CN114940994B

CN114940994B - Application of rice transcription factor OsNF-YA in antiviral of rice

Info

Publication number: CN114940994B
Application number: CN202210465028.7A
Authority: CN
Inventors: 孙宗涛; 谭小香; 张合红; 魏中艳; 李雁军; 陈剑平
Original assignee: Ningbo University
Current assignee: Ningbo University
Priority date: 2022-04-29
Filing date: 2022-04-29
Publication date: 2023-07-07
Anticipated expiration: 2042-04-29
Also published as: CN114940994A

Abstract

The invention relates to a rice nuclear transcription factor OsNF-YA gene and application thereof in resisting southern rice black-streaked dwarf virus and rice stripe virus, and stable inheritance RNAi-OsNF-YA transgenic plants are obtained by knocking out OsNF-YA in plant rice in an siRNA mode. Experimental data indicate that: RNAi-OsNF-YA transgenic plants can enhance the resistance of rice to rice stripe virus and southern rice black-streaked dwarf virus.

Description

Application of rice transcription factor OsNF-YA in antiviral of rice

Technical Field

The invention relates to the technical field of transgenosis and the field of plant disease control, in particular to a transcription factor OsNF-YA gene of rice and application thereof in rice virus disease resistance and plant breeding.

Background

Rice stripe virus (Rice stripe virus, RSV) is a typical representation of the genus Tenivirus. RSV is a envelope-coated filar negative-strand multi-split RNA virus, the virions are in the form of fine filaments of varying lengths, about 3-8nm in diameter. RSV infects 50 grasses such as rice, corn, etc. under natural conditions and has a broad host range. Obvious dwarfing, chlorosis and curling of leaves, serious withered hearts and even death occur in the early stage of infected rice plants, and yellow spots appear on leaves along veins in the later growth stage, so that heading is reduced or not. The transmission medium of the RSV is mainly Laodelphax striatellus, and can be vertically transmitted through eggs, and the larvae and adults of the Laodelphax striatellus, and female worms and male worms can be used as the medium of the RSV. In 2003-2010, large-scale outbreaks of rice stripe disease occur in the eastern China rice area, the general incidence rate of the rice stripe disease field is about 5%, the yield is reduced by 3% -5%, and the yield is reduced by 20% -30% in severe cases, even up to 70% or the harvest is stopped; in 2004 and 2005, the areas affected by rice stripe virus in Jiangsu regions only reached 153 and 187 ten thousand hectares, respectively (Zhang Hengmu et al, 2007; zhou Yijun, 2010). At present, rice stripe disease is spread in 18 provincial rice areas in China, wherein the incidence of japonica rice fields in Jiangsu, zhejiang, shandong, henan, yunnan and other places is more common (Zhou Yijun, 2010), and the grain safety of rice is seriously affected. Taking the gold mountain town in Lufeng county of Yunnan province as an example, the onset of the disease is increased year by year from 2018 to 2021, and the onset area in 2018 reaches 12.8 hectares; the area of onset with a slight exacerbation in 2019 was 30 hectares; the attack area in 2020 is 136.93 hectare; early preliminary investigation of the occurrence of leaf blight of full town rice in 2021 was carried out, with an occurrence area of 304 hectare (Ma Liqiong et al, 2022). Directly causes serious yield reduction of rice and brings serious negative influence to agricultural production.

Southern rice black streaked dwarf virus (Southern rice black-streaked dwarf virus, SRBDV) was found in Yangjiang, guangdong province in 2001 in China. The virus particles are in regular icosahedral sphere structure according to the particle structure of fijivirus genus, the diameter is 75-80nm, and the host range is mainly in Gramineae plants. The transmission medium of SRBSDV is mainly the plant hopper which can carry viruses for life once the viruses are obtained but does not transmit through eggs. The long wing type of the sogatella furcifera has the capability of long-distance migration, so that the SRBSDV can burst and prevail in a large area in a short time. Plants developed after SRBSDV infection show symptoms similar to RBSDV, SRBSDV can be infected in each growth period of rice, and the symptoms are different due to different periods. Typical symptoms of plants infected with SRBSDV are dwarfing, darkening of leaf color to greenish, curling of leaf tips, and uneven folds on the basal leaf surface of the upper portion She Jin. The stem node of the disease plant in the jointing stage has the fibrous root and high-joint branch; the surface of the stalk is provided with milky white tumor-shaped protrusions which are longitudinally arranged in a wax dot shape with the size of about 1-2 mm, the later period of the tumor is brown-black, the later the disease sensing period is, the higher the position generated by the tumor is (Zhou Guohui et al, 2008), and the yield of the economic crops of rice, corn, wheat and barley is seriously affected. In the later 90 s of the 20 th century, the disease has large outbreaks in Jiangsu, zhejiang and other areas, the occurrence of the disease is over 90 percent in the rice field with serious disease occurrence, and serious economic loss is caused (Wang Huadi and the like, 2007), so that the research on the reason of the rice disease caused by the SRBSDV virus has extremely important practical significance.

SRBSDV is one of the important members of the Reoviridae (Reoviridae) Fijivirus genus, and recently phylogenetic tree analysis has shown that SRBSDV has high homology to the gene sequence of Rice black-streaked dwarf virus (RBSDV). The analogous RBSDV researchers found that SRBSDV P5-1, P6, P9 was an important component of viral replication virulence. Wherein the P6 protein can coordinate virus infection and transmission through interaction with an ethylene signal pathway key transcription factor OsRTH 2. P7-2 interacts with S-phase kinase-associated protein 1 (OsSKP 1) to form SCF complex. The P8 protein codes for inner capsid protein of virus, has the function of inhibiting transcription activity, and inhibits antiviral defense reaction mediated by the protein through interaction with rice auxin pathway transcription factor OsARF 17. P10 encodes a coat protein that is capable of stimulating endoplasmic reticulum stress.

Nuclear Factor Y (NF-Y) is a class of genes whose transcription is regulated by binding to the CCAAT-box cis-acting element of the downstream gene promoter region. Unlike animals, higher plants have 10 or more family genes, the genomes found in studies of model organism Arabidopsis have 10 NF-YA genes, 13 NF-YB genes and 13 NF-YC genes altogether, while in studies on rice have been found to encode 11 NF-YA genes, 11 NF-YB genes and 12 NF-YC genes (Yang et al, 2017).

Researches show that NF-Ys has important biological functions in the growth and development process of plants, and is mainly involved in the development of plant embryos, the regulation of seed germination, plant flowering and the like. NF-Y was first found to be involved in regulating plant growth and development in Arabidopsis, where the first identified and widely studied NF-Y subunit plays a role in embryogenesis and seed maturation as NF-YB9, which was identified as LEAFY COTYLIDOON 1 (LEC 1) regulating the transformation of plants from embryos to adults (Lotan et al, 1998; huang et al, 2015).

However, the role of rice virus infection of rice NF-YA gene family members is still not clear, and based on the defects of the prior art, the inventor of the invention obtains transgenic rice capable of stably inheriting by constructing an interference vector of OsNF-YAs and introducing the interference vector into rice varieties by using an agrobacterium-mediated method. Experiments of artificially inoculating southern rice black-streaked dwarf virus (SRBSDV) and Rice Stripe Virus (RSV) show that RNAi-OsNF-YAs gene in rice can obviously enhance the resistance of the rice to RSV and SRBSDV infection, and the diseases are reduced in plant morbidity, incidence, virus content and the like. The invention provides a new idea for breeding and breeding new rice antiviral varieties by using southern rice black-streaked dwarf virus and rice stripe virus resistant plants, and provides technical guarantee and scientific basis for ensuring continuous yield increase of agricultural rice crops in China.

Disclosure of Invention

The invention relates to a rice coding gene OsNF-YA family gene and a coding protein thereof;

the nucleotide sequence of the OsNF-YA gene is shown as SEQ ID NO.1-11, and the amino acid sequence of the protein corresponding to the OsNF-YA gene encoded by the rice transcription factor is the amino acid encoded by SEQ ID NO. 1-11.

In some specific embodiments, the CDS nucleotide sequence (SEQ ID NOS: 1-11) for an OsNF-YA family gene is as follows:

OsNF-YA1

ATGCTCCCTCCTCATCTCACAGAAAATGGCACAGTAATGATTCAGTTTGGTCATAAAATGCCTGACTACGAGTCATCAGCTACCCAATCAACTAGTGGATCTCCTCGTGAAGTGTCTGGAATGAGCGAAGGAAGCCTCAATGAGCAGAATGATCAATCTGGTAATCTTGATGGTTACACGAAGAGTGATGAAGGTAAGATGATGTCAGCTTTATCTCTGGGCAAATCAGAAACTGTGTATGCACATTCGGAACCTGACCGTAGCCAACCCTTTGGCATATCATATCCATATGCTGATTCGTTCTATGGTGGTGCTGTAGCGACTTATGGCACACATGCTATTATGCATCCCCAGATTGTGGGCGTGATGTCATCCTCCCGAGTCCCGCTACCAATAGAACCAGCCACCGAAGAGCCTATTTATGTAAATGCAAAGCAATACCATGCGATTCTCCGAAGGAGACAGCTCCGTGCAAAGTTAGAGGCTGAAAACAAGCTGGTGAAAAACCGCAAGCCGTACCTCCATGAATCCCGGCATCAACACGCGATGAAGAGAGCTCGGGGAACAGGGGGGAGATTCCTCAACACAAAGCAGCAGCCTGAAGCTTCAGATGGTGGCACCCCAAGGCTCGTCTCTGCAAACGGCGTTGTGTTCTCAAAGCACGAGCACAGCTTGTCGTCCAGTGATCTCCATCATCGTCGTGCGAAAGAGGGCGCTTGA

OsNF-YA2

ATGATAATGCTGTTGCAAGAAATGGAGAATCATCCTGTCCAATGCATGGCCAAGACCAACTATGATTTTCTTGCCAGGAATAACTATCCAATGAAACAGTTAGTTCAGAGGAACTCTGATGGTGACTCGTCACCAACAAAGTCTGGGGAGTCTCACCAAGAAGCATCTGCAGTAAGTGACAGCAGTCTCAACGGACAACACACCTCACCACAATCAGTGTTTGTCCCCTCAGATATTAACAACAATGATAGTTGTGGGGAGCGGGACCATGGCACTAAGTCGGTATTGTCTTTGGGGAACACAGAAGCTGCCTTTCCTCCTTCAAAGTTCGATTACAACCAGCCTTTTGCATGTGTTTCTTATCCATATGGTACTGATCCATATTATGGTGGAGTATTAACAGGATACACTTCACATGCATTTGTTCATCCTCAAATTACTGGTGCTGCAAACTCTAGGATGCCATTGCCTGTTGATCCTTCTGTAGAAGAGCCCATATTTGTCAATGCAAAGCAATACAATGCGATCCTTAGAAGAAGGCAAACGCGTGCAAAATTGGAGGCCCAAAATAAGGCGGTGAAAGGTCGGAAGCCTTACCTCCATGAATCTCGACATCATCATGCTATGAAGCGAGCCCGTGGATCAGGTGGTCGGTTCCTTACCAAAAAGGAGCTGCTGGAACAGCAGCAGCAGCAGCAGCAGCAGAAGCCACCACCGGCATCAGCTCAGTCTCCAACAGGTAGAGCCAGAACGAGCGGCGGTGCCGTTGTCCTTGGCAAGAACCTGTGCCCAGAGAACAGCACATCCTGCTCGCCATCGACACCGACAGGCTCCGAGATCTCCAGCATCTCATTTGGGGGCGGCATGCTGGCTCACCAAGAGCACATCAGCTTCGCATCCGCTGATCGCCACCCCACAATGAACCAGAACCACCGTGTCCCCGTCATGAGGTGA

OsNF-YA3

ATGCTGAGCTTCAAGCAGAGCCACGAGGGGTTCGGCCATGTCGCCGCCGCTGGAGCTGGACCGCAGCAGCAGCAGCAGCCGTGGTGGGCGGGGTCGCAGCTGCTGTACGGGGAGGCGTCGCCGGAGGAGGCGGCGCTGCGCGACGGCGGCCAGTTCCAGGTCGTGCCCGGAGGCCGCGCCGCGCTGGATCCGGCGGCGCCGGAGCCGGAGAAGACGGCGGTGCCGGCGATGCCCAAGAGAGGAGGAGGAGGAGGGGCTCCTGAGGTGCTGAAATTCTCGGTGTTTTCAGGTAATTTGGAGCCGGGAGATACAGGAGAGAAGAACAGAGAGCACTCTGCCACTATTGCAATGCAATCGCCGTTGCCAGAATACAACGGCCATTTCGAGCTTGGTCTTGGTCAATCCATGGTCTCTCCCAATTATCCTTGTATTGACCAATGCTATGGTCTTATGACCACCTACGCGATGAAATCAATGAGTGGCGGGCGAATGCTACTGCCGCTGAACGCGCCAGCCGATGCGCCGATCTATGTCAACGCGAAGCAGTACGAAGGCATCCTCCGCCGTCGCCGTGCCCGCGCCAAGGCCCAGAGGGAGAACAGGCTGGTCAAAGGCAGGAAGCCCTACCTCCACGAGTCGCGCCACCGCCACGCCATGCGCCGGGCCAGAGGCTCCGGCGGCCGCTTCCTCAACACCAAGAAAGAAGCCACCGCCGCCGGATGCGGCGGCAGCAGCAAGACGCCCCTCGCGTCCCTCGTCAGCCCCGCCGACGTAGCCCATCGTCCAGGCTCCGGCGGCCGCGCGTCCAGCCTCTCCGGCTCCGACGTGTCGTCGCCGGGAGGCGTCATGTACGACCACCACCGCCACGACGACGCCGACGCGGCGGACCACTACAACAGCATCGACCACCACCTCCGCACGCCGTTCTTCACCCCGCTCCCGATCATCATGGACAGCGGCGGCGGCGGCGGCGACCACGCCTCACACTCCGCCGCCGCCGTCGCCGCCCCCTTCAGGTGGGCGACGGCGGCCGGCGACGGCTGCTGCGAGCTCCTCAAGGCGTGA

OsNF-YA4

ATGGAGTCGAGGCCGGGGGGAACCAACCTCGTGGAGCCGAGGGGGCAGGGCGCGCTGCCGTCCGGCATACCGATCCAGCAGCCGTGGTGGACGACCTCCGCCGGGGTCGGGGCGGTGTCGCCCGCCGTCGTGGCGCCGGGGAGCGGTGCGGGGATCAGCCTGTCGGGCAGGGATGGCGGCGGCGACGACGCGGCAGAGGAGAGCAGCGATGACTCACGAAGATCAGGGGAGACCAAAGATGGAAGCACTGATCAAGAAAAGCATCATGCAACATCGCAGATGACTGCTTTGGCATCAGACTATTTAACACCATTTTCACAGCTGGAACTAAACCAACCAATTGCTTCGGCAGCATACCAGTACCCTGACTCTTACTATATGGGCATGGTTGGTCCCTATGGACCTCAAGCTATGTCCGCACAGACTCATTTCCAGCTACCTGGATTAACTCACTCTCGTATGCCGTTGCCTCTTGAAATATCTGAGGAGCCTGTTTATGTAAATGCTAAGCAATATCATGGAATTTTAAGACGGAGGCAGTCACGTGCGAAGGCTGAACTTGAGAAAAAAGTTGTTAAATCAAGAAAGCCCTATCTTCATGAGTCTCGTCATCAACATGCTATGCGAAGGGCAAGAGGAACGGGTGGACGCTTCCTGAACACAAAGAAAAATGAAGATGGTGCTCCCAGTGAGAAAGCCGAACCAAACAAAGGAGAGCAGAACTCCGGGTATCGCCGGATCCCTCCTGACTTACAGCTCCTACAGAAGGAAACATGA

OsNF-YA5

ATGAGAAGTGCAGCTCTGAGCTTCCAAGATCACGGCCATGGGCTTCAGGCGATCACCGGCCGTGGCGGCAATGGCGGCGCCGCCGCTCACGCATTGCCATGGTGGGCTGGAGCCGGAGCCGGAGCTGGATCCCAAACACTGCTTGGAACAGGAGGAGGAGAAGAATCATTCTGCCAATTAAGCAACACAATCATGGAGGACACCCGAATCCTGCAAAACCACCACCACCAGATCCTCGCCGCCGGCCGGCAGCTGCAGCAGCGCCACCACTTCCCGGCAATGCCGCCGGAGCGACACCACCACCCTCCTCCTCCAGCTCCTGGAAGCCCTGCCATGAAGTTCCCAATCATCTCAGGTGACTCTGATCTTGGCAAAGATCTGAAGTTCCATGAGTCCTCCGCGCCGACCATCGCCGCGTACTCGCCATTGCAGGAGTACCAAGGACACTTTGAGCTAGCCCTTGGCCACTCCATGGTTTGCACCAACTTCTGCAACTCTGAACAAAGCTATGGTGTTTACTCCCCCTATGGAGCTCAAACCATGGCTGGGAGGATGCTGCTGCCGCCGGCGATCGCCACCGACGTGGGTCCGATCTACGTCAACGCGAAGCAGTTCAACGGCATCATCCGGCGGCGGCTGGCGCGCGCCAAGGCGGAGCGGGAGCACCGGGTTTCCCGGAGCCGGAAGCCGTACCTCCACGAGTCGCGCCACCGCCACGCCATGCGCCGCGCGCGGGGCAGCGGCGGCCGCTTCCTCAACACCAAGAACGCCTCCTCCGCCGCCGCCGCGGCCGCCGACGCGGCGCCGGTGAGCTCCGGTGGCGGCGACCACGGGGCGAGCAACAAGAGCTCGTCGGCGTCGGAGGCGACGCGCGTGTACGACGACGACGACGACATGGGCGCGGGCGGCGGCGGCGACGGCGGCGACTTCCACCACGCGATGGGTCACCTCCGCTCGCCGGCGTTCTTCCCGTCGCTGGCCGCGATGATGGACGGCGGCGGCGGCGGCGGCGAGGGGAAGTGGGCGACCGCGACGCCTCACCATGGCTGCCGCGTCGACCTCCTCAAGGTGTGA

OsNF-YA6

ATGCTAATGCTTTTGCGACAAATGGAAGATCATCGAGCCCATACTACGCCCAACTATGATTTTTTCTCTGGAGATTATCAGATGAAGCAGTTAGGTCATAAGATGTATGATCAAGATTCCCCGTCAAGCGATTCTGGACAGTCACACCAAGAAGAATCTGCCATGAATGATAGCAGTCCAAATGAGCGACATACCTCAACACAATCTGACAATGATGATGGTCATCAGATGCCAGATCAGGACAAAACAAAGTCAGTATCATCGTTGGGGAATCCAGGAGCTTTGCCTCCAAAGCTCAACTATAGCCAATCCTTTGCTTGTATTCCTTATACAGCTGATGCATACTATGGTGGGGTCTTGACTGGATATTCTTCACATGCAATTGTTCATCCCCAGCAAAATGGTACAGCTAACTCCCGGGTGCCGTTGCCTGTTGAGCCTGCAGCAGAAGAGCCAATATTTGTAAACGCAAAGCAGTACCATGCAATTCTTAGGAGGAGACAGATACGAGCTAAATTGGAGGCCCAAAATAAGTTGGTGAAAGGTCGGAAGCCATACCTCCATGAATCTCGGCATCGCCATGCCATGAAGCGAGCTCGTGGATCTGGAGGGCGCTTCCTCAACACAAAGCAGCTCGAGGAGCAGAAGCAGCAACAGGAGGAGGAGGCCGCATCCGGTGGCGCGAGCTCTGGCAATAGGACATGCCTTCAGAATGGCACCGGTAGCGCGCCTTCAGCTTCCTCTCCCTCTGAAATCGCGAGCGTCTCAACCAGCAGAGAATTCCTTGGTAACCATGAGCAGAGCCACTTCCCCTCAGCTGGCTTCCTTCCCACAATGAGCTTCAGAGCGCAGAATGGCGGAGATGGGAAGCTGGTCGCGAACGCCATTCACCAGCGCGTTTCCATGATGAGGTGA

OsNF-YA7

ATGAAGCCAGATGGTGAAACTCAGCTTCGTCCTACAGCTGCTGGACATCCAGATCCTGGTTTGGGCACATCATCTGCAGAATACGTGGCCTCTCTAGGACCAGCTACAGCTCCAGTATCTTATCCATATATCAGTACCTATTATGGAGGCACTTATGGTGCTTATAGTGGACAACCTCTGGTTAACGCTGCTTTAATGGCAATGCCTCCGCATTCTGTGCCCTTGGTGACCGATGCTGTTGTAGAGCCCATATATGTCAATGCAAGGCAGTATCATGGTATATTAAGGCGGCGCCAATCTCGTGCAAAAGCTGAATCAGAAAATAAGGCCAACAAAATCCGCAAGCCTTACCTACATGAGTCCCGCCATCTGCATGCTTTGAAAAGGGCAAGGGGGTCCGGTGGTCGATTTCTCAACTCTAAGGCTGTGGAGGGGAAGCAAGACACTAAATCTGTAGATAAAAAGGATGGAGCTGTGCCATCTGAGGAGAAGAGAGACAAGAAGTTGGCAAATAGCATTATCAAATTGGAGAACTCGAGCCCAACAACACAACCAGGTGCAGATGCGTCCGATGTTGTATGA

OsNF-YA8

ATGGGTTTTGGTGAAAGCACCCAGGGCAATCAACGTAAGCTTGATGGTCCTGGGAAAGTGTCAACTGAATTATCCCTAGTCAATCTAGAAGCTAAAAATTTGCATCCTAAACCTGAGTGCAACCAACCTATTGAACACATACCTACCAAGGGTATGAAGTGTACTCCACTGCTACCACTACCTACAGAACATGCTGATGATGAGCCTATATATGTGAATGCAAAGCAGTACCATGCAATTATCCGAAGGAGACAACGTCGAAAAATTGTTGGATCAGAAGATAAAGTAGCAGCAATTCGAAAGAGGATCCTTGTTGAGGCTCGCCAAAAGCAAGCAAAATTGAGGCATAGAGGAAAAGGCGGACGGTTTATTAGCATAGAACATCCCCTTGAACTTTCTATGGATGATCAGATATCGAAAAACGGAGGAAGTGCCTCGCCTTCTTCATCTACAGTGTCAGAAAACTCTAGCAATGTGAACGGTTTTACAGGAGATCTCTAA

OsNF-YA9

ATGACGTCTGTAGTTCATGATGTTTCAGGCAACCATGGAGCTGATGAGCGGCAAAAACAGCAAAGGCAAGGTGAACCTGAGGACCAGCAAGAAGCCTCAGTTACTAGTACAGATAGCCATACAATGGTAGCAACACCTTCAACAGATTATGCGACACCCTATGCCCATCACGATATGGCCCATGCAATGGGCCAAATTGCTTACGCAAATATTGATCCATATTACGGAAGCCTTTATGCAGCTTATGGTGGACAGCCTATGATGCATCCACCATTGGTCGGGATGCATCCAGCTGGACTACCACTGCCTACCGATGCAATTGAAGAGCCTGTCTATGTTAATGCAAAACAGTACAATGCCATATTAAGGCGTCGACAATCTCGAGCCAAAGCTGAGTCTGAAAAGAAGCTTGTCAAGGGCCGTAAGCCATATCTCCATGAGTCACGGCATCAACATGCCCTGAAAAGGGCTAGGGGAGCTGGAGGCCGATTTCTTAATTCAAAATCGGATGACAAGGAAGAGCATTCTGATTCCAGTTCCAGAGATAAACAGGATGGAGTTGCACCCCGTGATAGTGGCCAACCGTCTACCTCTCCGTCT

OsNF-YA10

ATGATGAGCTTCAACAAGAGCCAAGAAGGATTTGGGCAGGTTGCTGCTGTGGCCACCCTGGCCTCCAATGGAGGAGGCTCTCTACCATGGCTGCTGTACGGCGAGCCACTGGGGCAGGGGAAGCCGGCCATGTCGCCGGAGGGCGTGGTGCCGAGAGCACAGACTCCTCTGGATCCTCCTCAGGTTCCAGCCATGGACAGGGGTGTCCCTGAAATTCTGAACTTCTCCATGGTTCCAGGTAAAGGAGAAAAATGTTCTGAGCACTCAACTACTATTGCTCTGCAGTCACCATTTGCAGAATATAATGGCTGTTTTGAGCTGGGCCTTGGTCAATCTGTGGTTCCCTCTAATTATCCTTATGCTGACCAGCACTATGGCCTACTTTCTCCTTATGGAGTGAGACCAACGCCTAGCGGGCGAATTCTTATTCCACCAAATATGCCAGCTGATGCACCAATTTATGTGAATGCAAAACAGTGTTCAGCCATCATTCGACGTCGCCATGCTCGTGCCAAGGCAGAGAGGGAGAATAGGCTGGTCAAAGCTAGAAAACCATATCTTCACGAATCACGCCATCTTCATGCAATGCGTCGTGCAAGAGGCTCTGGTGGGCGCTTCCTCAACACGAAGAAAGAGACCAATGGGAAAACCACTGGTGGAGGCAGGAAGGTGATGGACATCATCATCCCGCCTCTGTGCCCCGCCGCATCTCCCAGCTCGGAGCAGTGCAACCCAAGCAGCGTTTCCAGCCTGTCCGGGTCAGAGGTGTCGAGCATATATGAACACGAAGACATGGACCACTTCCATAGCTTTGATCATCTCCGGACACACTTCTTCACCCCGCTCCCGAGCCTCATGGATGTCGAGCACGGGGCTGGTAACCCCTTCAAGTGGACAGCAGCCTCTGATGGCTGCTGTGACCTCCTCAAAGCATGA

OsNF-YA11

ATGCTTCTCCCCTCATCGTCTTCTTATTCCTACGCCTCCAAAGGTGACTCCTTCAGGAGAACTGTTGATGGTCCTATGAGGTCAACGTTGACTTTTGATAATAATCATTCTGTAGTGCCAAGTCAAAACATTGATTACGGCCAGCCAATGGCTTGCATTTCATACCCATACAACGATTCTGGTTCAGGAGTTTGGGCATCCTACAGTTCACGCTCGGTGTTCCATCCTCAAATTGTGGGAGGAGGCACATCGCCAAGAGTTCCCTTGCCCTCCCTGGAGATAGCAGATGATGGGCCCATATATGTCAATCCCAAACAATATCATGGAATTCTTCGCAGAAGACAACTGCGTGCTAAGTTAGAGGCCCAGAATAAGCTCGTCAAAACCCGAAAGCCTTACCTTCACGAATCTCGGCATCGCCATGCAATGAAGAGGGCTAGGGGCACTGGTGGGCGATTCCTGAATACCAAGCAGCTCCAGCTGCAGCAACAGTCTCACACTACCTCCACCAAGACCACCACAGACAGCCAAAATTCTTCAGGTTCAGTCCATCTACGGCTAGGTGGTGGCGCAATCGGAGATCAAACTCCATTTCCGTTCAAAGCAATGGATTCACAAGCTAACATCAAGAGAGCTGCAGCTTCTGCTTCCACCTTCACTGTAACTTCTGCGGCACAGAAAGACGACGCCTTCTTCGACCGCCATGGCCACCATCTCAGTAGCTTCTCCGGCCATTTTGGCCAGGCAAGCGCACAAGGTGGCGTCGGCAGCATGCATAACGGGTCACAGCAGAGGGTTCCTGCTATGAGATGA

on the other hand, the invention relates to the application of the rice transcription factor protein coding gene OsNF-YA in the breeding of gramineous grain crops of anti-Tenuivirus and Fijivirus;

in some embodiments, the genus Tenuivirus (Tenuivirus) comprises rice stripe virus (Rice stripe virus, RSV), maize stripe virus (Maize stripe virus, MSpV); fijivirus (Fijivirus) includes Maize Rough dwarf virus (Maize Rough DwarfVirus, MRDV), rice black-streaked dwarf virus (Rice black streaked dwarf virus, RBSDV), southern rice black-streaked dwarf virus (Southern rice black streaked dwarf virus, RBSDV);

in some embodiments, the gracilis is most preferably rice stripe virus and the fijis is most preferably southern rice black-streaked dwarf virus and rice black-streaked dwarf virus.

In some embodiments, the gramineous food crop is preferably rice, maize, wheat, oats, and barley; more preferably rice, most preferably Nippon Temminck;

in another aspect, the invention relates to a method for preparing a rice OsNF-YA plant expression interference vector, which comprises the following steps: designing a primer according to the recombination sequence of the OsNF-YA shown in SEQ ID No. 44, recovering a PCR product, connecting a pTCK303 vector, selecting and cloning, and carrying out measurement to obtain a pTCK303-OsNF-YA recombination plasmid; then, the pTCK303 vector is digested by BamHI, kpnI, speI, sacI, and the PCR products are respectively connected with the vector; selecting positive clones, and carrying out sequencing to confirm that the pTCK303-OsNF-YA expression vector is successfully constructed;

in some embodiments, the primer sequences are set forth in SEQ ID Nos. 45-48;

in another aspect, the present invention relates to a method for preparing a resistant transgenic plant comprising the steps of:

1) Construction of rice OsNF-YA plant expression interference vector

Designing a primer according to the recombination sequence of the OsNF-YA shown in SEQ ID No. 34, recovering a PCR product, connecting a pTCK303 vector, picking and cloning, and carrying out measurement to confirm that a correct recombinant plasmid of the pTCK303-OsNF-YA is obtained; then, the pTCK303 vector is digested by BamHI, kpnI, speI, sacI, and the PCR products are respectively connected with the vector; selecting positive clones, and carrying out sequencing to confirm that the pTCK303-OsNF-YA expression vector is successfully constructed;

2) Genetic transformation of rice

Agrobacterium transformation and callus induction culture: agrobacterium transformation: the plasmid containing the target vector is transformed into Agrobacterium tumefaciens GV3101 by the following steps: adding 2 mu L of plasmid into 50 mu L of competent cell, mixing, adding into electrode cup which is cooled in advance, transforming by 220V voltage electric shock method, adding 600 mu L of non-resistant LB liquid culture medium, shake culturing in shaking table at 28deg.C for about 3 hr, spreading on KR solid plate containing 50 mu g/ml Kan and 50 mu g/ml Rif, culturing in incubator at 28deg.C for 3d;

callus induction culture: selecting plump rice seeds (Japanese sunny) and removing glume, selecting high-quality seeds, soaking in 75% ethanol solution for 10min, washing with sterile water for 5-10 times, soaking in 30% sodium hypochlorite solution for 20-30min, and washing with sterile water for 5-10 times; then placing the cleaned seeds on sterile filter paper to absorb water, placing the seeds into an induction culture medium by using sterile forceps, culturing the seeds in a 28 ℃ illumination incubator for 3 weeks until callus grows out, selecting optimal callus into a secondary culture medium by using the sterile forceps, and carrying out secondary culture in the 28 ℃ illumination incubator for 1 week;

screening and culturing agrobacterium transfected callus and resistant callus: selecting a monoclonal from a single colony plate for mature culture and performing PCR verification, inoculating positive clones into 100mL of LB liquid medium containing 50 mug/mL Kan and 50 mug/mL Rif, and culturing in a constant temperature shaking table at 28 ℃ and 220r/min until the OD600 = 0.5; soaking the induced callus in agrobacterium suspension culture solution, taking out, and culturing in co-culture medium for 2.5d; the callus is placed on a culture medium containing 50mg/L hygromycin for 30-45d screening, the screened callus is placed in a differentiation culture medium for differentiation culture, and light culture is carried out for 22d after dark culture for 3d. After green buds grow out, transferring the green buds into a rooting culture medium for culturing for about 15 days to obtain transgenic plants;

3) Positive identification of transgenic plants

Extracting positive transgenic plant total RNA, performing reverse transcription to obtain cDNA, and taking UBQ gene of rice as an internal reference; the quantitative primers are shown as SEQ ID No. 12-15 and SEQ ID No. 30-33, and the relative expression levels of the four genes, namely OsNF-YA1, osNF-YA2, osNF-YA10 and OsNF-YA11, in the transgenic strain interfering the OsNF-YA genes are obviously lower than that of a control group, so that the construction of the transgenic rice strain is proved to be successful;

in some embodiments, the induction medium comprises: 24.1g/L of N6 culture medium, 2.5mg/L2,4-D, PH =5.8;

in some embodiments, the secondary medium comprises: 24.1g/L of N6 culture medium, 2.5mg/L of 2,4-D, 50mg/L of hygromycin, 300mg/mL of cephalosporin, and PH=5.8;

in some embodiments, the rooting medium comprises: 1/2MS 39.45g/L, 0.5mg/L NAA, 50mg/L hygromycin, pH=5.8;

in some embodiments, the co-culture medium comprises: 24.1g/L of N6 medium, 2.5mg/L of 2,4-D, 200 mu mol/L of acetosyringone and PH=5.8;

in another aspect, the invention is directed to a transgenic plant having both a gracilis and a fijis virus resistance;

in some embodiments, the genus Tenuivirus (Tenuivirus) comprises rice stripe virus (Rice stripe virus, RSV), maize stripe virus (Maize stripe virus, MSpV); fijivirus (Fijivirus) includes maize rough dwarf virus (Maize Rough Dwarf Virus, MRDV), rice black-streaked dwarf virus (Rice black streaked dwarf virus, RBSDV), southern rice black-streaked dwarf virus (Southern rice black streaked dwarf virus, RBSDV);

Description of the drawings:

fig. 1: after RSV and SRBSDV infest rice, the experimental result of up-regulating expression of OsNF-YA genes is induced;

fig. 2: experimental results of the relative expression level of OsNF-YA in RNAi-OsNF-YA transgenic rice;

fig. 3: schematic representation of the onset symptoms of RNAi-OsNF-YA transgene and control NIP following RSV infection;

fig. 4: RNAi-OsNF-YA transgene after RSV infection and virus content detection result of control NIP;

fig. 5: schematic representation of the onset symptoms of RNAi-OsNF-YA transgenes and control NIP following SRBSDV infection;

fig. 6: after SRBSDV infection, RNAi-OsNF-YA transgenesis and a virus content detection result of a control NIP; mock is healthy rice; NIP: paddy rice in Nipponbare; SRBSDV in the SRBSDV infected rice; RSV infection: RSV-infected rice; SRBSDV: SRBSDV infected rice; RSV infected rice

Examples:

Detailed Description

The rice varieties selected in the series of experiments are as follows: nippon sunny day

The relevant medium components are as follows:

induction medium: n6 Medium (manufacturer: haibo Biotechnology Co., ltd., product number: HBZ 0601) 24.1g/L, 2.5mg/L2,4-D, PH =5.8.

Subculture medium: n6 Medium (manufacturer: haibo Biotechnology Co., ltd., product number: 15HBZ 0601) 24.1g/L, 2,4-D, 50mg/L hygromycin, 300mg/mL cephalosporin, pH=5.8.

Co-culture medium: n6 Medium (manufacturer: haibo Biotechnology Co., ltd., product number: HBZ 0601) 24.1g/L, 2.5mg/L2,4-D, 200. Mu. Mol/L acetosyringone, pH=5.8.

Rooting medium: :1/2MS (manufacturer: haibo Biotechnology Co., ltd., product number: HB 8469-6) 39.45g/L, 0.5mg/L NAA, 50mg/L hygromycin, pH=5.8.

Example 1: induction of OsNF-YA gene expression changes after infection of rice by RSV and SRBSDV

(1) Extraction of total RNA of rice plant and synthesis of first-strand cDNA sequence

Extraction of inoculated RSV 20d with TRIzol reagent, inoculation of SRBSDV 30d and healthy Total RNA of rice, and use of reverse transcription kit 5. Times. HiScript

III qRT Super Mix (manufacturer: northenan, cat. No. R323-01) reverse transcribes the extracted RNA into cDNA and reverse transcribes the extracted RNA into cDNA.

(2) qRT-PCR detection of expression change of OsNF-YA gene

The cDNA sample was used, and the UBQ gene of rice was used as an internal reference. The quantitative primers are qRT-OsNF-YA1, qRT-OsNF-YA2, qRT-OsNF-YA3, qRT-OsNF-YA4, qRT-OsNF-YA5, qRT-OsNF-YA6, qRT-OsNF-YA7, qRT-OsNF-YA8, qRT-OsNF-YA9, qRT-OsNF-YA10, qRT-OsNF-YA11, and the relative expression amounts of the OsNF-YA are shown in figure 1, and the quantitative primer sequences are as follows:

qRT-OsNF-YA1-F tgaagtgtctggaatgagcg(SEQ ID No:12)；

qRT-OsNF-YA1-R cagcaccaccatagaacgaa(SEQ ID No:13)；

qRT-OsNF-YA2-F atcaggtggtcggttcctta(SEQ ID No:14)；

qRT-OsNF-YA2-R gttctggttcattgtggggt(SEQ ID No:15)；

qRT-OsNF-YA3-F ggtgctgaaattctcggtgt(SEQ ID No:16)；

qRT-OsNF-YA3-R tgatttcatcgcgtaggtgg(SEQ ID No:17)；

qRT-OsNF-YA4-F tgccgttgcctcttgaaata(SEQ ID No:18)；

qRT-OsNF-YA4-R tgtttggttcggctttctca(SEQ ID No:19)；

qRT-OsNF-YA5-F tgccatgaagttcccaatca(SEQ ID No:20)；

qRT-OsNF-YA5-R tttgagctccatagggggag(SEQ ID No:21)；

qRT-OsNF-YA6-F ctgcagcagaagagccaata(SEQ ID No:22)；

qRT-OsNF-YA6-R aaggcatgtcctattgccag(SEQ ID No:23)；

qRT-OsNF-YA7-F atacgtggcctctctaggac(SEQ ID No:24)；

qRT-OsNF-YA7-R cagcttttgcacgagattgg(SEQ ID No:25)；

qRT-OsNF-YA8-F cctgagtgcaaccaacctat(SEQ ID No:26)；

qRT-OsNF-YA8-R atgctaataaaccgtccgcc(SEQ ID No:27)；

qRT-OsNF-YA9-F atgcagcttatggtggacag(SEQ ID No:28)；

qRT-OsNF-YA9-R ttaagaaatcggcctccagc(SEQ ID No:29)；

qRT-OsNF-YA10-F gccttggtcaatctgtggtt(SEQ ID No:30)；

qRT-OsNF-YA10-R tgcatgaagatggcgtgatt(SEQ ID No:31)；

qRT-OsNF-YA11-F aggagtttgggcatcctaca(SEQ ID No:32)；

qRT-OsNF-YA11-R aacttagcacgcagttgtct(SEQ ID No:33)；

OsUBQ-F accacttcgaccgccactact(SEQ ID No:34)；

OsUBQ-R acgcctaagcctgctggtt(SEQ ID No:35)；

the experimental results are shown in figure 1, and the expression of the OsNF-YA gene can be obviously induced after the infection of RSV and SRBSDV, which indicates that the OsNF-YA participates in the antiviral defense reaction of rice.

Example 2: construction of rice OsNF-YA plant expression vector

(1) Cloning of Rice OsNF-YA Gene

Based on the test results in example 1, we selected four genes, namely OsNF-YA1, osNF-YA2, osNF-YA10, osNF-YA11, for subsequent experiments, and designed primer sequences based on their sequences (SEQ ID No:1,2, 10, 11) as follows:

OsNF-YA1-F atgctccctcctcatctca(SEQ ID No:36)；

OsNA-YA1-R ttaagcgccctctttcgca(SEQ ID No:37)；

OsNF-YA2-F atgataatgctgttgcaagaa(SEQ ID No:38)；

OsNF-YA2-R ttacctcatgacggggaca(SEQ ID No:39)；

OsNF-YA10-F atgatgagcttcaacaagagc(SEQ ID No:40)；

OsNF-YA10-R ttatgctttgaggaggtcac(SEQ ID No:41)；

OsNF-YA11-F atgcttctcccctcatcgt(SEQ ID No:42)；

OsNF-YA11-R ttatctcatagcaggaac(SEQ ID No:43)；

PCR amplification system: the total volume was 50. Mu.L, which contained 10 XKOD buffer 25. Mu.L, 1.5. Mu.L each of the upstream and downstream primers (10. Mu.M), 5. Mu.L of dNTP Mix (2.5 mM), 1. Mu.L of cDNA template, 1. Mu.L of KOD Taq enzyme (5U/. Mu.L), and 15. Mu.L of ddH 2O.

PCR amplification procedure: pre-denaturation at 94℃for 4min; denaturation at 94℃for 30s, renaturation at 58℃for 30s, extension at 72℃for 1min,35 cycles; finally, the extension is carried out for 5min at 72 ℃.

The PCR products of the above genes were recovered, ligated with pMD18-T vector (Takara, cat. No. D101A), picked, cloned, sequenced, and confirmed to obtain the recombinant plasmids of PMD18-T-OsNF-YA1, pMD18-T-OsNF-YA2, pMD18-T-OsNF-YA10, pMD18-T-OsNF-YA11 of the above four genes, which were confirmed to be sequenced correctly by Hangzhou Kangshengmbh. Respectively obtaining pMD18-T-OsNF-YA1 recombinant plasmid with CDS sequence size of 720bp and encoding 239 amino acids; CDS sequence size is 954bp, and pMD18-T-OsNF-YA2 recombinant plasmid of 317 amino acids is encoded; CDS sequence size is 936bp, and codes pMD18-T-OsNF-YA10 recombinant plasmid of 311 amino acids; CDS sequence size is 813bp, and encodes pMD18-T-OsNF-YA11 recombinant plasmid of 270 amino acids.

(2) Construction of interference vectors

According to the conserved structural domains of OsNF-YA1, osNF-YA2, osNF-YA10 and OsNF-YA11 sequences SEQ ID No.1, 2, 10 and 11, a section of conserved sequence SEQ ID No. 44 with higher homology is designed as an interference vector sequence, and the sequence is specifically as follows:

cacatgctattatgcatccccagattgtgggcgtgatgtcatcctcccgagtcccgctaccaatagaaccagccaccgaagagcctatttatgtaaatgcaaagcaataccatgcgattctccgaaggagacagctccgtgcaaagttagaggctgaaaacaagctggtgaaaaaccgcaagccgtacctccatgaatcccggcatcaacacgcgatgaagagagctcggggaacaggggaccaacgcctagcgggcgaattcttattccaccaaatatgccagctgatgcaccaatttatgtgaatgcaaaacagtgttcagccatcattcgacgtcgccatgctcgtgccaaggcagagagggagaataggctggtcaaagctagaaaaccatatcttcacgaatcacgccatcttcatgcaatgcgtcgtgcaagaggctctggtgggcgcttcctcaacacgaagaaagagaccaa

primers for interfering the vector fragments and connecting enzyme cutting sites are designed according to the conserved domains of the OsNF-YA1, 2, 10 and 11 and are used for constructing the expression vector RNAi-OsNF-YA. The pTCK303 vector is digested with KpnI and BamHI, and then is connected with PCR products of primers SEQ ID No. 45 and SEQ ID No. 46 to obtain a positive recombinant plasmid. The positive recombinant plasmid was double digested with Spel I and Sac I and ligated with the PCR products of primers SEQ ID No. 47 and SEQ ID No. 48, and positive clones were selected for sequencing. The primer sequences used were as follows:

RNAi-OsNF-YA-KpnI-F ctgtcgacctcgagggtacccacatgctattatgcat

(SEQ ID No:45)；

RNAi-OsNF-YA-BamHI-R tcgcccgctaggcgttggtcccctgttccccgagctctct

(SEQ ID No:46)；

RNAi-OsNF-YA-Spel I-F agagagctcggggaacaggggaccaacgcctagcgggcga

(SEQ ID No:47)；

RNA-OsNF-YA-Sac I-R caggtcgactctagaggatccttggtctctttcttcgtgtt

(SEQ ID No:48)；

the RNAi-OsNF-YA expression vector was confirmed to have been successfully constructed by sequencing.

Example 3 Rice genetic transformation analysis experiment

(1) Agrobacterium transformation: the plasmid containing the target vector is transformed into Agrobacterium tumefaciens GV3101 by the following steps: adding 2 μl of plasmid into 50 μl of competent cell, mixing, adding into electrode cup with early cooling, transforming with 220V voltage shock method, adding 600 μl of non-resistant LB liquid medium, shake culturing at 28deg.C for about 3 hr, spreading on KR solid plate containing 50 μg/ml Kan and 50 μg/ml Rif, and culturing at 28deg.C for 3d.

(2) Callus induction culture: selecting plump rice seeds (Japanese sunny) and removing glume, selecting high-quality seeds, soaking in 75% ethanol solution for 10min, washing with sterile water for 5-10 times, soaking in 30% sodium hypochlorite solution for 20-30min, and washing with sterile water for 5-10 times; then placing the cleaned seeds on sterile filter paper to absorb water, placing the seeds into an induction culture medium by using sterile forceps, culturing the seeds in a 28 ℃ illumination incubator for 3 weeks until the calli grow out, selecting the optimal calli into a secondary culture medium by using the sterile forceps, and subculturing the calli in the 28 ℃ illumination incubator for 1 week.

(3) From cultureThe mature single colony plate is picked up and subjected to PCR verification, positive clones are inoculated in 100mL of LB liquid medium containing 50 mug/mL Kan and 50 mug/mL Rif, and cultured to OD in a constant temperature shaker at 28 ℃ and 220r/min ₆₀₀ =about 0.5; soaking the induced callus in agrobacterium suspension culture solution, taking out, and culturing in co-culture medium for 2.5d; the callus is placed on a culture medium containing 50mg/L hygromycin for 30-45d screening, the screened callus is placed in a differentiation culture medium for differentiation culture, and light culture is carried out for 22d after dark culture for 3d. After green buds grow out, transferring the green buds into a rooting culture medium for culturing for about 15 days to obtain transgenic plants. And obtaining 20 positive plants through transgenic positive identification.

Example 4 Positive identification of transgenic plants

Positive transgenic plants were extracted for total RNA, reverse transcribed to cDNA, and rice UBQ gene was used as an internal reference as in example 1. The quantitative primers are shown as SEQ ID No. 12-35, and 2 strains RNAi-OsNF-YA#7 and RNAi-OsNF-YA#8 with the expression level significantly lower than that of NIP are selected from 20 strains obtained before, and the RNAi-OsNF-YA#8 with the (# relative expression level) is significantly lower than that of the NIP in a control group (see figure 2), so that the construction of the transgenic rice strain is proved to be successful.

EXAMPLE 5 Artificial Vaccination with RSV

(1) The control NIP, RNAi-OsNF-YA #7 and RNAi-OsNF-YA #8 transgenic rice seeds are placed in a constant temperature 37 ℃ incubator for seed soaking for 2-3d, water is changed in the morning and evening every day, after the seeds bud, the seeds are sown in a 1L glass beaker, 30 seedlings are planted in each cup, 3 biological repeats are designed, and the seeds are placed in a climatic chamber for culturing at 30 ℃ for 16 hours under illumination for 8 hours.

(2) And (3) carrying out a virus inoculation test on the 1-2-year-old Laodelphax striatellus with the population area toxicity rate of more than 50% according to the proportion of 3 heads/plant seedling grafting, and sweeping out all insects after 3 days of virus inoculation.

(3) After transplanting the rice seedlings subjected to virus inoculation to a field for 20d, observing plant disease symptoms and determining the disease condition of the rice through qRT-PCR.

Example 6 RNAi-OsNF-YA transgene resistance analysis to RSV infection

qRT-PCR detection of viral content in infected plants

After 20d of rice transplanting into the field, the disease symptoms were observed, and RNAi-OsNF-YA#7 and RNAi-OsNF-YA#8 showed significant resistance to infection with RSV, as shown in FIG. 3. Further, qRT-PCR is used for detecting the expression quantity of the genes of the virus RSV CP and RSV P2, as shown in figure 4, and the expression quantity of the genes of the virus CP and P2 in the transgenic line is obviously lower than that of NIP; the results show that inhibiting the expression of the OsNF-YA gene can enhance the resistance of rice to RSV infection.

The quantitative primer sequences were as follows:

qRSV-CP-F aggcaatcaatgacatctcc(SEQ ID No:49)；

qRSV-CP-R atctctcacaaagccagtgc(SEQ ID No:50)；

qRSV-P2-F acgggtttcagtttgctaca(SEQ ID No:51)；

qRSV-P2-R cactcatgtgctccaaccaa(SEQ ID No:52)；

EXAMPLE 7 Artificial inoculation of SRBSDV

(2) The 1-2-year-old nontoxic sogatella furcifera is transferred to the insect-raising seedling for a transition and recycling period of about 10d after being subjected to 3-5d of toxicity acquisition on the rice seedling infected by the SRBSDV (the time required by the SRBSDV to complete the infection cycle in the sogatella furcifera).

(3) The sogatella furcifera in the transitional period is inoculated on the test seedling in the three-four leaf period (about 15 d) according to the proportion of 3 heads/plant seedling for virus inoculation test, and all insects are swept out after 3d of virus inoculation.

(4) After transplanting the rice seedlings subjected to virus inoculation to a field for 30d, observing plant disease symptoms and determining the disease condition of the rice through qRT-PCR.

Example 8 RNAi-OsNF-YA transgene resistance analysis to SRBSDV infection

qRT-PCR detection of viral content in infected plants

After transplanting the rice into the field for 20 days, the disease symptoms were observed, and RNAi-OsNF-YA#7 and RNAi-OsNF-YA#8 showed significant resistance to infection by SRBSDV, as shown in FIG. 5. Further, the qRT-PCR is used for detecting the expression quantity of the genes of the viruses SRBSDV S2, SRBSDV S4 and SRBSDV S6, as shown in figure 6, the expression quantity of the genes of the viruses S2, S4 and S6 in the transgenic strain is obviously lower than NIP; the results show that inhibiting the expression of the OsNF-YA gene can enhance the resistance of rice to SRBSDV infection.

The quantitative primer sequences were as follows:

qSRBSDV-S2-F catcgaccaagttcaacccg(SEQ ID No:53)；

qSRBSDV-S2-R aagaagtctgcgggtgaaga(SEQ ID No:54)；

qSRBSDV-S4-F aaagtgaacccgttgctgac(SEQ ID No:55)；

qSRBSDV-S4-R tgcaacgctagatcctatgc(SEQ ID No:56)；

qSRBSDV-S6-F atctgcttttccccttccga(SEQ ID No:57)；

qSRBSDV-S6-R gattccgcgtttgaagagtca(SEQ ID No:58)；

the test results above are combined to show that: inhibiting the expression of the OsNF-YA gene in rice significantly enhances rice resistance to RSV and SRBSDV infection (including phenotypic symptoms, morbidity, and viral content of the diseased plant) compared to control NIP. Therefore, the invention successfully obtains double-resistance transgenic rice with SRBSDV resistance and RSV infection resistance in a transgenic mode, has important significance on agricultural development and national grain safety, and obtains unexpected technical effects.

SEQUENCE LISTING

<110> university of Ningbo

Application of rice transcription factor OsNF-YA in resisting viruses of rice

<130> 1

<160> 58

<170> PatentIn version 3.3

<210> 1

<211> 720

<212> DNA

<213> Artificial sequence (unknown)

<400> 1

atgctccctc ctcatctcac agaaaatggc acagtaatga ttcagtttgg tcataaaatg 60

cctgactacg agtcatcagc tacccaatca actagtggat ctcctcgtga agtgtctgga 120

atgagcgaag gaagcctcaa tgagcagaat gatcaatctg gtaatcttga tggttacacg 180

aagagtgatg aaggtaagat gatgtcagct ttatctctgg gcaaatcaga aactgtgtat 240

gcacattcgg aacctgaccg tagccaaccc tttggcatat catatccata tgctgattcg 300

ttctatggtg gtgctgtagc gacttatggc acacatgcta ttatgcatcc ccagattgtg 360

ggcgtgatgt catcctcccg agtcccgcta ccaatagaac cagccaccga agagcctatt 420

tatgtaaatg caaagcaata ccatgcgatt ctccgaagga gacagctccg tgcaaagtta 480

gaggctgaaa acaagctggt gaaaaaccgc aagccgtacc tccatgaatc ccggcatcaa 540

cacgcgatga agagagctcg gggaacaggg gggagattcc tcaacacaaa gcagcagcct 600

gaagcttcag atggtggcac cccaaggctc gtctctgcaa acggcgttgt gttctcaaag 660

cacgagcaca gcttgtcgtc cagtgatctc catcatcgtc gtgcgaaaga gggcgcttga 720

<210> 2

<211> 954

<212> DNA

<213> Artificial sequence (unknown)

<400> 2

atgataatgc tgttgcaaga aatggagaat catcctgtcc aatgcatggc caagaccaac 60

tatgattttc ttgccaggaa taactatcca atgaaacagt tagttcagag gaactctgat 120

ggtgactcgt caccaacaaa gtctggggag tctcaccaag aagcatctgc agtaagtgac 180

agcagtctca acggacaaca cacctcacca caatcagtgt ttgtcccctc agatattaac 240

aacaatgata gttgtgggga gcgggaccat ggcactaagt cggtattgtc tttggggaac 300

acagaagctg cctttcctcc ttcaaagttc gattacaacc agccttttgc atgtgtttct 360

tatccatatg gtactgatcc atattatggt ggagtattaa caggatacac ttcacatgca 420

tttgttcatc ctcaaattac tggtgctgca aactctagga tgccattgcc tgttgatcct 480

tctgtagaag agcccatatt tgtcaatgca aagcaataca atgcgatcct tagaagaagg 540

caaacgcgtg caaaattgga ggcccaaaat aaggcggtga aaggtcggaa gccttacctc 600

catgaatctc gacatcatca tgctatgaag cgagcccgtg gatcaggtgg tcggttcctt 660

accaaaaagg agctgctgga acagcagcag cagcagcagc agcagaagcc accaccggca 720

tcagctcagt ctccaacagg tagagccaga acgagcggcg gtgccgttgt ccttggcaag 780

aacctgtgcc cagagaacag cacatcctgc tcgccatcga caccgacagg ctccgagatc 840

tccagcatct catttggggg cggcatgctg gctcaccaag agcacatcag cttcgcatcc 900

gctgatcgcc accccacaat gaaccagaac caccgtgtcc ccgtcatgag gtga 954

<210> 3

<211> 1065

<212> DNA

<213> Artificial sequence (unknown)

<400> 3

atgctgagct tcaagcagag ccacgagggg ttcggccatg tcgccgccgc tggagctgga 60

ccgcagcagc agcagcagcc gtggtgggcg gggtcgcagc tgctgtacgg ggaggcgtcg 120

ccggaggagg cggcgctgcg cgacggcggc cagttccagg tcgtgcccgg aggccgcgcc 180

gcgctggatc cggcggcgcc ggagccggag aagacggcgg tgccggcgat gcccaagaga 240

ggaggaggag gaggggctcc tgaggtgctg aaattctcgg tgttttcagg taatttggag 300

ccgggagata caggagagaa gaacagagag cactctgcca ctattgcaat gcaatcgccg 360

ttgccagaat acaacggcca tttcgagctt ggtcttggtc aatccatggt ctctcccaat 420

tatccttgta ttgaccaatg ctatggtctt atgaccacct acgcgatgaa atcaatgagt 480

ggcgggcgaa tgctactgcc gctgaacgcg ccagccgatg cgccgatcta tgtcaacgcg 540

aagcagtacg aaggcatcct ccgccgtcgc cgtgcccgcg ccaaggccca gagggagaac 600

aggctggtca aaggcaggaa gccctacctc cacgagtcgc gccaccgcca cgccatgcgc 660

cgggccagag gctccggcgg ccgcttcctc aacaccaaga aagaagccac cgccgccgga 720

tgcggcggca gcagcaagac gcccctcgcg tccctcgtca gccccgccga cgtagcccat 780

cgtccaggct ccggcggccg cgcgtccagc ctctccggct ccgacgtgtc gtcgccggga 840

ggcgtcatgt acgaccacca ccgccacgac gacgccgacg cggcggacca ctacaacagc 900

atcgaccacc acctccgcac gccgttcttc accccgctcc cgatcatcat ggacagcggc 960

ggcggcggcg gcgaccacgc ctcacactcc gccgccgccg tcgccgcccc cttcaggtgg 1020

gcgacggcgg ccggcgacgg ctgctgcgag ctcctcaagg cgtga 1065

<210> 4

<211> 777

<212> DNA

<213> Artificial sequence (unknown)

<400> 4

atggagtcga ggccgggggg aaccaacctc gtggagccga gggggcaggg cgcgctgccg 60

tccggcatac cgatccagca gccgtggtgg acgacctccg ccggggtcgg ggcggtgtcg 120

cccgccgtcg tggcgccggg gagcggtgcg gggatcagcc tgtcgggcag ggatggcggc 180

ggcgacgacg cggcagagga gagcagcgat gactcacgaa gatcagggga gaccaaagat 240

ggaagcactg atcaagaaaa gcatcatgca acatcgcaga tgactgcttt ggcatcagac 300

tatttaacac cattttcaca gctggaacta aaccaaccaa ttgcttcggc agcataccag 360

taccctgact cttactatat gggcatggtt ggtccctatg gacctcaagc tatgtccgca 420

cagactcatt tccagctacc tggattaact cactctcgta tgccgttgcc tcttgaaata 480

tctgaggagc ctgtttatgt aaatgctaag caatatcatg gaattttaag acggaggcag 540

tcacgtgcga aggctgaact tgagaaaaaa gttgttaaat caagaaagcc ctatcttcat 600

gagtctcgtc atcaacatgc tatgcgaagg gcaagaggaa cgggtggacg cttcctgaac 660

acaaagaaaa atgaagatgg tgctcccagt gagaaagccg aaccaaacaa aggagagcag 720

aactccgggt atcgccggat ccctcctgac ttacagctcc tacagaagga aacatga 777

<210> 5

<211> 1074

<212> DNA

<213> Artificial sequence (unknown)

<400> 5

atgagaagtg cagctctgag cttccaagat cacggccatg ggcttcaggc gatcaccggc 60

cgtggcggca atggcggcgc cgccgctcac gcattgccat ggtgggctgg agccggagcc 120

ggagctggat cccaaacact gcttggaaca ggaggaggag aagaatcatt ctgccaatta 180

agcaacacaa tcatggagga cacccgaatc ctgcaaaacc accaccacca gatcctcgcc 240

gccggccggc agctgcagca gcgccaccac ttcccggcaa tgccgccgga gcgacaccac 300

caccctcctc ctccagctcc tggaagccct gccatgaagt tcccaatcat ctcaggtgac 360

tctgatcttg gcaaagatct gaagttccat gagtcctccg cgccgaccat cgccgcgtac 420

tcgccattgc aggagtacca aggacacttt gagctagccc ttggccactc catggtttgc 480

accaacttct gcaactctga acaaagctat ggtgtttact ccccctatgg agctcaaacc 540

atggctggga ggatgctgct gccgccggcg atcgccaccg acgtgggtcc gatctacgtc 600

aacgcgaagc agttcaacgg catcatccgg cggcggctgg cgcgcgccaa ggcggagcgg 660

gagcaccggg tttcccggag ccggaagccg tacctccacg agtcgcgcca ccgccacgcc 720

atgcgccgcg cgcggggcag cggcggccgc ttcctcaaca ccaagaacgc ctcctccgcc 780

gccgccgcgg ccgccgacgc ggcgccggtg agctccggtg gcggcgacca cggggcgagc 840

aacaagagct cgtcggcgtc ggaggcgacg cgcgtgtacg acgacgacga cgacatgggc 900

gcgggcggcg gcggcgacgg cggcgacttc caccacgcga tgggtcacct ccgctcgccg 960

gcgttcttcc cgtcgctggc cgcgatgatg gacggcggcg gcggcggcgg cgaggggaag 1020

tgggcgaccg cgacgcctca ccatggctgc cgcgtcgacc tcctcaaggt gtga 1074

<210> 6

<211> 915

<212> DNA

<213> Artificial sequence (unknown)

<400> 6

atgctaatgc ttttgcgaca aatggaagat catcgagccc atactacgcc caactatgat 60

tttttctctg gagattatca gatgaagcag ttaggtcata agatgtatga tcaagattcc 120

ccgtcaagcg attctggaca gtcacaccaa gaagaatctg ccatgaatga tagcagtcca 180

aatgagcgac atacctcaac acaatctgac aatgatgatg gtcatcagat gccagatcag 240

gacaaaacaa agtcagtatc atcgttgggg aatccaggag ctttgcctcc aaagctcaac 300

tatagccaat cctttgcttg tattccttat acagctgatg catactatgg tggggtcttg 360

actggatatt cttcacatgc aattgttcat ccccagcaaa atggtacagc taactcccgg 420

gtgccgttgc ctgttgagcc tgcagcagaa gagccaatat ttgtaaacgc aaagcagtac 480

catgcaattc ttaggaggag acagatacga gctaaattgg aggcccaaaa taagttggtg 540

aaaggtcgga agccatacct ccatgaatct cggcatcgcc atgccatgaa gcgagctcgt 600

ggatctggag ggcgcttcct caacacaaag cagctcgagg agcagaagca gcaacaggag 660

gaggaggccg catccggtgg cgcgagctct ggcaatagga catgccttca gaatggcacc 720

ggtagcgcgc cttcagcttc ctctccctct gaaatcgcga gcgtctcaac cagcagagaa 780

ttccttggta accatgagca gagccacttc ccctcagctg gcttccttcc cacaatgagc 840

ttcagagcgc agaatggcgg agatgggaag ctggtcgcga acgccattca ccagcgcgtt 900

tccatgatga ggtga 915

<210> 7

<211> 582

<212> DNA

<213> Artificial sequence (unknown)

<400> 7

atgaagccag atggtgaaac tcagcttcgt cctacagctg ctggacatcc agatcctggt 60

ttgggcacat catctgcaga atacgtggcc tctctaggac cagctacagc tccagtatct 120

tatccatata tcagtaccta ttatggaggc acttatggtg cttatagtgg acaacctctg 180

gttaacgctg ctttaatggc aatgcctccg cattctgtgc ccttggtgac cgatgctgtt 240

gtagagccca tatatgtcaa tgcaaggcag tatcatggta tattaaggcg gcgccaatct 300

cgtgcaaaag ctgaatcaga aaataaggcc aacaaaatcc gcaagcctta cctacatgag 360

tcccgccatc tgcatgcttt gaaaagggca agggggtccg gtggtcgatt tctcaactct 420

aaggctgtgg aggggaagca agacactaaa tctgtagata aaaaggatgg agctgtgcca 480

tctgaggaga agagagacaa gaagttggca aatagcatta tcaaattgga gaactcgagc 540

ccaacaacac aaccaggtgc agatgcgtcc gatgttgtat ga 582

<210> 8

<211> 501

<212> DNA

<213> Artificial sequence (unknown)

<400> 8

atgggttttg gtgaaagcac ccagggcaat caacgtaagc ttgatggtcc tgggaaagtg 60

tcaactgaat tatccctagt caatctagaa gctaaaaatt tgcatcctaa acctgagtgc 120

aaccaaccta ttgaacacat acctaccaag ggtatgaagt gtactccact gctaccacta 180

cctacagaac atgctgatga tgagcctata tatgtgaatg caaagcagta ccatgcaatt 240

atccgaagga gacaacgtcg aaaaattgtt ggatcagaag ataaagtagc agcaattcga 300

aagaggatcc ttgttgaggc tcgccaaaag caagcaaaat tgaggcatag aggaaaaggc 360

ggacggttta ttagcataga acatcccctt gaactttcta tggatgatca gatatcgaaa 420

aacggaggaa gtgcctcgcc ttcttcatct acagtgtcag aaaactctag caatgtgaac 480

ggttttacag gagatctcta a 501

<210> 9

<211> 600

<212> DNA

<213> Artificial sequence (unknown)

<400> 9

atgacgtctg tagttcatga tgtttcaggc aaccatggag ctgatgagcg gcaaaaacag 60

caaaggcaag gtgaacctga ggaccagcaa gaagcctcag ttactagtac agatagccat 120

acaatggtag caacaccttc aacagattat gcgacaccct atgcccatca cgatatggcc 180

catgcaatgg gccaaattgc ttacgcaaat attgatccat attacggaag cctttatgca 240

gcttatggtg gacagcctat gatgcatcca ccattggtcg ggatgcatcc agctggacta 300

ccactgccta ccgatgcaat tgaagagcct gtctatgtta atgcaaaaca gtacaatgcc 360

atattaaggc gtcgacaatc tcgagccaaa gctgagtctg aaaagaagct tgtcaagggc 420

cgtaagccat atctccatga gtcacggcat caacatgccc tgaaaagggc taggggagct 480

ggaggccgat ttcttaattc aaaatcggat gacaaggaag agcattctga ttccagttcc 540

agagataaac aggatggagt tgcaccccgt gatagtggcc aaccgtctac ctctccgtct 600

<210> 10

<211> 936

<212> DNA

<213> Artificial sequence (unknown)

<400> 10

atgatgagct tcaacaagag ccaagaagga tttgggcagg ttgctgctgt ggccaccctg 60

gcctccaatg gaggaggctc tctaccatgg ctgctgtacg gcgagccact ggggcagggg 120

aagccggcca tgtcgccgga gggcgtggtg ccgagagcac agactcctct ggatcctcct 180

caggttccag ccatggacag gggtgtccct gaaattctga acttctccat ggttccaggt 240

aaaggagaaa aatgttctga gcactcaact actattgctc tgcagtcacc atttgcagaa 300

tataatggct gttttgagct gggccttggt caatctgtgg ttccctctaa ttatccttat 360

gctgaccagc actatggcct actttctcct tatggagtga gaccaacgcc tagcgggcga 420

attcttattc caccaaatat gccagctgat gcaccaattt atgtgaatgc aaaacagtgt 480

tcagccatca ttcgacgtcg ccatgctcgt gccaaggcag agagggagaa taggctggtc 540

aaagctagaa aaccatatct tcacgaatca cgccatcttc atgcaatgcg tcgtgcaaga 600

ggctctggtg ggcgcttcct caacacgaag aaagagacca atgggaaaac cactggtgga 660

ggcaggaagg tgatggacat catcatcccg cctctgtgcc ccgccgcatc tcccagctcg 720

gagcagtgca acccaagcag cgtttccagc ctgtccgggt cagaggtgtc gagcatatat 780

gaacacgaag acatggacca cttccatagc tttgatcatc tccggacaca cttcttcacc 840

ccgctcccga gcctcatgga tgtcgagcac ggggctggta accccttcaa gtggacagca 900

gcctctgatg gctgctgtga cctcctcaaa gcatga 936

<210> 11

<211> 813

<212> DNA

<213> Artificial sequence (unknown)

<400> 11

atgcttctcc cctcatcgtc ttcttattcc tacgcctcca aaggtgactc cttcaggaga 60

actgttgatg gtcctatgag gtcaacgttg acttttgata ataatcattc tgtagtgcca 120

agtcaaaaca ttgattacgg ccagccaatg gcttgcattt catacccata caacgattct 180

ggttcaggag tttgggcatc ctacagttca cgctcggtgt tccatcctca aattgtggga 240

ggaggcacat cgccaagagt tcccttgccc tccctggaga tagcagatga tgggcccata 300

tatgtcaatc ccaaacaata tcatggaatt cttcgcagaa gacaactgcg tgctaagtta 360

gaggcccaga ataagctcgt caaaacccga aagccttacc ttcacgaatc tcggcatcgc 420

catgcaatga agagggctag gggcactggt gggcgattcc tgaataccaa gcagctccag 480

ctgcagcaac agtctcacac tacctccacc aagaccacca cagacagcca aaattcttca 540

ggttcagtcc atctacggct aggtggtggc gcaatcggag atcaaactcc atttccgttc 600

aaagcaatgg attcacaagc taacatcaag agagctgcag cttctgcttc caccttcact 660

gtaacttctg cggcacagaa agacgacgcc ttcttcgacc gccatggcca ccatctcagt 720

agcttctccg gccattttgg ccaggcaagc gcacaaggtg gcgtcggcag catgcataac 780

gggtcacagc agagggttcc tgctatgaga tga 813

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 12

tgaagtgtct ggaatgagcg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 13

cagcaccacc atagaacgaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 14

atcaggtggt cggttcctta 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 15

gttctggttc attgtggggt 20

<210> 16

<211> 20

<212> DNA

<213> artificial sequence

<400> 16

ggtgctgaaa ttctcggtgt 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 17

tgatttcatc gcgtaggtgg 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 18

tgccgttgcc tcttgaaata 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 19

tgtttggttc ggctttctca 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 20

tgccatgaag ttcccaatca 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 21

tttgagctcc atagggggag 20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 22

ctgcagcaga agagccaata 20

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 23

aaggcatgtc ctattgccag 20

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 24

atacgtggcc tctctaggac 20

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 25

cagcttttgc acgagattgg 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 26

cctgagtgca accaacctat 20

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 27

atgctaataa accgtccgcc 20

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 28

atgcagctta tggtggacag 20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 29

ttaagaaatc ggcctccagc 20

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 30

gccttggtca atctgtggtt 20

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 31

tgcatgaaga tggcgtgatt 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 32

aggagtttgg gcatcctaca 20

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 33

aacttagcac gcagttgtct 20

<210> 34

<211> 21

<212> DNA

<213> Artificial sequence (unknown)

<400> 34

accacttcga ccgccactac t 21

<210> 35

<211> 19

<212> DNA

<213> Artificial sequence (unknown)

<400> 35

acgcctaagc ctgctggtt 19

<210> 36

<211> 19

<212> DNA

<213> Artificial sequence (unknown)

<400> 36

atgctccctc ctcatctca 19

<210> 37

<211> 19

<212> DNA

<213> Artificial sequence (unknown)

<400> 37

ttaagcgccc tctttcgca 19

<210> 38

<211> 21

<212> DNA

<213> Artificial sequence (unknown)

<400> 38

atgataatgc tgttgcaaga a 21

<210> 39

<211> 19

<212> DNA

<213> Artificial sequence (unknown)

<400> 39

ttacctcatg acggggaca 19

<210> 40

<211> 21

<212> DNA

<213> Artificial sequence (unknown)

<400> 40

atgatgagct tcaacaagag c 21

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 41

ttatgctttg aggaggtcac 20

<210> 42

<211> 19

<212> DNA

<213> Artificial sequence (unknown)

<400> 42

atgcttctcc cctcatcgt 19

<210> 43

<211> 18

<212> DNA

<213> Artificial sequence (unknown)

<400> 43

ttatctcata gcaggaac 18

<210> 44

<211> 480

<212> DNA

<213> Artificial sequence (unknown)

<400> 44

cacatgctat tatgcatccc cagattgtgg gcgtgatgtc atcctcccga gtcccgctac 60

caatagaacc agccaccgaa gagcctattt atgtaaatgc aaagcaatac catgcgattc 120

tccgaaggag acagctccgt gcaaagttag aggctgaaaa caagctggtg aaaaaccgca 180

agccgtacct ccatgaatcc cggcatcaac acgcgatgaa gagagctcgg ggaacagggg 240

accaacgcct agcgggcgaa ttcttattcc accaaatatg ccagctgatg caccaattta 300

tgtgaatgca aaacagtgtt cagccatcat tcgacgtcgc catgctcgtg ccaaggcaga 360

gagggagaat aggctggtca aagctagaaa accatatctt cacgaatcac gccatcttca 420

tgcaatgcgt cgtgcaagag gctctggtgg gcgcttcctc aacacgaaga aagagaccaa 480

<210> 45

<211> 37

<212> DNA

<213> Artificial sequence (unknown)

<400> 45

ctgtcgacct cgagggtacc cacatgctat tatgcat 37

<210> 46

<211> 40

<212> DNA

<213> Artificial sequence (unknown)

<400> 46

tcgcccgcta ggcgttggtc ccctgttccc cgagctctct 40

<210> 47

<211> 40

<212> DNA

<213> Artificial sequence (unknown)

<400> 47

agagagctcg gggaacaggg gaccaacgcc tagcgggcga 40

<210> 48

<211> 41

<212> DNA

<213> Artificial sequence (unknown)

<400> 48

caggtcgact ctagaggatc cttggtctct ttcttcgtgt t 41

<210> 49

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 49

aggcaatcaa tgacatctcc 20

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 50

atctctcaca aagccagtgc 20

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 51

acgggtttca gtttgctaca 20

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 52

cactcatgtg ctccaaccaa 20

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 53

catcgaccaa gttcaacccg 20

<210> 54

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 54

aagaagtctg cgggtgaaga 20

<210> 55

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 55

aaagtgaacc cgttgctgac 20

<210> 56

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 56

tgcaacgcta gatcctatgc 20

<210> 57

<211> 20

<212> DNA

<213> Artificial sequence (unknown)

<400> 57

atctgctttt ccccttccga 20

<210> 58

<211> 21

<212> DNA

<213> Artificial sequence (unknown)

<400> 58

gattccgcgt ttgaagagtc a 21

Claims

1. A preparation method of a transgenic plant resistant to rice stripe virus and southern rice black-streaked dwarf virus comprises the step of simultaneously inhibiting OsNF-YA1, osNF-YA2, osNF-YA10 and OsNF-YA11 by RNAi, wherein the nucleotide sequences of OsNF-YA1, osNF-YA2, osNF-YA10 and OsNF-YA11 are SEQ ID NO.1, 2, 10 and 11 respectively.

2. The method of manufacturing according to claim 1, characterized in that: SEQ ID NO. 44 is used as the interfering vector sequence.