CN112111510B

CN112111510B - Application of Oscpy and encoded protein thereof in improving rice quality

Info

Publication number: CN112111510B
Application number: CN202011041364.6A
Authority: CN
Inventors: 彭晓珏; 阳菁; 朱友林; 丁霞; 王鑫
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2020-09-28
Filing date: 2020-09-28
Publication date: 2022-03-15
Anticipated expiration: 2040-09-28
Also published as: CN112111510A

Abstract

The invention relates to rice orphan gene Oscpy and application of encoding protein thereof, which reduces the chalkiness degree and/or chalkiness rate of crops by regulating and controlling the expression of Oscpy. In the invention, an RNAi interference vector of an Oscpy gene with good interference effect is constructed by the inventor, and the rice orphan gene Oscpy and the encoding protein thereof are explored in rice application, so that the expression of the gene is reduced to reduce the chalkiness degree and chalkiness rate of rice and improve the rice quality. Therefore, the rice orphan gene Oscpy and the protein thereof can be applied to improving the rice quality, can be popularized to the technical field of rice breeding, and can improve the rice quality.

Description

Application of Oscpy and encoded protein thereof in improving rice quality

Technical Field

The invention belongs to the field of biological gene engineering, and particularly relates to a new orphan gene Oscpy in rice and application of a coding protein thereof in improving rice quality.

Background

Chalkiness is one of the important indicators of the appearance quality of rice, wherein chalkiness is a white opaque part in the endosperm of rice and is caused by light transmittance change due to gaps among starch grains of the endosperm. Chalkiness is the percentage of the area of the chalky part in rice that is the projected area of the grain.

The chalky grain rate is the rate of chalky rice grains in rice grains and is an important quality index of rice. It not only relates to the good appearance, but also has great influence on the processing quality and the cooking quality. The state establishes the standard: the first grade high quality rice is inferior rice with the chalky grain rate of less than 10%, the second grade is 11% -20%, the third grade is 21% -30%, and the chalky grain rate of more than 30%.

Studies of Chen and Jian nationality show that for F₂Rice generation and chalkiness expression is mainly regulated and controlled by maternal genetic factors. The research of forest establishment and the like shows that the direct additive regulation of seeds and the additive regulation of female parents on the expression of chalkiness has larger influence. In addition, the white heart and the white abdomen are affected by recessive monogenic inheritance. The genetic mechanism of the chalkiness character of rice is complex and interacts with environmental factors.

The whole polished rice refers to the rice grains with the length reaching three quarters or more of the average length of the whole rice grains when the clean rice grains are hulled into brown rice by an experimental huller and the brown rice is milled into the rice grains with the processing precision of national standard grade three (GB1354) by the experimental huller. The polished rice rate is the percentage of the polished rice to the mass of the clean rice sample.

In China, the method not only improves the rice yield, but also improves the rice quality, and is an important target of rice breeding. Promotes the high-grade and the super-high quality of rice production and rice products, improves the economic added value of the rice production, and is a main direction of the rice quality improvement and high-quality rice variety breeding work at the present stage. The chalkiness proportion and the whole rice rate of rice are two key factors determining the market price of rice, and the chalkiness indirectly influences the height of the whole rice rate. The chalkiness reduction is one of the main targets of rice quality breeding. The research on the quality gene function is helpful to promote the breeding of new high-quality rice varieties and the industrialization of rice, and further improves the grain production benefit.

The "orphan gene" refers to a gene whose function and biological significance have not been known based on the existing knowledge. The "orphan Gene" has no homologous proteins in Gene and does not belong to any Gene family or Gene superfamily. Some of the orphan genes are found in yeast, human and mouse as essential genes of species, playing an important role in regulating the life activities of the species, and many of the orphan genes perform special physiological functions. We found a novel gene (LOC _ Os09g30350) in the cDNA library of rice roots, which gene has a cDNA of 1722bp in total length and encodes 573 amino acids. The protein sequence of the gene is analyzed in an InterPro and PROSITE database, a known functional structural domain cannot be identified, the gene does not belong to any gene family or supergene family, the gene is a typical orphan gene, the gene is named as OsCPY, and the expression analysis under the adversity stress (low temperature) is carried out on the gene.

In view of the complexity of gene inheritance, the rice orphan gene OsCPY encoding protein and the function of the gene are still to be further developed.

Disclosure of Invention

Based on the above, one of the purposes of the invention is to provide a new application of the rice orphan gene Oscpy and the protein thereof.

The technical scheme for achieving the purpose is as follows.

The rice orphan gene Oscpy and/or the coding protein thereof are applied to the regulation of the chalkiness degree and/or chalkiness particle rate of crops.

The application of rice orphan gene Oscpy and/or its encoded protein in breeding for improving the quality of crops by regulating the chalkiness degree and/or chalkiness rate of crops.

In one embodiment, the crop is a food crop, more preferably, the food crop is a cereal crop, and most preferably, the cereal crop is rice.

In one embodiment, the cDNA reading frame of the Oscpy gene is shown as SEQ ID NO.2, or a nucleotide sequence which is complementary and matched with SEQ ID NO.2, or a sequence with an encoding amino acid sequence shown as SEQ ID NO. 1; or a nucleotide sequence which is the above sequence and has one or more nucleotide mutations but no biological activity. Further, the biological activity is that when the expression of Oscpy is down-regulated, the chalkiness degree and/or chalkiness particle rate of rice is reduced.

A method for improving rice quality comprises regulating Oscpy gene expression to be down-regulated.

In one embodiment, the method comprises constructing an Oscpy gene RNAi interference vector; after the Oscpy gene RNAi interference vector is transformed into rice, the expression of the Oscpy gene can be regulated and controlled to be reduced.

In one embodiment, the Oscpy gene RNAi interference vector construction comprises: taking rice seedlings as materials, extracting RNA, carrying out reverse transcription on the RNA to form cDNA, amplifying a forward interference fragment (SEQ ID NO.5) of Oscpy by using a primer sequence (preferably SEQ ID NO.3 and SEQ ID NO.4CPY-SIF 22: 5'-CGCGGATCCTCCATCGTGGAGCCGGAGAA-3'; CPY-SIR 22: 5'-GCCTAAGCTTCCCTGTAGAAACCTCCTGCTCCAG-3'), connecting with interference vector pYL by enzyme digestion to construct intermediate vector PYL-Oscpy, performing PCR amplification on PYL-Oscpy by using primer sequences (preferably SEQ NO.6 and SEQ NO.7) to obtain reverse interference fragment (SEQ NO.8), after the reverse interference fragment is connected with PYL-Oscpy through enzyme digestion and connection, DH5a competent cells are transformed, positive colonies are selected, after plasmids are extracted, PCR amplification is carried out by using sequencing primers (preferably SEQ NO.9 and SEQ NO.10), and an interference vector pYL-RNNAi Oscpy is obtained after sequencing verification of amplification products.

In one embodiment, the interference vector pYL-RNAi Oscpy is used for transforming rice callus by an agrobacterium-mediated method and then cultivated into a transgenic plant, preferably, a fluorescent quantitative PCR method is used for detecting the expression down-regulation of the Oscpy gene, and an RNAi interference plant and a T-DNA insertion plant under the expression level of the Oscpy gene are obtained.

Another objective of the invention is to disclose an Oscpy gene RNAi interference vector, which can regulate and control the expression of the Oscpy gene after being transformed into rice.

An Oscpy gene RNAi interference vector is prepared by connecting a forward interference fragment containing Oscpy shown in SEQ ID NO.5 and a reverse interference fragment containing Oscpy shown in SEQ ID NO.8 to a vector.

The invention also provides transgenic rice plants (including RNAi interfering plants and T-DNA inserting plants) with expression of the Oscpy expression quantity reduced, and compared with wild type controls, the chalkiness degree of rice of the transgenic plants with expression of the Oscpy expression quantity reduced is reduced.

The invention has the following beneficial effects:

in the invention, an RNAi interference vector of an Oscpy gene with good interference effect is constructed by the inventor, and the rice orphan gene Oscpy and the encoding protein thereof are explored in rice application, so that the expression of the gene is reduced to reduce the chalkiness degree and chalkiness rate of rice and improve the rice quality. Therefore, the rice orphan gene Oscpy and the protein thereof can be applied to improving the rice quality, can be popularized to the technical field of rice breeding, and can improve the rice quality.

Drawings

FIG. 1 interference vector pYL plasmid map.

FIG. 2 the successful construction of interference vector pYL-RNNAi Oscpy, M, Maker; 1, plasmid extraction result; 2, the result of single digestion of plasmid BamHI.

FIG. 3 shows that Oscpy is detected in expression level of RNAi interfering plants.

FIG. 4 shows the expression level of the amylose synthase Gene (GBSSI) in different transgenic lines.

FIG. 5 is an observation of starch granules in the cross section of rice of each strain by using a scanning electron microscope.

Detailed Description

In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It is to be understood that the experimental procedures in the following examples, where specific conditions are not noted, are generally in accordance with conventional conditions, or with conditions recommended by the manufacturer. The various reagents used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The invention provides a rice orphan gene Oscpy, a coding protein thereof and application thereof. We cloned a rice new orphan gene, Oscpy, in a rice root cDNA library. The function research of the gene shows that the expression of the gene can be reduced to reduce the chalkiness degree and chalkiness granule rate of rice and improve the quality of the rice. The gene has great application potential in rice breeding.

RNAi interference vector construction: the seedling of the medium flower 11 of rice is taken as a material, RNA is extracted and is reversely transcribed into cDNA, a forward interference fragment (SEQ ID NO.5) of Oscpy is amplified by utilizing a primer sequence (SEQ ID NO.3, SEQ ID NO.4CPY-SIF 22: 5'-CGCGGATCCTCCATCGTGGAGCCGGAGAA-3'; CPY-SIR 22: 5'-GCCTAAGCTTCCCTGTAGAAACCTCCTGCTCCAG-3'), connecting with interference vector pYL (figure 1) by enzyme digestion to construct intermediate vector PYL-Oscpy, performing PCR amplification on PYL-Oscpy by using primer sequences (SEQ NO.6 and SEQ NO.7) to obtain reverse interference fragment (SEQ NO.8), after the reverse interference fragment is connected with PYL-Oscpy through enzyme digestion and connection, TOP 10F' competent cells are transformed, positive colonies are selected, plasmids are extracted, PCR amplification is carried out by using sequencing primers (SEQ NO.9 and SEQ NO.10), and an amplification product is subjected to sequencing verification to obtain the interference vector pYL-RNNAi Oscpy.

The interference vector pYL-RNAi Oscpy is transformed into rice callus by an agrobacterium-mediated method, then is cultivated into a transgenic plant, and the expression of the Oscpy gene is detected to be reduced by a fluorescent quantitative PCR method, so that an RNAi interference plant and a T-DNA insertion plant under the expression quantity of the Oscpy gene are obtained.

Rice quality indicators such as chalky grain rate, amylose content and the like of transgenic plants with the Oscpy expression quantity reduced are detected by using a rice quality analyzer, and rice plants with the chalky grain rate reduced and the amylose content increased are obtained.

The scanning electron microscope is used for observing the starch granules of the cross section of the transgenic rice with the Oscpy expression quantity reduced, and the starch granules in the cross section of the transgenic rice are larger and more irregularly arranged compared with the wild type.

The following media were used including:

YEB liquid medium: 10.0g/L tryptone; 1.0g/L yeast extract; 5.0g/L sucrose, 1.03g/L MgSO4 & 7H 2O; 8.0g/L agar (solid culture medium) pH7.0-7.4

The agrobacterium suspension culture medium comprises 1/2N6 macroelements and microelements, N6 ferric salt and vitamin complex, 3.0 mg/L2, 4-D; 0.6g/L hydrolyzed casein; 20g/L sucrose; 10g/L glucose; 100. mu. mol/L Acetobutyrophenone (AS), pH 5.2.

Co-culture medium: 1/2N6 macroelements and microelements, iron salt and vitamin complex; 3.0 mg/L2, 4-D; 0.8g/L hydrolyzed casein; 2% sucrose; 0.8% agar; pH 5.6, and after sterilization, cooling to about 50 ℃ and adding 20mL of 50% glucose (previously sterilized at 115 ℃ for 30min) and 1mL of acetobutyrophenone AS (100mmol/L) per liter of the medium.

Screening a culture medium: n6 macroelements and microelements, iron salt and vitamins; 2.0 mg/L2, 4-D; 0.6g/L hydrolyzed casein; 3% of sucrose; 0.8% agar; pH5.9, sterilizing, cooling to about 50 deg.C, and adding hygromycin (50mg/mL) per liter of culture medium; cefotaxime sodium (250mg/mL) and carbenicillin (250mg/mL) were each 1 mL.

Differentiation medium: MS macroelements and microelements; MS iron salt and vitamin complex; 3.5 mg/L6-BA; 1mg/L KT; 0.4mg/L NAA; 0.60g/L hydrolyzed casein; 15.0g/L sorbitol; 30.0g/L sucrose; 3.0g/L Phytagel, pH 6.0. Sterilizing, cooling to about 50 deg.C, and adding hygromycin (50mg/mL) per liter of culture medium; cefotaxime sodium (250mg/mL) and carbenicillin (250mg/mL) were each 1 mL. 7-rooting culture medium 1/2MS macroelements and microelements; MS iron salt and vitamin complex; 20g/L sucrose; 3.0g/L Phytagel; pH5.9, sterilized, cooled to about 50 ℃ and 1mL hygromycin (50mg/mL) per liter of medium.

SEQ ID NO.1

>LOC_Os09g30350.1

MDSGGNSVNSAVESVAESPAPASPASNPTAPAAVTKGRGLRRWRRIPREHHEEGSPGSGGGGGGGGSVAAAAADEDLAQLHKRRHPLGADAPKGKEEAAAAAAAAAVEEVGSESPVASVESSFAPQEAPPSPPVQTKLDPDLGFLIASAGFSVGAGGADSDNSDDRASKSSTNAAAPRHDFSFGGGFGRERDRPRSRAPGAAAHAKGIRTARTRGAHGARAATPTPSIVEPENSRSSVESNLRSSAAAHARQSSAGISSNGVHKVLYDDDDDDDDDAEQSDGEPPSEEAARSGAGGFYRENGSVVGRLVKGSSDSDADDHGYDERSIGKGENGEIHSGLDPYVQSIAMLRSAEEAIENEIQKFIEMRNETCENSANNHSETEWSSSCHFDESTEELSEKLKLLESRLNEASTLINDKDSEILELDVLNHKQPKQHVLCNTELLSLQSDMDQLFLEKMEAETQCFILTRASQAWNPLTEDQAAIFDIQKSLPEDHKQLEAKLRHTENRALMLEEMVEKLEAQCKDLARTSEILKLQARASRASLFCSVQFVLLFIAVGTFLVRLWPSSSEFVPT*

SEQ ID NO.2

>LOC_Os09g30350.1

ATGGATTCCGGCGGCAACAGCGTGAATTCTGCGGTGGAGTCGGTGGCGGAGTCGCCGGCGCCGGCTTCACCGGCGAGCAATCCCACCGCACCCGCCGCGGTCACCAAGGGGCGTGGGCTACGGCGGTGGCGGCGTATCCCCCGGGAACACCACGAGGAGGGCTCACCTGGCTCCGGCGGCGGCGGCGGCGGCGGCGGCAGCGTTGCGGCCGCTGCCGCGGATGAGGACTTGGCGCAGCTTCACAAGCGCCGGCACCCTCTCGGCGCCGACGCGCCTAAGGGGAAGGAGGAGGCCGCCGCCGCCGCCGCCGCCGCTGCCGTGGAGGAGGTGGGGAGCGAGAGCCCCGTCGCCTCCGTGGAGTCCAGCTTCGCGCCGCAGGAGGCGCCACCGTCGCCGCCGGTCCAGACCAAGCTGGACCCGGATCTCGGCTTCCTGATCGCCTCGGCGGGGTTCTCGGTGGGCGCCGGCGGCGCCGACTCGGACAACAGCGACGACCGGGCCAGCAAGTCCTCCACCAACGCCGCCGCGCCGCGCCACGACTTCTCGTTCGGCGGCGGCTTCGGCCGCGAGCGCGACAGGCCGCGATCCCGCGCCCCAGGCGCCGCCGCGCACGCCAAGGGCATCCGCACGGCGCGCACGCGCGGAGCCCACGGCGCGCGCGCCGCCACACCGACCCCCTCCATCGTGGAGCCGGAGAACTCGCGCTCCAGCGTTGAATCCAACCTCCGGAGCTCTGCCGCTGCTCATGCGCGCCAATCCAGTGCTGGCATAAGCAGCAATGGCGTTCACAAGGTTCTCTATGATGATGATGACGATGATGATGATGATGCCGAGCAGAGTGACGGCGAGCCTCCGAGCGAGGAGGCGGCGCGCTCTGGAGCAGGAGGTTTCTACAGGGAGAATGGAAGTGTAGTAGGGAGATTGGTAAAGGGCAGCAGTGATTCCGATGCCGATGATCATGGATACGATGAGAGGAGTATAGGCAAGGGTGAGAATGGGGAAATTCATTCGGGTCTCGATCCGTATGTGCAGTCGATCGCGATGCTCCGGTCAGCCGAAGAAGCAATTGAGAATGAGATCCAGAAGTTTATTGAAATGAGAAATGAAACGTGTGAAAATTCTGCAAACAACCACAGTGAAACTGAATGGAGTAGTTCATGCCATTTTGACGAATCCACAGAAGAACTGAGTGAGAAGTTGAAGCTTCTCGAGTCTAGGCTAAACGAAGCTTCTACCCTCATCAATGATAAGGATTCAGAAATACTTGAACTCGATGTGCTCAACCACAAACAACCAAAGCAGCATGTTCTATGCAATACCGAGCTGCTGTCTCTGCAATCTGATATGGATCAACTGTTCCTGGAGAAGATGGAAGCAGAGACTCAATGCTTCATCCTGACAAGAGCATCGCAAGCTTGGAATCCCCTGACTGAGGATCAAGCTGCTATTTTTGACATTCAGAAATCTCTACCTGAGGATCACAAACAGCTTGAAGCTAAGCTACGGCACACCGAGAACAGGGCACTGATGCTAGAGGAGATGGTGGAGAAGCTAGAGGCACAGTGCAAAGATCTTGCTAGGACTTCAGAAATCCTGAAGCTGCAGGCAAGAGCAAGCAGAGCTTCGCTGTTTTGCTCCGTCCAGTTTGTTCTGCTGTTCATCGCCGTCGGAACCTTCCTCGTCCGGCTATGGCCCTCTTCCTCTGAATTTGTACCTACCTGA

Forward interference fragment upstream primer sequence of SEQ ID NO.3 Oscpy

CPY-SIF22：5’-CGCGGATCCTCCATCGTGGAGCCGGAGAA-3’；

Forward interference fragment downstream primer sequence of SEQ ID NO.4 Oscpy

CPY-SIR22:5’–GCCTAAGCTTCCCTGTAGAAACCTCCTGCTCCAG-3’

Forward interference fragment sequence of SEQ ID NO.5 Oscpy

CCTCCATCGTGGAGCCGGAGAACTCGCGCTCCAGCGTTGAATCCAACCTCCGGAGCTCTGCCGCTGCTCATGCGCGCCAATCCAGTGCTGGCATAAGCAGCAATGGCGTTCACAAGGTTCTCTATGATGATGATGACGATGATGATGATGATGCCGAGCAGAGTGACGGCGAGCCTCCGAGCGAGGAGGCGGCGCGCTCTGGAGCAGGAGGTTTCTACAGGGA

Reverse interference fragment upstream primer sequence of Oscpy (SEQ ID NO. 6)

RNAi-M：5’—CACCCTGACGCGTGGTGTTACTTCTGA AGA GG—3’

Reverse interference fragment downstream primer sequence of SEQ ID NO.7 Oscpy

RNAi-P：5’—ACTAGAACTGCAGCCTCAGATCTACA TGGTGG—3

Reverse interference fragment sequence of SEQ ID NO.8 Oscpy

TCCCTGTAGAAACCTCCTGCTCCAGAGCGCGCCGCCTCCTCGCTCGGAGGCTCGCCGTCACTCTGCTCGGCATCATCATCATCATCGTCATCATCATCATAGAGAACCTTGTGAACGCCATTGCTGCTTATGCCAGCACTGGATTGGCGCGCATGAGCAGCGGCAGAGCTCCGGAGGTTGGATTCAACGCTGGAGCGCGAGTTCTCCGGCTCCACGATGGAGG

SEQ ID NO.9 sequencing primer upstream sequence

5’-CTGAACTCACCGCGACGTCTGTC-3’；

SEQ ID NO.10 sequencing primer downstream sequence

5’-TAGCGCGTCTGCT GCTCCATACA-3’

Oscpy gene quantitative specific primer upstream sequence of SEQ ID NO.11

5’-AGGGCACTGATGCTAGAGGA-3’；

Downstream sequence of Oscpy gene quantitative specific primer of SEQ ID NO.12

5’-CTCATTGGCGCCGGATTTTC-3’，

SEQ ID NO.13 reference gene OsActin upstream sequence

5’-ACCTTCAACACCCCTGCTAT-3’

SEQ ID No.14: internal reference gene OsActin downstream sequence

5’-CACCATCACCAGAGTCC AAC-3’。

The present invention is further illustrated by the following specific examples, which are not intended to limit the scope of the invention.

Example 1 construction and genetic transformation of RNA interference vectors

(1) Obtaining a forward interference fragment: extracting the total RNA of the young ear of the medium flower 11, inverting the total RNA into cDNA, and performing amplification reaction by using a designed primer pair 3: SEQ ID No.3CPY-SIF 22: 5'-CGCGGATCCTCCATCGTGGAGCCGGAGAA-3' (underlined BamHI cleavage site) and SEQ ID NO.4CPY-SIR 22: 5'-GCCTAAGCTTCCCTGTAGAAACCTCCTGCTCCAG-3' (HindIII cleavage sites underlined). A forward interference fragment (SEQ ID NO.5) of Oscpy is amplified by RT-PCR and is used for interference vector construction after sequencing verification.

(2) The RNA interference vector construction comprises the steps of carrying out double enzyme digestion, purification and recovery on a forward interference fragment (SEQ ID NO.5) and a pYL vector (shown in figure 1) by using BamH I and Hind III enzymes, then carrying out a ligation reaction by using T4DNA enzyme, transforming escherichia coli DH5a competent cells by using a ligation product, selecting positive single colonies, extracting plasmids after shaking to obtain an intermediate interference vector PYL-Oscpy, and adopting a primer pair II of SEQ ID NO.6: RNAi-M: 5 '-CACCCTGACGCGTGGTGTTACTTCTGA AGA GG-3' SEQ ID NO.7 RNAi-P: 5' -ACTAGAACTGCAGCCTCAGATCTACA TGGTGG-3; performing PCR amplification on the PYL-Oscpy, wherein the PCR amplification system and conditions are as follows: 10 XbafferI 2.5ul,10mMdNTP 0.5ul, RNAi-M0.5 ul, RNAi-P0.5 ul, cDNA 1ul, HIFI taq 0.5ul, ddH₂O19.5 ul. 94 ℃, 5min,94 ℃,30sec,60 ℃,30sec,72 ℃,30sec,30 cycles; 72 ℃ for 7 min. Obtaining a reverse interference fragment, carrying out double enzyme digestion on the reverse interference fragment and PYL-Oscpy by using Mlu I and Pst I enzymes, purifying and recycling the reverse interference fragment and the PYL-Oscpy, then carrying out ligation by using T4DNA ligase, transforming DH5a competent cells, selecting positive single colonies, shaking bacteria to extract plasmids to obtain an interference vector pYL-RNNAi Oscpy, and carrying out single enzyme digestion and BamHI and HindIII double enzyme digestion verification on a pYL-RNNAiOscpyp vector by using BamH I respectively (see figure 2).

(3) The successfully constructed RNAi interference vector pYL-RNNAiOscpy is transformed into Agrobacterium tumefaciens EHA105, and the rice callus is transformed by an agrobacterium-mediated method.

a. Callus induction and subculture.

Removing glumes of seeds of 11 medium flowers of rice, putting the medium flowers into a sterilized 100mL triangular flask, sterilizing the medium flowers for 1min by 30mL of 75% alcohol, then sterilizing the medium flowers for 6min by 0.1% mercuric chloride, washing the medium flowers for 5 times by using sterile water, inoculating the sterilized seeds into a callus induction culture medium, and putting the medium flowers into a climatic chamber to perform dark culture at 26 ℃ for about one month for callus induction. Inoculating the light yellow callus to subculture medium for amplification culture at 26 deg.C for 15-20 days.

Callus induction culture medium containing N6 macroelement and microelement, iron salt and vitamin; 3.0 mg/L2, 4-D; 0.3g/L L-proline; 0.6g/L hydrolyzed casein; 3% of sucrose; 0.3% phytagel; the pH was 5.9.

The callus subculture medium comprises macroelements and microelements of N6, iron salt and vitamins; 2.0 mg/L2, 4-D; 0.5g/L L-proline; 0.6g/L hydrolyzed casein; 3% of sucrose; 0.8% agar; the pH was 5.9.

b. Preculture

After one subculture, the callus (light yellow, dense, granular) with the size of 1-3mm is inoculated and pre-cultured in dark at 26 ℃ for 4 days.

The pre-culture medium comprises 1/2N6 macroelements, microelements, iron salt and vitamin 3.0 mg/L2, 4-D; 1.2g/L L-proline; 0.6g/L hydrolyzed casein; 2% sucrose; 0.8% agar; pH 5.6, and 20mL of 50% glucose (previously sterilized at 115 ℃ for 30min) and 1mL of acetobutyrophenone AS (100mmol/L) were added per liter of the medium after sterilization.

c. Genetic transformation

Inoculating Agrobacterium EHA105 carrying Oscpy gene interference vector pYL-RNNAi Oscpy to YEB liquid medium (adding 100mg/L kanamycin and 25mg/L rifampicin), shaking at 28 deg.C for 48 times, centrifuging to collect strain, suspending Agrobacterium again with 100 μmol/L Acetosyringone (AS) -containing Agrobacterium suspension culture medium to make OD600 of the strain to 0.1, impregnating the pre-cultured callus with the above-mentioned concentration of Agrobacterium strain for 30min, then placing the callus on sterilized filter paper to suck off excess strain, inoculating to co-culture medium (containing 100 μmol/L AS), co-culturing at 19 deg.C in dark environment for 3 days, then rapidly washing the callus with sterile water for 10 times, finally soaking the callus with sterile water containing 400mg/L cefuromycin and 250mg/L carbenicillin for 10min, then placing the callus on sterilized filter paper for airing, inoculating the callus into a screening culture medium for screening culture, after culturing for one month in a dark environment at 26 ℃, inoculating the newly grown callus into a differentiation culture medium for differentiation, inoculating the differentiated seedlings into a rooting culture medium for culture, and transplanting the seedlings into a field for planting when the height of the seedlings reaches about 10 cm.

Example 2 transgenic Positive Rice plants detection and Oscpy expression Down-regulated plant acquisition

After DNA of transgenic rice leaves is extracted by a CTAB method, hygromycin phosphotransferase gene specific primers (SEQ ID NO.9: 5'-CTGAACTCACCGCGACGTCTGTC-3'; SEQ ID NO.10: 5'-TAGCGCGTCTGCT GCTCCATACA-3') are adopted to amplify the DNA into positive rice by PCR, and the positive rice is determined as a T0 generation transgenic positive plant; a fluorescent quantitative PCR method is adopted, and an Oscpy gene specific primer SEQ ID NO.11: 5'-AGGGCACTGATGCTAGAGGA-3'; SEQ ID NO.12: 5'-CTCATTGGCGCCGGATTTTC-3', OsActin of rice is used as an internal reference gene, primer sequences of the internal reference gene are SEQ ID NO.13: 5'-ACCTTCAACACCCCTGCTAT-3' and SEQ ID NO.14: 5'-CACCATCACCAGAGTCC AAC-3', Oscpy down-regulation expression is detected, and an RNAi rice plant and a T-DNA insertion mutant plant with Oscpy down-regulation expression are obtained, as shown in figure 3, compared with a wild type middle flower 11, transgenic RNAi strains 12, 14, 36, 48 and 74 with Oscpy expression quantity remarkably reduced are obtained respectively.

Example 3 Oscpy downregulation of the chalkiness rate and chalkiness of expressing Rice

The rice with the Oscpy gene expression down-regulated (RNAi interference and T-DNA insertion mutant) and the wild rice are harvested, dried in a 45 ℃ air-blast drying oven for one week, placed at room temperature for at least two months, and glume is removed. The results of the determination of the chalky particle rate and the chalky whiteness by the department of agriculture NY/T83-2017 show that the chalky particle rate of the T-DNA mutant (cpy) is 32% + -0.04, the chalky particle rate of the RNAi interfering plant is 35.67% + -0.12 and the chalky particle rate of the wild type middle flower 11 is 51.33% + -0.05, the chalky whiteness of cpy and RNAi interfering plants is 3.7% and 4% respectively, and the chalky whiteness of the wild type middle flower 11 is 5.5%, and the data show that the expression of the Oscpy gene can reduce the chalky particle rate and the chalky whiteness of rice obviously compared with the wild type. We examined the amylose content of rice of each transgenic line according to the specification of NY/T2639, and found that the amylose content of cpy and RNAi plants is 14.6% and 15.3%, respectively, while the amylose content of Zhonghua 11 is 15.8% (Table 1), and compared with Zhonghua 11, the amylose content of rice is significantly reduced by Oscpy gene expression.

Detecting the expression level of amylose synthetase Gene (GBSSI) in each transgenic rice: meanwhile, we also found that the expression level of the amylose synthase Gene (GBSSI) in rice (RNAi12 and RNAi14) was significantly down-regulated by the Oscpy gene at day 10 of endosperm development compared to the wild type (fig. 4).

TABLE 1 determination of white grain rate and amylose content in rice of each line

Example 4 Observation of starch granules in the Cross section of Rice of Each line Using scanning Electron microscope

The rice (cpy, RNAi) RNAi12 and RNAi14 mature seed brown rice edges were down-regulated by rapidly crossing flower 11 and Oscpy gene expression in wild type with a sharp blade, and gently ripped to break it from the middle. The other side was cut with a blade, the unnatural cross section of the sample was lightly stuck to a stage with a double-sided conductive adhesive, subjected to gold spraying treatment, observed with a scanning electron microscope (Hitachi S-3400N type) and photographed (acceleration voltage set at 10-20 kV). As a result, it was found that the expression of Oscpy gene down-regulated starch granules of rice in rice became larger, more irregularly arranged and larger in gap than that of wild type rice 11, which may be the cause of the decrease of chalkiness rate and chalkiness degree thereof (FIG. 5).

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

Sequence listing

<110> university of Nanchang

<120> Oscpy and application of protein coded by Oscpy in improving rice quality

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 573

<212> PRT

<213> Oscpy protein (Oscpy)

<400> 1

Met Asp Ser Gly Gly Asn Ser Val Asn Ser Ala Val Glu Ser Val Ala

1 5 10 15

Glu Ser Pro Ala Pro Ala Ser Pro Ala Ser Asn Pro Thr Ala Pro Ala

20 25 30

Ala Val Thr Lys Gly Arg Gly Leu Arg Arg Trp Arg Arg Ile Pro Arg

35 40 45

Glu His His Glu Glu Gly Ser Pro Gly Ser Gly Gly Gly Gly Gly Gly

50 55 60

Gly Gly Ser Val Ala Ala Ala Ala Ala Asp Glu Asp Leu Ala Gln Leu

65 70 75 80

His Lys Arg Arg His Pro Leu Gly Ala Asp Ala Pro Lys Gly Lys Glu

85 90 95

Glu Ala Ala Ala Ala Ala Ala Ala Ala Ala Val Glu Glu Val Gly Ser

100 105 110

Glu Ser Pro Val Ala Ser Val Glu Ser Ser Phe Ala Pro Gln Glu Ala

115 120 125

Pro Pro Ser Pro Pro Val Gln Thr Lys Leu Asp Pro Asp Leu Gly Phe

130 135 140

Leu Ile Ala Ser Ala Gly Phe Ser Val Gly Ala Gly Gly Ala Asp Ser

145 150 155 160

Asp Asn Ser Asp Asp Arg Ala Ser Lys Ser Ser Thr Asn Ala Ala Ala

165 170 175

Pro Arg His Asp Phe Ser Phe Gly Gly Gly Phe Gly Arg Glu Arg Asp

180 185 190

Arg Pro Arg Ser Arg Ala Pro Gly Ala Ala Ala His Ala Lys Gly Ile

195 200 205

Arg Thr Ala Arg Thr Arg Gly Ala His Gly Ala Arg Ala Ala Thr Pro

210 215 220

Thr Pro Ser Ile Val Glu Pro Glu Asn Ser Arg Ser Ser Val Glu Ser

225 230 235 240

Asn Leu Arg Ser Ser Ala Ala Ala His Ala Arg Gln Ser Ser Ala Gly

245 250 255

Ile Ser Ser Asn Gly Val His Lys Val Leu Tyr Asp Asp Asp Asp Asp

260 265 270

Asp Asp Asp Asp Ala Glu Gln Ser Asp Gly Glu Pro Pro Ser Glu Glu

275 280 285

Ala Ala Arg Ser Gly Ala Gly Gly Phe Tyr Arg Glu Asn Gly Ser Val

290 295 300

Val Gly Arg Leu Val Lys Gly Ser Ser Asp Ser Asp Ala Asp Asp His

305 310 315 320

Gly Tyr Asp Glu Arg Ser Ile Gly Lys Gly Glu Asn Gly Glu Ile His

325 330 335

Ser Gly Leu Asp Pro Tyr Val Gln Ser Ile Ala Met Leu Arg Ser Ala

340 345 350

Glu Glu Ala Ile Glu Asn Glu Ile Gln Lys Phe Ile Glu Met Arg Asn

355 360 365

Glu Thr Cys Glu Asn Ser Ala Asn Asn His Ser Glu Thr Glu Trp Ser

370 375 380

Ser Ser Cys His Phe Asp Glu Ser Thr Glu Glu Leu Ser Glu Lys Leu

385 390 395 400

Lys Leu Leu Glu Ser Arg Leu Asn Glu Ala Ser Thr Leu Ile Asn Asp

405 410 415

Lys Asp Ser Glu Ile Leu Glu Leu Asp Val Leu Asn His Lys Gln Pro

420 425 430

Lys Gln His Val Leu Cys Asn Thr Glu Leu Leu Ser Leu Gln Ser Asp

435 440 445

Met Asp Gln Leu Phe Leu Glu Lys Met Glu Ala Glu Thr Gln Cys Phe

450 455 460

Ile Leu Thr Arg Ala Ser Gln Ala Trp Asn Pro Leu Thr Glu Asp Gln

465 470 475 480

Ala Ala Ile Phe Asp Ile Gln Lys Ser Leu Pro Glu Asp His Lys Gln

485 490 495

Leu Glu Ala Lys Leu Arg His Thr Glu Asn Arg Ala Leu Met Leu Glu

500 505 510

Glu Met Val Glu Lys Leu Glu Ala Gln Cys Lys Asp Leu Ala Arg Thr

515 520 525

Ser Glu Ile Leu Lys Leu Gln Ala Arg Ala Ser Arg Ala Ser Leu Phe

530 535 540

Cys Ser Val Gln Phe Val Leu Leu Phe Ile Ala Val Gly Thr Phe Leu

545 550 555 560

Val Arg Leu Trp Pro Ser Ser Ser Glu Phe Val Pro Thr

565 570

<210> 2

<211> 1722

<212> DNA

<213> Oscpy gene (Oscpy)

<400> 2

atggattccg gcggcaacag cgtgaattct gcggtggagt cggtggcgga gtcgccggcg 60

ccggcttcac cggcgagcaa tcccaccgca cccgccgcgg tcaccaaggg gcgtgggcta 120

cggcggtggc ggcgtatccc ccgggaacac cacgaggagg gctcacctgg ctccggcggc 180

ggcggcggcg gcggcggcag cgttgcggcc gctgccgcgg atgaggactt ggcgcagctt 240

cacaagcgcc ggcaccctct cggcgccgac gcgcctaagg ggaaggagga ggccgccgcc 300

gccgccgccg ccgctgccgt ggaggaggtg gggagcgaga gccccgtcgc ctccgtggag 360

tccagcttcg cgccgcagga ggcgccaccg tcgccgccgg tccagaccaa gctggacccg 420

gatctcggct tcctgatcgc ctcggcgggg ttctcggtgg gcgccggcgg cgccgactcg 480

gacaacagcg acgaccgggc cagcaagtcc tccaccaacg ccgccgcgcc gcgccacgac 540

ttctcgttcg gcggcggctt cggccgcgag cgcgacaggc cgcgatcccg cgccccaggc 600

gccgccgcgc acgccaaggg catccgcacg gcgcgcacgc gcggagccca cggcgcgcgc 660

gccgccacac cgaccccctc catcgtggag ccggagaact cgcgctccag cgttgaatcc 720

aacctccgga gctctgccgc tgctcatgcg cgccaatcca gtgctggcat aagcagcaat 780

ggcgttcaca aggttctcta tgatgatgat gacgatgatg atgatgatgc cgagcagagt 840

gacggcgagc ctccgagcga ggaggcggcg cgctctggag caggaggttt ctacagggag 900

aatggaagtg tagtagggag attggtaaag ggcagcagtg attccgatgc cgatgatcat 960

ggatacgatg agaggagtat aggcaagggt gagaatgggg aaattcattc gggtctcgat 1020

ccgtatgtgc agtcgatcgc gatgctccgg tcagccgaag aagcaattga gaatgagatc 1080

cagaagttta ttgaaatgag aaatgaaacg tgtgaaaatt ctgcaaacaa ccacagtgaa 1140

actgaatgga gtagttcatg ccattttgac gaatccacag aagaactgag tgagaagttg 1200

aagcttctcg agtctaggct aaacgaagct tctaccctca tcaatgataa ggattcagaa 1260

atacttgaac tcgatgtgct caaccacaaa caaccaaagc agcatgttct atgcaatacc 1320

gagctgctgt ctctgcaatc tgatatggat caactgttcc tggagaagat ggaagcagag 1380

actcaatgct tcatcctgac aagagcatcg caagcttgga atcccctgac tgaggatcaa 1440

gctgctattt ttgacattca gaaatctcta cctgaggatc acaaacagct tgaagctaag 1500

ctacggcaca ccgagaacag ggcactgatg ctagaggaga tggtggagaa gctagaggca 1560

cagtgcaaag atcttgctag gacttcagaa atcctgaagc tgcaggcaag agcaagcaga 1620

gcttcgctgt tttgctccgt ccagtttgtt ctgctgttca tcgccgtcgg aaccttcctc 1680

gtccggctat ggccctcttc ctctgaattt gtacctacct ga 1722

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgcggatcct ccatcgtgga gccggagaa 29

<210> 4

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcctaagctt ccctgtagaa acctcctgct ccag 34

<210> 5

<211> 223

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctccatcgt ggagccggag aactcgcgct ccagcgttga atccaacctc cggagctctg 60

ccgctgctca tgcgcgccaa tccagtgctg gcataagcag caatggcgtt cacaaggttc 120

tctatgatga tgatgacgat gatgatgatg atgccgagca gagtgacggc gagcctccga 180

gcgaggaggc ggcgcgctct ggagcaggag gtttctacag gga 223

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caccctgacg cgtggtgtta cttctgaaga gg 32

<210> 7

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

actagaactg cagcctcaga tctacatggt gg 32

<210> 8

<211> 223

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tccctgtaga aacctcctgc tccagagcgc gccgcctcct cgctcggagg ctcgccgtca 60

ctctgctcgg catcatcatc atcatcgtca tcatcatcat agagaacctt gtgaacgcca 120

ttgctgctta tgccagcact ggattggcgc gcatgagcag cggcagagct ccggaggttg 180

gattcaacgc tggagcgcga gttctccggc tccacgatgg agg 223

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctgaactcac cgcgacgtct gtc 23

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tagcgcgtct gctgctccat aca 23

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agggcactga tgctagagga 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctcattggcg ccggattttc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

accttcaaca cccctgctat 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caccatcacc agagtccaac 20

Claims

1. Rice orphan geneOscpyAnd/or the protein encoded thereby, in the reduction of the chalkiness and/or chalkiness rate of rice, saidOscpyThe cDNA reading frame of the gene is a nucleotide sequence shown as SEQ ID NO.2, or a nucleotide sequence of an amino acid sequence shown as SEQ ID NO. 1.

2. Rice orphan geneOscpyAnd/or the use of the encoded protein in breeding for improving the quality of rice by reducing the chalkiness and/or chalkiness rate of rice, saidOscpyThe cDNA reading frame of the gene is a nucleotide sequence shown as SEQ ID NO.2, or a nucleotide sequence of an amino acid sequence shown as SEQ ID NO. 1.

3. A method for improving the quality of crops is characterized by regulating and controlling the quality of cropsOscpyDown-regulation of gene expression, the crop being rice, theOscpyThe cDNA reading frame of the gene is a nucleotide sequence shown as SEQ ID NO.2 or a nucleotide sequence for coding an amino acid sequence shown as SEQ ID NO.1, and the improvement on the quality of crops is to reduce the chalkiness degree and/or chalkiness rate of rice.

4. The method of claim 3, comprising constructingOscpyA gene RNAi interference vector; will be provided withOscpyAfter the gene RNAi interference vector is transformed into rice, regulation and control are carried outOscpyExpression of the gene.

5. The method of claim 4, wherein the step of modifying the plant material comprises modifying the plant material to increase the quality of the plant materialOscpyThe construction of the gene RNAi interference vector comprises the following steps: taking rice seedlings as materials, extracting RNA, carrying out reverse transcription on the RNA into cDNA, and amplifying to obtain the DNA including SEQ IOf the sequence denoted by D number 5OscpyThe forward interference fragment is connected with an interference vector through enzyme digestion to construct an intermediate vector, a primer sequence is utilized to carry out PCR amplification on the intermediate vector to obtain a reverse interference fragment comprising a sequence shown as SEQ ID number 8, the reverse interference fragment is connected with the intermediate vector through enzyme digestion to transform DH5a competent cells, a positive bacterial colony is selected, and after a plasmid is extracted, PCR amplification is carried out to obtain the DNA fragmentOscpyGene RNAi interference vectors.

6. Method for improving the quality of crops according to claim 4 or 5, characterized in thatOscpyThe gene RNAi interference vector is used for transforming rice callus by utilizing an agrobacterium-mediated method and then is cultivated into a transgenic plant.

7. A kind ofOscpyA gene RNAi interference vector, which is characterized in that the vector comprises a gene shown as SEQ ID number 5OscpyThe forward interference fragment and the reverse interference fragment containing the same as shown in SEQ ID number 8 are connected to an interference carrier to prepare the interference carrier.

8. The method of claim 7OscpyA genetic RNAi interference vector, wherein said interference vector is pYL.