro Leu Glu Asp Arg Asp

145 150 155 160

Asp Phe Gly Arg Trp Ser Ser Thr Met Ile Asp Glu Ser Pro Gln Asp

165 170 175

Glu Lys Phe Ala Ala Ser Gln Lys Leu Ser Glu Tyr Leu Ala Gly Leu

180 185 190

Ile Asp Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser Ala Leu

195 200 205

Thr Gln Val Ser Asp Glu Asp Met Asp Ala Leu Ser Gln Glu Glu Leu

210 215 220

Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr Thr Val

225 230 235 240

Asn Leu Ile Gly Asn Gly Ile Leu Gly Leu Leu Thr His Pro Glu Gln

245 250 255

Arg Glu Ile Leu Ala Asp Lys Pro Glu Leu Trp Pro Ser Ala Val Glu

260 265 270

Glu Phe Leu Arg Trp Asp Ser Pro Val Thr Asn Ala Pro Val Arg Phe

275 280 285

Ala Ala Glu Asp Val Glu Val Ala Gly Thr Thr Ile Pro Glu Gly Ala

290 295 300

Val Val Met Leu Gly Ile Ala Ala Ala Asn Arg Asp Asp Ala Arg Phe

305 310 315 320

Ala Asp Ala Ala Arg Leu Asp Val Ser Arg Asp Asp Arg Gly His Leu

325 330 335

Ala Phe Gly Tyr Gly Leu His His Cys Leu Gly Ala Pro Leu Ala Arg

340 345 350

Ile Glu Gly Glu Val Ala Leu Arg Ser Leu Phe Thr Ala Arg Pro Asp

355 360 365

Met Ala Leu Ala Ala Ser Asp Leu Thr His Arg Arg Ser Thr Leu Arg

370 375 380

Arg Gly Val Thr Glu Leu Pro Val Arg Leu Gly Glu Pro Ala

385 390 395

<210> 14

<211> 1204

<212> DNA

<213> Pseudonocardia autotrophica

<400> 14

catatggcac cgaccaccac ctcaggcctg gaactgtttg atggtccgtt ttggagtgat 60

ccgtatccgg cctatgccga actgcgtgca gatgaaccgg ttcgtcgtct ggatctgccg 120

gatggtccga tgtggattat tgcacgttat gaagatgcac gtgcagcatt tgttgatgca 180

cgttttagca aagattggcg ttataccctg cgtgcagatc agcgtgcagc aatgccggct 240

gcaccgacac cgatgatgct gctgctggac ccgccggatc atacccgtct gcgcaaactg 300

gttagtcgta gttttaccgc acgtcgcatg gcaggtctgc gtccgcgcgt tcaggaaatt 360

gcagatgatc tgctggcaga tctgccggca ggcggtaccg ttgatctgat ggcacattat 420

gcatttctgc tgccggttcg tgttatttgt gaactgctgg gtgttccgct ggaagatcgt 480

gatgattttg gtcgttggag cagtaccatg attgatgaat ctccgcagga tgaaaaattt 540

gcagcatcac agaaactgag cgaatatctg gcaggcctga ttgatcgtaa acgtacagaa 600

cctgatgatg cgctgctgag tgcactgacc caggtgagtg atgaagatat ggatgcgctg 660

tctcaggaag aactggtggc aatggccatg ctgctgctga ttgcaggtca tgaaaccacc 720

gttaatctga ttggtaatgg tattctggga ctgctgaccc atccggaaca gcgtgaaatt 780

ctggcagata aaccggaact gtggccttca gccgttgaag aatttctgcg ttgggatagc 840

ccggtgacaa atgcaccggt tcgctttgct gcagaagatg ttgaagttgc aggtacaacc 900

attccggaag gtgcagttgt tatgctgggt attgcagcag caaatcgtga tgatgcgcgt 960

tttgcagatg cagcacgtct ggatgtttct cgtgatgatc gcggtcatct ggcatttggt 1020

tatggtctgc atcattgtct gggtgcgccg ctggcacgta ttgaaggtga agttgcactg 1080

cgcagcctgt ttaccgcgcg tccggatatg gcactggcag ccagtgatct gacccatcgt 1140

cgttcaaccc tgcgtcgtgg tgttaccgaa ctgccggttc gtctgggtga accggcataa 1200

gctt 1204

<210> 15

<211> 402

<212> PRT

<213> Pseudonocardia endophytica

<400> 15

Met Thr Val Thr Thr Ile Gly Ser Glu Arg His Glu Leu Phe Glu Gly

1 5 10 15

Ser Phe Phe Ala Asp Pro His Pro Ala Leu Ala Ala Leu Arg Glu His

20 25 30

Asp Pro Val Ser Arg Leu Glu Leu His Gly Gly Thr Thr Trp Leu Leu

35 40 45

Ser Arg His Ala Asp Val Arg Ala Ala Leu Thr Asp Pro Arg Val Ser

50 55 60

Lys Asp Trp Arg Trp Arg Leu Pro Pro Glu Glu Arg Glu Lys His Pro

65 70 75 80

Ala Ala Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Glu His Thr

85 90 95

Arg Leu Arg Lys Leu Val Ser Arg Ser Phe Thr Val Arg Arg Met Asn

100 105 110

Glu Gln Lys Pro Arg Val Gln Glu Ile Ala Ser Ala Leu Val Ala Asp

115 120 125

Leu Pro Glu Thr Gly Thr Val Asp Leu Met Thr Ala Tyr Ala Phe Gln

130 135 140

Ile Pro Val Tyr Val Ile Cys Glu Met Leu Gly Leu Pro Val Glu Asp

145 150 155 160

Arg Asp Asp Phe Gly Ala Trp Thr Lys Ala Leu Val Asp Asn Ser Gly

165 170 175

Asp Glu Ala Thr Met Gly Ala Met Gly Lys Leu Asn Gly Tyr Leu Gly

180 185 190

Glu Leu Ile Glu Arg Lys Arg Ser Glu Pro Asp Asp Lys Leu Leu Ala

195 200 205

Ala Leu Ile Glu Val Ala Asp Met Asp Gly Asp Arg Leu Ser Pro Asp

210 215 220

Glu Leu Leu Ala Met Thr Met Leu Leu Leu Ile Ala Gly His Glu Thr

225 230 235 240

Thr Val Asn Leu Ile Gly Asn Gly Leu Arg Ala Leu Leu Thr His Pro

245 250 255

Glu Gln His Ala Thr Leu Lys Ala Asp Pro Gly Leu Leu Asp Ser Ala

260 265 270

Val Glu Glu Met Leu Arg Tyr Asp Thr Pro Val Ala Gln Thr Pro Ala

275 280 285

Arg Phe Thr Ser Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala

290 295 300

Gly Gln Met Val Met Tyr Ser Leu Ser Ala Ala Asn Arg Asp Pro Arg

305 310 315 320

Trp Val Gln Asp Pro Asp Thr Phe Asp Ile Thr Arg Gln Thr Ser Gly

325 330 335

Ala Ile Tyr Phe Ala His Gly Asn His His Cys Ile Gly Ala Gln Leu

340 345 350

Ala Arg Ile Glu Gly Arg Val Ala Ile Gly Thr Leu Val Ala Asp Arg

355 360 365

Pro Glu Leu Ala Leu Ala Val Asp Pro Ser Glu Leu Gly Tyr Arg Arg

370 375 380

Ser Ser Leu Ile Arg Gly Leu Thr Ser Leu Pro Val Thr Pro Gly Pro

385 390 395 400

Arg Ala

<210> 16

<211> 1216

<212> DNA

<213> Pseudonocardia endophytica

<400> 16

catatgaccg ttaccaccat tggtagtgaa cgtcatgaac tgtttgaagg tagcttcttt 60

gcagatccgc atccggcact ggccgcactg cgtgaacatg atccggttag tcgtctggaa 120

ctgcatggtg gtacaacctg gctgctgagc cgtcatgcag atgttcgtgc agctctgacc 180

gatccgcgcg ttagtaaaga ttggcgctgg cgtctgccgc cggaagaacg tgaaaaacat 240

ccggcagcac cgaccccgat gatgattctg atggaccctc cggaacatac ccgcctgcgt 300

aaactggtga gccgtagctt taccgttcgt cgtatgaatg aacagaaacc gcgtgttcag 360

gaaattgcat cagcgctggt tgctgatctg ccggaaaccg gtaccgttga tctgatgacc 420

gcctatgcat ttcagattcc ggtttatgtg atttgtgaaa tgctgggtct gccggttgaa 480

gatcgtgatg attttggcgc atggaccaaa gcactggttg ataattcagg tgatgaagca 540

actatgggtg cgatgggtaa actgaatggt tatctgggtg aactgattga acgtaaacgc 600

agtgaaccgg atgataaact gctggcggca ctgattgaag ttgctgatat ggatggtgat 660

cgcctgagcc cggatgaact gctggcaatg accatgctgc tgctgattgc aggtcatgaa 720

acaaccgtta atctgattgg taatggtctg cgtgcactgc tgacccatcc ggaacagcat 780

gcgaccctga aagcagatcc gggtctgctg gattcagcag tggaagaaat gctgcgctat 840

gataccccgg ttgcacagac cccggcccgt tttacatcag aagatgttac ctatagtggt 900

gtgaccattc cggcaggtca gatggttatg tatagtctga gcgcagcaaa tcgtgatccg 960

cgttgggttc aagatccgga tacctttgat attacacgtc agaccagtgg tgcgatttat 1020

tttgcacatg gtaatcatca ttgtattggt gcacagctgg cgcgcattga aggtcgcgtt 1080

gcaattggta cactggttgc agatcgtccg gaactggcac tggcggttga tccgagcgaa 1140

ctgggttatc gtcgtagcag cctgattcgt ggtctgacca gtctgccggt tacaccgggt 1200

ccgcgtgcat aagctt 1216

<210> 17

<211> 185

<212> PRT

<213> Bos taurus

<400> 17

Ala Ala Arg Leu Leu Arg Val Ala Ser Ala Ala Leu Gly Asp Thr Ala

1 5 10 15

Gly Arg Trp Arg Leu Leu Ala Arg Pro Arg Ala Gly Ala Gly Gly Leu

20 25 30

Arg Gly Ser Arg Gly Pro Gly Leu Gly Gly Gly Ala Val Ala Thr Arg

35 40 45

Thr Leu Ser Val Ser Gly Arg Ala Gln Ser Ser Ser Glu Asp Lys Ile

50 55 60

Thr Val His Phe Ile Asn Arg Asp Gly Glu Thr Leu Thr Thr Lys Gly

65 70 75 80

Lys Ile Gly Asp Ser Leu Leu Asp Val Val Val Gln Asn Asn Leu Asp

85 90 95

Ile Asp Gly Phe Gly Ala Cys Glu Gly Thr Leu Ala Cys Ser Thr Cys

100 105 110

His Leu Ile Phe Glu Gln His Ile Phe Glu Lys Leu Glu Ala Ile Thr

115 120 125

Asp Glu Glu Asn Asp Met Leu Asp Leu Ala Tyr Gly Leu Thr Asp Arg

130 135 140

Ser Arg Leu Gly Cys Gln Ile Cys Leu Thr Lys Ala Met Asp Asn Met

145 150 155 160

Thr Val Arg Val Pro Asp Ala Val Ser Asp Ala Arg Glu Ser Ile Asp

165 170 175

Met Gly Met Asn Ser Ser Lys Ile Glu

180 185

<210> 18

<211> 568

<212> DNA

<213> Bos taurus

<400> 18

catatggccg cacgtctgct gcgtgttgca agcgcagcac tgggtgatac cgcaggtcgt 60

tggcgtctgc tggcacgtcc gcgtgcaggt gcaggtggtc tgcgtggtag ccgtggtccg 120

ggtctgggtg gtggtgcagt tgcaacccgt accctgagcg ttagcggtcg tgcacagagc 180

agcagcgaag ataaaattac cgttcatttt attaatcgtg atggtgaaac cctgaccacc 240

aaaggtaaaa ttggtgatag cctgctggat gttgttgttc agaataatct ggatattgat 300

ggttttggtg catgtgaagg taccctggca tgtagcacct gtcatctgat ttttgaacag 360

catatttttg aaaaactgga agcaattacc gatgaagaaa atgatatgct ggatctggcc 420

tatggtctga ccgatcgtag tcgtctgggt tgtcagattt gtctgaccaa agcaatggat 480

aatatgaccg ttcgtgttcc ggatgcagtt agcgatgcac gtgaaagcat tgatatgggt 540

atgaatagca gcaaaattga ataagctt 568

<210> 19

<211> 497

<212> PRT

<213> Bos taurus

<400> 19

Ala Pro Arg Cys Trp Arg Trp Trp Pro Trp Ser Ser Trp Thr Arg Thr

1 5 10 15

Arg Leu Pro Pro Ser Arg Ser Ile Gln Asn Phe Gly Gln His Phe Ser

20 25 30

Thr Gln Glu Gln Thr Pro Gln Ile Cys Val Val Gly Ser Gly Pro Ala

35 40 45

Gly Phe Tyr Thr Ala Gln His Leu Leu Lys His His Ser Arg Ala His

50 55 60

Val Asp Ile Tyr Glu Lys Gln Leu Val Pro Phe Gly Leu Val Arg Phe

65 70 75 80

Gly Val Ala Pro Asp His Pro Glu Val Lys Asn Val Ile Asn Thr Phe

85 90 95

Thr Gln Thr Ala Arg Ser Asp Arg Cys Ala Phe Tyr Gly Asn Val Glu

100 105 110

Val Gly Arg Asp Val Thr Val Gln Glu Leu Gln Asp Ala Tyr His Ala

115 120 125

Val Val Leu Ser Tyr Gly Ala Glu Asp His Gln Ala Leu Asp Ile Pro

130 135 140

Gly Glu Glu Leu Pro Gly Val Phe Ser Ala Arg Ala Phe Val Gly Trp

145 150 155 160

Tyr Asn Gly Leu Pro Glu Asn Arg Glu Leu Ala Pro Asp Leu Ser Cys

165 170 175

Asp Thr Ala Val Ile Leu Gly Gln Gly Asn Val Ala Leu Asp Val Ala

180 185 190

Arg Ile Leu Leu Thr Pro Pro Asp His Leu Glu Val Leu Leu Leu Cys

195 200 205

Gln Lys Thr Asp Ile Thr Glu Ala Ala Leu Gly Ala Leu Arg Gln Ser

210 215 220

Arg Val Lys Thr Val Trp Ile Val Gly Arg Arg Gly Pro Leu Gln Val

225 230 235 240

Ala Phe Thr Ile Lys Glu Leu Arg Glu Met Ile Gln Leu Pro Gly Thr

245 250 255

Arg Pro Met Leu Asp Pro Ala Asp Phe Leu Gly Leu Gln Asp Arg Ile

260 265 270

Lys Glu Ala Ala Arg Pro Arg Lys Arg Leu Met Glu Leu Leu Leu Arg

275 280 285

Thr Ala Thr Glu Lys Pro Gly Val Glu Glu Ala Ala Arg Arg Ala Ser

290 295 300

Ala Ser Arg Ala Trp Gly Leu Arg Phe Phe Arg Ser Pro Gln Gln Val

305 310 315 320

Leu Pro Ser Pro Asp Gly Arg Arg Ala Ala Gly Ile Arg Leu Ala Val

325 330 335

Thr Arg Leu Glu Gly Ile Gly Glu Ala Thr Arg Ala Val Pro Thr Gly

340 345 350

Asp Val Glu Asp Leu Pro Cys Gly Leu Val Leu Ser Ser Ile Gly Tyr

355 360 365

Lys Ser Arg Pro Ile Asp Pro Ser Val Pro Phe Asp Pro Lys Leu Gly

370 375 380

Val Val Pro Asn Met Glu Gly Arg Val Val Asp Val Pro Gly Leu Tyr

385 390 395 400

Cys Ser Gly Trp Val Lys Arg Gly Pro Thr Gly Val Ile Thr Thr Thr

405 410 415

Met Thr Asp Ser Phe Leu Thr Gly Gln Ile Leu Leu Gln Asp Leu Lys

420 425 430

Ala Gly His Leu Pro Ser Gly Pro Arg Pro Gly Ser Ala Phe Ile Lys

435 440 445

Ala Leu Leu Asp Ser Arg Gly Val Trp Pro Val Ser Phe Ser Asp Trp

450 455 460

Glu Lys Leu Asp Ala Glu Glu Val Ser Arg Gly Gln Ala Ser Gly Lys

465 470 475 480

Pro Arg Glu Lys Leu Leu Asp Pro Gln Glu Met Leu Arg Leu Leu Gly

485 490 495

His

<210> 20

<211> 1504

<212> DNA

<213> Bos taurus

<400> 20

catatggccc cgcgttgttg gcgttggtgg ccgtggagta gctggacccg tacccgtctg 60

ccgcctagtc gtagtattca gaattttggt cagcatttta gtacccagga acagaccccg 120

cagatttgtg ttgttggttc aggtccggca ggtttttata cagcacagca tctgctgaaa 180

catcatagtc gtgcacatgt tgatatttat gaaaaacagc tggttccgtt tggtctggtt 240

cgttttggtg ttgcgcctga tcatccggaa gttaaaaatg ttattaatac ctttacccag 300

accgcccgca gtgatcgttg tgccttttat ggtaatgttg aagttggtcg tgatgttacc 360

gttcaggaac tgcaggatgc atatcatgca gttgttctga gttatggtgc agaagatcat 420

caggcactgg atattccagg tgaagaactg ccgggtgtgt ttagtgcacg tgcatttgtt 480

ggttggtata atggtctgcc ggaaaatcgt gaactggcac cggatctgtc atgtgatacc 540

gcagttattc tgggtcaggg taatgtggca ctggatgttg cccgtattct gctgacgccg 600

ccggatcatc tggaagttct gttactgtgc cagaaaaccg atattactga agcagcgctg 660

ggtgccctgc gtcagagtcg tgttaaaacc gtttggattg ttggtcgtcg tggtccgctg 720

caggttgcat ttacaattaa agaactgcgt gaaatgattc agctgccggg tacccgtccg 780

atgttagatc cggctgattt tctgggtctg caggatcgta ttaaagaagc tgcacgtccg 840

cgtaaacgtc tgatggaact gctgctgcgt acagcaaccg aaaaaccggg tgtggaagaa 900

gcagcacgtc gtgctagtgc tagtcgtgca tggggtctgc gtttctttcg tagtccgcag 960

caggttctgc cgtctccgga tggtcgccgt gcagcaggta ttcgtttagc cgttacacgt 1020

ctggaaggta ttggtgaagc aacacgtgca gtgccgaccg gtgatgttga agatctgcct 1080

tgtggtctgg ttctgagttc aattggttat aaatctcgtc cgattgatcc atcagttccg 1140

tttgatccga aactgggtgt tgttcctaat atggaaggtc gtgttgttga tgttccgggt 1200

ctgtattgta gtggttgggt gaaacgtggt ccgaccggtg ttattaccac cacaatgacc 1260

gatagctttt taaccggtca gattctgctg caggatctga aagcaggtca tctgccgagt 1320

ggtccgcgtc cgggtagcgc atttattaaa gcactgctgg atagtcgtgg tgtttggccg 1380

gttagtttta gtgattggga aaaactggat gcagaagaag ttagccgtgg tcaggcatca 1440

ggtaaaccgc gtgaaaaact gttagatccg caggaaatgc tgcgtctgct gggtcattaa 1500

gctt 1504

<210> 21

<211> 106

<212> PRT

<213> Acinetobacter sp. OC4

<400> 21

Met Gly Gln Ile Thr Phe Ile Ala His Asp Gly Ala Gln Thr Ser Val

1 5 10 15

Ala Ile Glu Ala Gly Lys Ser Leu Met Gln Leu Ala Val Glu Asn Gly

20 25 30

Val Ala Gly Ile Asp Gly Asp Cys Gly Gly Glu Cys Ala Cys Gly Thr

35 40 45

Cys His Val Ile Val Ser Ala Glu Trp Ser Asp Val Ala Gly Thr Ala

50 55 60

Gln Ala Asn Glu Gln Gln Met Leu Glu Met Thr Pro Glu Arg Ala Ala

65 70 75 80

Thr Ser Arg Leu Ala Cys Cys Ile Gln Val Thr Asp Ala Met Asp Gly

85 90 95

Met Thr Val His Leu Pro Glu Phe Gln Met

100 105

<210> 22

<211> 328

<212> DNA

<213> Acinetobacter sp. OC4

<400> 22

catatgggtc agattacctt tattgcacat gatggtgcac agaccagcgt tgcaattgaa 60

gcaggtaaaa gcctgatgca gctggcagtt gaaaatggtg ttgcaggtat tgatggtgat 120

tgtggtggtg aatgtgcatg tggtacctgt catgttattg ttagcgcaga atggagcgat 180

gttgcaggta ccgcccaggc aaatgaacag cagatgctgg aaatgacccc ggaacgtgca 240

gcaaccagcc gtctggcatg ttgtattcag gttaccgatg caatggatgg tatgaccgtt 300

catctgccgg aatttcagat gtaagctt 328

<210> 23

<211> 404

<212> PRT

<213> Acinetobacter sp. OC4

<400> 23

Met Gln Thr Ile Val Ile Ile Gly Ala Ser His Ala Ala Ala Gln Leu

1 5 10 15

Ala Ala Ser Leu Arg Pro Asp Gly Trp Gln Gly Glu Ile Val Val Ile

20 25 30

Gly Asp Glu Pro Tyr Leu Pro Tyr His Arg Pro Pro Leu Ser Lys Thr

35 40 45

Phe Leu Arg Gly Ala Gln Leu Val Asp Glu Leu Leu Ile Arg Pro Ala

50 55 60

Ala Phe Tyr Gln Lys Asn Gln Ile Glu Phe Arg His Gly Arg Val Val

65 70 75 80

Ala Ile Asp Arg Ala Ala Arg Ser Val Thr Leu Gln Asp Gly Ser Thr

85 90 95

Leu Ala Tyr Asp Gln Leu Ala Leu Cys Thr Gly Ala Arg Val Arg Thr

100 105 110

Val Ser Leu Ala Gly Ser Asp Leu Ala Gly Val His Tyr Leu Arg Asn

115 120 125

Ile Ser Asp Val Gln Ala Ile Gln Pro Phe Val Gln Pro Asn Gly Lys

130 135 140

Ala Val Val Ile Gly Gly Gly Tyr Ile Gly Leu Glu Thr Ala Ala Ala

145 150 155 160

Leu Thr Glu Gln Gly Met Gln Val Val Val Leu Glu Ala Ala Glu Arg

165 170 175

Ile Leu Gln Arg Val Thr Ala Pro Glu Val Ser Asp Phe Tyr Thr Arg

180 185 190

Ile His Arg Glu Gln Gly Val Thr Ile His Thr Gly Val Ser Val Thr

195 200 205

Ala Ile Thr Gly Glu Gly Arg Ala Gln Ala Val Leu Cys Ala Asp Gly

210 215 220

Ser Met Phe Asp Ala Asp Leu Val Ile Ile Gly Val Gly Val Val Pro

225 230 235 240

Asn Ile Glu Leu Ala Leu Asp Ala Gly Leu Gln Val Asp Asn Gly Ile

245 250 255

Val Ile Asp Glu Tyr Cys Arg Thr Ser Ala Pro Glu Ile Val Ala Ile

260 265 270

Gly Asp Cys Ala Asn Ala Phe Asn Pro Ile Tyr Gln Arg Arg Met Arg

275 280 285

Leu Glu Ser Val Pro Asn Ala Asn Glu Gln Ala Lys Ile Ala Ser Ala

290 295 300

Thr Leu Cys Gly Leu Gln Arg Thr Ser Lys Ser Leu Pro Trp Phe Trp

305 310 315 320

Ser Asp Gln Tyr Asp Leu Lys Leu Gln Ile Ala Gly Leu Ser Gln Gly

325 330 335

Tyr Asp Gln Ile Val Ile Arg Gly Asp Val Gln Gln Arg Arg Ser Phe

340 345 350

Ala Ala Phe Tyr Leu Gln Ala Gly Arg Leu Ile Ala Ala Asp Cys Val

355 360 365

Asn Arg Pro Gln Glu Phe Met Leu Ser Lys Lys Leu Ile Thr Ala Gly

370 375 380

Thr Ala Val Asp Pro Leu Arg Leu Ala Asp Glu Ser Ile Ala Val Gln

385 390 395 400

Ala Leu Met Gly

<210> 24

<211> 1222

<212> DNA

<213> Acinetobacter sp. OC4

<400> 24

catatgcaga ccattgttat tattggtgca agccatgcag cagcacagct ggcagcaagt 60

ctgcgtccgg atggttggca gggtgaaatt gttgttattg gtgatgaacc gtatctgccg 120

tatcatcgtc cgccgctgag caaaaccttt ctgcgtggtg cacagctggt tgatgaactg 180

ctgattcgtc cggcggcctt ttatcagaaa aatcagattg aatttcgtca tggtcgtgtt 240

gttgccattg atcgtgcagc acgtagcgtt accctgcagg atggtagtac cctggcatac 300

gatcagctgg ccctgtgtac cggcgcccgc gttcgtaccg tgagcctggc aggtagtgat 360

ctggcaggcg ttcattatct gcgtaatatt tcagatgttc aggccattca gccgtttgtt 420

cagccgaatg gtaaagcagt tgtgattggt ggtggttata ttggtctgga aaccgcagca 480

gccctgaccg aacagggtat gcaggttgtt gttctggaag cagcagaacg tattctgcag 540

cgtgttaccg ccccggaagt tagcgatttt tatacccgca ttcatcgtga acagggtgtg 600

accattcata caggtgttag tgttaccgca attaccggtg aaggtcgtgc ccaggcagtt 660

ctgtgtgcgg atggtagcat gtttgatgcc gatctggtta ttattggtgt gggtgttgtt 720

ccgaatattg aactggccct ggatgcaggt ctgcaggttg ataatggtat tgttattgat 780

gaatattgcc gcaccagcgc accggaaatt gttgcaattg gtgattgtgc aaatgcattt 840

aatccgattt atcagcgccg catgcgtctg gaaagcgttc cgaatgcaaa tgaacaggca 900

aaaattgcat cagcaaccct gtgtggtctg cagcgtacca gcaaatcact gccgtggttt 960

tggagtgatc agtatgatct gaaactgcag attgccggtc tgagccaggg ttatgatcag 1020

attgttattc gtggtgatgt gcagcagcgt cgttcatttg cagcatttta tctgcaggca 1080

ggtcgtctga ttgcagcaga ttgtgtgaat cgtccgcagg aatttatgct gagcaaaaaa 1140

ctgattaccg caggtaccgc agttgatccg ctgcgtctgg cagatgaaag cattgcagtt 1200

caggccctga tgggttaagc tt 1222

<210> 25

<211> 147

<212> PRT

<213> Spinacia oleracea

<400> 25

Met Ala Ala Thr Thr Thr Thr Met Met Gly Met Ala Thr Thr Phe Val

1 5 10 15

Pro Lys Pro Gln Ala Pro Pro Met Met Ala Ala Leu Pro Ser Asn Thr

20 25 30

Gly Arg Ser Leu Phe Gly Leu Lys Thr Gly Ser Arg Gly Gly Arg Met

35 40 45

Thr Met Ala Ala Tyr Lys Val Thr Leu Val Thr Pro Thr Gly Asn Val

50 55 60

Glu Phe Gln Cys Pro Asp Asp Val Tyr Ile Leu Asp Ala Ala Glu Glu

65 70 75 80

Glu Gly Ile Asp Leu Pro Tyr Ser Cys Arg Ala Gly Ser Cys Ser Ser

85 90 95

Cys Ala Gly Lys Leu Lys Thr Gly Ser Leu Asn Gln Asp Asp Gln Ser

100 105 110

Phe Leu Asp Asp Asp Gln Ile Asp Glu Gly Trp Val Leu Thr Cys Ala

115 120 125

Ala Tyr Pro Val Ser Asp Val Thr Ile Glu Thr His Lys Glu Glu Glu

130 135 140

Leu Thr Ala

145

<210> 26

<211> 444

<212> DNA

<213> Spinacia oleracea

<400> 26

atggcagcaa ccaccacaac aatgatgggc atggccacca cctttgtccc aaaaccccaa 60

gcaccaccaa tgatggcggc gcttccatcc aacaccggcc gctctttgtt cggactcaag 120

accggtagcc gtggcggaag gatgacaatg gctgcctaca aggtaacctt ggtaacaccc 180

accggtaacg tagagtttca atgcccagac gatgtttaca tcttggatgc tgctgaagaa 240

gaaggcattg acttgcctta ctcatgcaga gctgggtcgt gctcttcatg cgccggaaag 300

cttaagacag gtagtcttaa ccaagatgat cagagttttt tggatgacga tcagatcgat 360

gaaggatggg ttcttacctg tgctgcttac cctgttagtg atgttactat tgagacccac 420

aaggaagagg agcttactgc ctaa 444

<210> 27

<211> 369

<212> PRT

<213> Spinacia oleracea

<400> 27

Met Thr Thr Ala Val Thr Ala Ala Val Ser Phe Pro Ser Thr Lys Thr

1 5 10 15

Thr Ser Leu Ser Ala Arg Ser Ser Ser Val Ile Ser Pro Asp Lys Ile

20 25 30

Ser Tyr Lys Lys Val Pro Leu Tyr Tyr Arg Asn Val Ser Ala Thr Gly

35 40 45

Lys Met Gly Pro Ile Arg Ala Gln Ile Ala Ser Asp Val Glu Ala Pro

50 55 60

Pro Pro Ala Pro Ala Lys Val Glu Lys His Ser Lys Lys Met Glu Glu

65 70 75 80

Gly Ile Thr Val Asn Lys Phe Lys Pro Lys Thr Pro Tyr Val Gly Arg

85 90 95

Cys Leu Leu Asn Thr Lys Ile Thr Gly Asp Asp Ala Pro Gly Glu Thr

100 105 110

Trp His Met Val Phe Ser His Glu Gly Glu Ile Pro Tyr Arg Glu Gly

115 120 125

Gln Ser Val Gly Val Ile Pro Asp Gly Glu Asp Lys Asn Gly Lys Pro

130 135 140

His Lys Leu Arg Leu Tyr Ser Ile Ala Ser Ser Ala Leu Gly Asp Phe

145 150 155 160

Gly Asp Ala Lys Ser Val Ser Leu Cys Val Lys Arg Leu Ile Tyr Thr

165 170 175

Asn Asp Ala Gly Glu Thr Ile Lys Gly Val Cys Ser Asn Phe Leu Cys

180 185 190

Asp Leu Lys Pro Gly Ala Glu Val Lys Leu Thr Gly Pro Val Gly Lys

195 200 205

Glu Met Leu Met Pro Lys Asp Pro Asn Ala Thr Ile Ile Met Leu Gly

210 215 220

Thr Gly Thr Gly Ile Ala Pro Phe Arg Ser Phe Leu Trp Lys Met Phe

225 230 235 240

Phe Glu Lys His Asp Asp Tyr Lys Phe Asn Gly Leu Ala Trp Leu Phe

245 250 255

Leu Gly Val Pro Thr Ser Ser Ser Leu Leu Tyr Lys Glu Glu Phe Glu

260 265 270

Lys Met Lys Glu Lys Ala Pro Asp Asn Phe Arg Leu Asp Phe Ala Val

275 280 285

Ser Arg Glu Gln Thr Asn Glu Lys Gly Glu Lys Met Tyr Ile Gln Thr

290 295 300

Arg Met Ala Gln Tyr Ala Val Glu Leu Trp Glu Met Leu Lys Lys Asp

305 310 315 320

Asn Thr Tyr Phe Tyr Met Cys Gly Leu Lys Gly Met Glu Lys Gly Ile

325 330 335

Asp Asp Ile Met Val Ser Leu Ala Ala Ala Glu Gly Ile Asp Trp Ile

340 345 350

Glu Tyr Lys Arg Gln Leu Lys Lys Ala Glu Gln Trp Asn Val Glu Val

355 360 365

Tyr

<210> 28

<211> 1110

<212> DNA

<213> Spinacia oleracea

<400> 28

atgaccaccg ctgtcaccgc cgctgtttct ttcccctcta ccaaaaccac ctctctctcc 60

gcccgaagct cctccgtcat ttcccctgac aaaatcagct acaaaaaggt tcctttgtac 120

tacaggaatg tatctgcaac tgggaaaatg ggacccatca gggcccagat cgcctctgat 180

gtggaggcac ctccacctgc tcctgctaag gtagagaaac attcaaagaa aatggaggaa 240

ggcattacag tgaacaagtt taagcctaag accccttacg ttggaagatg tcttcttaac 300

accaaaatta ctggggatga tgcacccgga gagacctggc acatggtttt ttcccatgaa 360

ggagagatcc cttacagaga agggcaatcc gttggggtta ttccagatgg ggaagacaag 420

aatggaaagc cccataagtt gagattgtac tcgatcgcca gcagtgctct tggtgatttt 480

ggtgatgcta aatctgtttc gttgtgtgta aaacgactca tctacaccaa tgacgctgga 540

gagacgatca agggagtctg ctccaacttc ttgtgtgact tgaaacccgg tgctgaagtg 600

aagttaacag gaccagttgg aaaggagatg ctcatgccca aagaccctaa cgcgacaatt 660

atcatgcttg gaactggaac tgggattgct cctttccgtt cattcttgtg gaagatgttc 720

ttcgaaaagc atgatgatta caagtttaac ggcttggctt ggcttttctt gggtgtaccc 780

acaagcagtt ctcttctcta caaagaggaa tttgagaaga tgaaggaaaa ggctccagac 840

aacttcaggc tggattttgc agtgagcaga gagcaaacta acgagaaagg ggagaagatg 900

tacattcaaa cccgaatggc acaatacgca gttgagctat gggaaatgtt gaagaaagat 960

aatacttatt tctacatgtg tggtctcaag ggaatggaaa agggaattga cgacattatg 1020

gtttcattgg ctgctgcaga aggcattgat tggattgaat acaagaggca gttgaagaag 1080

gcagaacaat ggaacgttga agtctactaa 1110

<210> 29

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> CYP6-F

<400> 29

catatggcac tgaccaccac cggtac 26

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> CYP6-R

<400> 30

aagcttaggc cggtgcaccc ggtgt 25

<210> 31

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Fdx-F

<400> 31

gaaggagata tacatatggg tcagattacc 30

<210> 32

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> Fdx-R

<400> 32

cagactcgag ggtaccaagc ttacatctga a 31

<210> 33

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> RSF-1F

<400> 33

caccggccta agcttgcggc cgcataatgc 30

<210> 34

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> RSF-1R

<400> 34

ggtcagtgcc atatgggatc ctggctgtgg 30

<210> 35

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> RSF-2F

<400> 35

atgtaagctt ggtaccctcg agtctggtaa 30

<210> 36

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> RSF-2R

<400> 36

taatctgacc catatgtata tctccttc 28

<210> 37

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> FdR-F

<400> 37

ccaggatccg aattccatat gcagaccatt g 31

<210> 38

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> FdR-R

<400> 38

ctgttcgact taagaagctt aacccatcag 30

<210> 39

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> GDH-F

<400> 39

gaaggagata tacatatgta tccggattta 30

<210> 40

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> GDH-R

<400> 40

ctttaccaga ctcgagtcga gtcattaacc gc 32

<210> 41

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> ACYC-1F

<400> 41

ggttaagctt cttaagtcga acagaaag 28

<210> 42

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> ACYC-1R

<400> 42

tctgcatatg gaattcggat cctggct 27

<210> 43

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> ACYC-2F

<400> 43

aatgactcga ctcgagtctg gtaaagaaac 30

<210> 44

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> ACYC-2R

<400> 44

aatccggata catatgtata tctccttc 28

<210> 45

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> CYP6-F2

<400> 45

catatggcac tgaccaccac cg 22

<210> 46

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> CYP6-R2

<400> 46

aagcttaggc cggtgcaccc gg 22

<210> 47

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> BAD-F

<400> 47

caccggccta agcttggctg ttttggcgga 30

<210> 48

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> BAD-R

<400> 48

ggtcagtgcc atatgggatc cccatcgatc 30

<210> 49

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> DT7-F

<400> 49

ccgcataatc ccatcttagt atattagtta g 31

<210> 50

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> DT7-R

<400> 50

tactaagatg ggattatgcg gccgtgtaca a 31

Claims

1. A gene engineering bacterium is characterized in that the gene engineering bacterium is an engineering bacterium constructed by expressing CYP genes, ferredoxin reductase genes and dehydrogenase genes in cells; wherein, the amino acid sequence coded by the CYP gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO. 11;

preferably, the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.21 or a sequence with 98%, preferably 99% or more homology with the ferredoxin gene, and the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.23 or a sequence with 98%, preferably 99% or more homology with the ferredoxin gene; or the amino acid sequence coded by the ferredoxin gene is shown as SEQ ID NO.25 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene, and the amino acid sequence coded by the ferredoxin gene is shown as SEQ ID NO.27 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene.

2. The genetically engineered bacterium of claim 1, wherein the cell is escherichia coli, preferably e.coli BL21(DE3), C2566 or Rosseta;

and/or the nucleotide sequence of the CYP gene is shown as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10 or SEQ ID NO. 12;

and/or the nucleotide sequence of the ferredoxin gene is shown as SEQ ID NO.22, and the nucleotide sequence of the ferredoxin reductase gene is shown as SEQ ID NO. 24; or the nucleotide sequence of the ferredoxin gene is shown as SEQ ID NO.26, and the nucleotide sequence of the ferredoxin reductase gene is shown as SEQ ID NO. 28;

and/or the dehydrogenase is glucose dehydrogenase, alcohol dehydrogenase and/or formate dehydrogenase, the glucose dehydrogenase is preferably glucose dehydrogenase with NCBI accession number NP-388275.1, the alcohol dehydrogenase is preferably alcohol dehydrogenase with Genbank accession number BAN05992.1, and the formate dehydrogenase is preferably formate dehydrogenase with Genbank accession number XP-001525545.1.

3. The genetically engineered bacterium of claim 1 or 2, wherein the CYP gene, ferredoxin reductase gene, and dehydrogenase gene are located on a recombinant expression vector, or are integrated in the genome;

preferably, the recombinant expression vector has a backbone of plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a and/or pET28 a;

and/or the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are located on the same recombinant expression vector, or the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are located on different recombinant expression vectors, preferably on two or three recombinant expression vectors, for example, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and the ferredoxin reductase gene and the dehydrogenase gene are located on another recombinant expression vector;

and/or the dehydrogenase gene is a low-expression dehydrogenase gene.

4. A gene combination comprising a CYP gene, a ferredoxin reductase gene, and a dehydrogenase gene; wherein, the amino acid sequence coded by the CYP gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO. 11;

preferably, the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.21 or a sequence with 98%, preferably 99% or more homology with the ferredoxin gene, and the amino acid sequence encoded by the ferredoxin gene is shown as SEQ ID No.23 or a sequence with 98%, preferably 99% or more homology with the ferredoxin gene; or the amino acid sequence coded by the ferredoxin gene is shown as SEQ ID NO.25 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene, and the amino acid sequence coded by the ferredoxin gene is shown as SEQ ID NO.27 or a sequence with 98 percent, preferably 99 percent or more homology with the ferredoxin gene;

more preferably, the CYP gene, ferredoxin reductase gene and dehydrogenase gene are located on the same recombinant expression vector; or, the recombinant expression vector is a multi-recombinant expression vector, preferably a dual-recombinant expression vector, the CYP gene, the ferredoxin reductase gene and the dehydrogenase gene are located on different recombinant expression vectors, preferably on two or three recombinant expression vectors, for example, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and the ferredoxin reductase gene and the dehydrogenase gene are located on another recombinant expression vector;

more preferably, the nucleotide sequence of the CYP gene is preferably shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10 or SEQ ID NO. 12;

and/or the recombinant expression vector has a backbone of plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a and/or pET28 a;

and/or the dehydrogenase is glucose dehydrogenase, alcohol dehydrogenase and/or formate dehydrogenase, the glucose dehydrogenase is preferably glucose dehydrogenase with NCBI accession number NP-388275.1, the alcohol dehydrogenase is preferably alcohol dehydrogenase with Genbank accession number BAN05992.1, and the formate dehydrogenase is preferably formate dehydrogenase with Genbank accession number XP-001525545.1;

and/or the dehydrogenase gene is a low-expression dehydrogenase gene.

5. A recombinant expression vector or a combination of recombinant expression vectors comprising the combination of genes of claim 4.

6. The gene combination of claim 4, or the recombinant expression vector combination of claim 5, for preparing a genetically engineered bacterium for producing calcitriol and/or calcitriol.

7. Use of a genetically engineered bacterium according to any one of claims 1 to 3 for the preparation of calcitriol and/or calcitriol;

8. A method for preparing a calcitriol and/or a calcitriol, characterized in that it comprises the following steps: in a reaction solvent, oxidized coenzyme NAD⁺/NADP⁺And in the presence of a hydrogen donor, catalyzing vitamin D3 to perform hydroxylation reaction by the genetically engineered bacteria as described in any one of claims 1 to 3.

9. The method of claim 8, wherein said vitamin D3 is co-solvent pre-dissolved vitamin D3; the cosolvent preferably comprises one or more of DMSO, Tween 80, Triton X100, methanol, ethanol and DMF;

and/or, the preparation method further comprises the step of adding hydroxypropyl-beta-cyclodextrin to the reaction solvent before the hydroxylation reaction is carried out; the hydroxypropyl-beta-cyclodextrin accounts for 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3% or 0.4% of the reaction system by mass and volume;

and/or the reaction temperature is 20-33 ℃, for example, 22 ℃,25 ℃, 28 ℃ or 30 ℃;

and/or the pH of the reaction is 6.0 to 8.0, for example 6.2, 6.6, 7.0, 7.4 or 7.8;

and/or the enzyme activity concentration of the genetic engineering bacteria is 4750U/L-94900U/L, preferably 14940U/L-18980U/L, such as 17420U/L;

and/or the concentration of vitamin D3 is 0.5g/L to 3g/L, such as 1.0g/L, 1.2g/L, 1.4g/L, 1.6g/L, or 1.8 g/L;

and/or, the NAD⁺/NADP⁺The hydrogen donor and the vitamin D3 are added into the reaction system in a batch adding mode;

and/or, the NAD⁺/NADP⁺The molar ratio to the vitamin D3 was 0.001: 1-0.5: 1, e.g., 0.1: 1;

and/or the genetically engineered bacteria exist in the form of bacterial sludge of the genetically engineered bacteria or bacterial sludge extract of the genetically engineered bacteria.

10. The process according to claim 8 or 9, wherein the hydrogen donor is glucose, isopropanol or formate;

preferably, when the dehydrogenase expressed in the genetically engineered bacterium is alcohol dehydrogenase, the hydrogen donor is isopropanol; when the dehydrogenase expressed in the genetic engineering bacteria is glucose dehydrogenase, the hydrogen donor is glucose; when the dehydrogenase expressed in the genetic engineering bacteria is formate dehydrogenase, the hydrogen donor is formate.