CN114931148A

CN114931148A - Application of nanocarbon sol in improvement of content of aliphatic glucosinolates in broccoli curd

Info

Publication number: CN114931148A
Application number: CN202210364816.7A
Authority: CN
Inventors: 李占省; 刘玉梅; 韩凤庆; 张硕; 刘伟; 张伟杰
Original assignee: China Vegetable Biotechnology Shouguang Co ltd; Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Current assignee: China Vegetable Biotechnology Shouguang Co ltd; Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Priority date: 2022-04-07
Filing date: 2022-04-07
Publication date: 2022-08-23
Anticipated expiration: 2042-04-07
Also published as: CN114931148B

Abstract

The invention provides application of a nanocarbon sol in improving the content of aliphatic glucosinolate (glucorapanin) in broccoli. The invention provides a method for improving the content of aliphatic glucosinolates in broccoli curd, and HPLC detection and qRT-PCR verification prove that the design and the method have the characteristics of greenness, science and technology, high efficiency and ecological environmental protection, and can directly induce the up-regulation expression of upstream regulatory genes from the aspect of molecular mechanism, so that the generation amount of partial beneficial aliphatic glucosinolates is directly improved.

Description

Application of nanocarbon sol in improvement of content of aliphatic glucosinolates in broccoli curd

Technical Field

The invention belongs to the technical field of agriculture, and particularly relates to application of a nanocarbon sol in improving the content of aliphatic glucosinolates in broccoli curd.

Background

Broccoli, also known as broccoli, cauliflower, and the like, is a variety of brassica oleracea of the brassica family, and its main edible organ is the curd of flowers. The broccoli is comprehensive in nutrition, rich in protein, vitamins and mineral substances and known as 'vegetable crown'. Research shows that the content of the beneficial glucosinolate 4-methylsulfinylbutylthioglycoside (GRA) in the broccoli is the highest in all vegetables, the GRA in vacuole and Myrosinase (MY) in cytoplasm can generate an anticancer active ingredient sulforaphane through hydrolysis reaction in the process of chewing and eating the broccoli, or the GRA can also generate sulforaphane through the action of human digestive tract flora, and according to the colleges and universities of domestic and foreign famous medical institutions such as Hopkins university and Harper medical institute, the sulforaphane is the most anticancer active ingredient found in the vegetables at present by combining clinical medical and epidemiological data. The sulforaphane is reported to have the effects of inducing phase II detoxification enzyme of a human body, inhibiting phase I detoxification enzyme, activating and improving human immunity, eliminating carcinogens, repairing DNA damage, inducing apoptosis of cancer cells and the like, can obviously reduce the incidence rate of cancers such as lung cancer, gastric cancer, breast cancer, colon cancer, bladder cancer, uterine cancer, esophageal cancer and the like, prevent cardiovascular and cerebrovascular diseases, reduce hypertension, prevent myopia, cure Parkinson's syndrome and the like, and has become an international research hotspot and frontier.

Sulforaphane (SFN, SUL), also known as sulforaphane, of formula C ₆ H ₁₁ NOS ₂ Molecular weight 177.29, is an Isothiocyanate (ITCs) species. In recent years, foreign scholars pay special attention to the influence of broccoli and extract SFN thereof on human health, and mainly focus on the field of cancer research. Multiple studies show that the 20% freeze-dried broccoli pollen and the SFN fed to the rat or the mouse can obviously induce the phase II detoxification enzyme, the induction amount has no obvious difference, and the content of the benzoquinone reductase in the liver can be obviously improvedThereby improving the immunity of the human body and eliminating toxin and the like. A large number of cell culture experiments indicate that SFN can promote apoptosis of cancer cells. The function of the SFN for inducing the apoptosis can be verified in the process of combining with the Nrf2/ARE, the action effect is different according to genotypes, but most of researches show that the concentration of the SFN for causing the apoptosis of cancer cells exceeds 10-20 mu M, however, the upregulation concentration of the Nrf2 dependent on detoxification enzyme in a cell culture experiment is 0.5-5 mu M. After the SFN is used for treating human colon cancer cells Caco-272 h, the cells show the phenomenon of cell block in a G2/M phase, and the high concentration of the SFN can cause the cell block in a G1 phase. SFN can induce the cell programmed death of DAOY cells of neural tube cell tumor, and further research shows that the effect is mainly to activate caspase-3 and caspase-9, but the apoptosis inhibitor B cell lymphoma-2 (bcl-2) is reduced. Multiple studies simultaneously indicate that this induction of SFN is closely related to concentration.

Broccoli has become one of the favorite special vegetables abroad, the area of the broccoli in China reaches more than 150 ten thousand mu since the introduction of planting in the 80 s of the last century, the annual export amount is maintained at 14-16 ten thousand tons, the broccoli has become one of the most important planting countries and important export countries in the world and becomes one of the important export foreign exchange vegetables, and the planting area of the broccoli in China is increased year by year. At present, consumers in China increasingly recognize the anticancer effect of broccoli, the market for marketing is expanded year by year, a batch of biological extraction companies are promoted, broccoli curd and seeds are used as objects for primary processing and deep processing extraction, meal replacement powder, candy slices, beverages and other foods begin to appear, and the export amount of broccoli extracts is increased year by year. At present, broccoli has become an important recommended supplementary food for infants all over the world and is popular with young and middle-aged people. Meanwhile, researches show that the content difference of GRA and SFN in different broccoli is obvious and varies from several times to hundreds of times, and the restriction is urgently broken through from the aspects of genotype and cultivation mode in consideration of the food restriction of people and the dosage effect of the active ingredient, so that the GRA content in the broccoli ball is increased, and the health requirement of a human body is better met.

The nano material is a special material in a space of 0.1-100 nm, when the physical or chemical properties of the material reach the nano scale, the material is mutated and improved, and the material has special properties, for example, after a conductive and heat-conductive copper or silver conductor is made into the nano scale, the original properties of the material can be lost, and the phenomenon that the material is not conductive or heat-conductive is subverted. The magnetic material is also the same, the iron-cobalt alloy in our daily life is made into a single magnetic domain by using a nanometer technology, and the magnetic domain of the iron-cobalt alloy is about 20-30 nm particle later, and the magnetic property of the iron-cobalt alloy is more than 1000 times higher than that of the iron-cobalt alloy. The material is a nano material which is composed of atoms and molecules with different compositions and special properties of macroscopic substances. Currently, nanotechnology has been widely studied and applied in material preparation, microelectronics, computer technology, medicine and health, aerospace, environment, energy, biotechnology, agricultural products, and the like, and has important ecological, economic and scientific values.

Therefore, based on the characteristics of north-south difference and cultivation mode of broccoli main production area and the advantages of current nanotechnology, a brand-new scientific method which is convenient to control and can improve the content of beneficial glucosinolates in broccoli bulbs needs to be developed.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide an application of a nanocarbon sol in improving the content of aliphatic glucosinolates in broccoli bulbs and a method for improving the content of aliphatic glucosinolates in the broccoli bulbs. The method can directly induce the up-regulation expression of the upstream regulation gene of part of the beneficial glucosinolates from the molecular mechanism, thereby directly improving the generation amount of part of the beneficial glucosinolates (mainly GRA).

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides an application of a nanocarbon sol in increasing the content of aliphatic glucosinolates in broccoli curd.

In the present invention, the aliphatic glucosinolate includes Glucoraaphanin (GRA) and/or Glucoreucin (GER), preferably GRA.

HPLC detection and RT-PCR verification prove that the design and the method have the characteristics of green, high efficiency and ecological environmental protection, can directly induce the up-regulation expression of the upstream regulatory gene FMOgs-ox2 of the GRA in a molecular mechanism, thereby directly improving the yield of the GRA, maximally improving the yield of 22.9 percent (p <0.05), and having originality and frontier at home and abroad.

In the present invention, the nano-carbon sol has a nano-carbon solid content of 0.1 to 1.0 wt%, and may be, for example, 0.1 wt%, 0.2 wt%, 0.3 wt%, 0.4 wt%, 0.5 wt%, 0.6 wt%, 0.7 wt%, 0.8 wt%, 0.9 wt%, 1.0 wt%, or the like.

In the present invention, the particle size of the nano-carbon in the nanocarbon sol is 0.1 to 200nm, and may be, for example, 0.1nm, 0.5nm, 1nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 15nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 120nm, 140nm, 160nm, 180nm, 190nm, 200nm, or the like, and preferably 1 to 6 nm.

Preferably, the nano-carbon sol contains 95.5% or more of nano-carbon, for example, 95.5%, 96%, 97%, 98%, 99%, 99.9%, etc.

In the present invention, the pH of the nanocarbon sol is 2 to 4, and may be, for example, 2, 2.2, 2.4, 2.6, 2.8, 3, 3.2, 3.4, 3.6, 3.8, 4, or the like.

In the invention, the concentration of the nano carbon sol is 1-20L-ha ^-1 For example, it may be 1L · ha ^-1 、2 L·ha ^-1 、3L·ha ^-1 、4L·ha ^-1 、5L·ha ^-1 、6L·ha ^-1 、7L·ha ^-1 、8L·ha ^-1 、9L·ha ^-1 、10L·ha ^-1 、 11L·ha ^-1 、12L·ha ^-1 、13L·ha ^-1 、14L·ha ^-1 、15L·ha ^-1 、16L·ha ^-1 、17L·ha ^-1 、18L·ha ^-1 、 19L·ha ^-1 、20L·ha ^-1 Etc., preferably 18 to 20L ha ^-1 。

In the present invention, the content of GRA in the broccoli ball is increased to 20% or more of the total glucosinolate content, and may be, for example, 20%, 21%, 22%, 23%, 24%, 25%, or the like.

In a second aspect, the present invention provides a method for increasing the content of aliphatic glucosinolates in broccoli curd, wherein the method comprises the following steps:

and (3) performing field management after the nano carbon sol is dripped on the planted broccoli curd, and realizing the improvement of the content of the aliphatic glucosinolates in the broccoli curd after the curd is in a mature period.

In the present invention, the field management may be performed according to conventional field management in the art, specifically, for example: and (3) water and fertilizer management, ensuring that planting water is sufficient: adopting drip irrigation under the film, each 667m ² The water amount is preferably 35-40 t. Because the transpiration amount in the greenhouse is low in early spring, the soil moisture content is kept stable for a long time after the water is planted and planted. Controlling fertilizer by water: ensuring that the base fertilizer is sufficient, needing no additional fertilizer, observing the growth vigor of the broccoli plants about 20 days after field planting, when the leaves of the plants grow rapidly and the leaf color changes from dark to light, the plants can quickly root and need fertility, and using drip irrigation for watering to release the nutrients of the base fertilizer, wherein the water amount is preferably 18-20 t. After the flower balls appear, whether watering is carried out or not is determined according to soil moisture content and plant growth vigor, and if the relative water content of the soil can reach 60% of the water holding capacity, watering is not carried out. Because of the black plastic film of in canopy cover, can remove the weeding management from and promote low ground temperature, saved the labour simultaneously and reduced planting cost. The diseases in early spring are light, if the soil-borne diseases of cruciferae do not appear in the cold shed within 2 years, no bactericide is needed, and the use of pesticides is reduced.

In the invention, the planting specifically comprises: sowing and raising seedlings in spring, and planting in greenhouse after 30-35 days (such as 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, etc.).

In the present invention, the dropping of the nanocarbon sol is performed 20 to 25 days after the permanent planting, and may be, for example, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, and the like.

In the present invention, the mature period is 50 to 60 days after the permanent planting, and may be, for example, 50 days, 52 days, 54 days, 56 days, 58 days, 60 days, or the like.

Compared with the prior art, the invention has the following beneficial effects:

(1) the invention provides a novel scientific method for improving the GRA content in broccoli curd, which is convenient to control, and the design and the method have the characteristics of greenness, high efficiency, ecology and environmental protection through HPLC detection and RT-PCR verification;

(2) the method can directly induce the up-regulation expression of the upstream regulatory gene FMOgs-ox2 of the GRA from the molecular mechanism, thereby directly improving the generation amount of the GRA and improving the yield of 22.9 percent (p is less than 0.05);

(3) the method has originality and frontier property.

Drawings

FIG. 1 is an electron microscope scanning image of the nanocarbon sol.

FIG. 2 is a view of the drip irrigation system setup provided in example 1;

wherein T0 is 0.00L ha ^-1 The concentration of the nanocarbon solution T1 was 3.75L ha ^-1 The concentration of the nanocarbon solution T2 was 11.25L ha ^-1 The concentration of the nano-carbon solution, T3, was 18.75 concentration of the nano-carbon solution.

Fig. 3 is a greenhouse broccoli planting diagram.

FIG. 4 is a flower ball diagram of "Zhongqing No. 16".

FIG. 5 is an HPLC chromatogram of the glycoside in broccoli curd provided in example 2.

FIG. 6 is a histogram of the glucosinolate content in broccoli curd under nanocarbon solutions of different concentrations as provided in example 2.

FIG. 7 is a map of the glucosinolate-regulated genes provided in example 3.

FIG. 8 is a linear relationship chart of the nanocarbon solutions with different concentrations for regulating different genes provided in example 3.

Detailed Description

The technical solution of the present invention is further explained by the following embodiments. It should be understood by those skilled in the art that the examples are only for the understanding of the present invention and should not be construed as the specific limitations of the present invention.

Example 1

The embodiment provides a method for increasing the content of aliphatic glucosinolates in broccoli curd, which comprises the following steps:

(1) test materials and nanocarbon sols

The broccoli variety 'Zhongqing No. 16' is bred by the vegetable and flower research institute of Chinese academy of agricultural sciences, is a male sterile first-generation hybrid F1, has the characteristics of precocity and suitability for open field and protected field planting in spring, has round flower balls, green ball colors, uniform flower buds, high commodity and consistent uniformity, can be planted nationwide, is particularly suitable for north spring and autumn cultivation, and can be eaten and processed fresh.

The nano carbon sol has the solid content of nano carbon of 0.6 wt%, carbon ions with the particle size of less than 6nm accounting for 95.5%, and the material has the pH value of 2-3, and is suitable for agriculture and technology limited company of China and fertile farmlands (provided by Liujun).

(2) Planting and harvesting

In spring of 2020 plus 2021 year, seeding and seedling raising are carried out in the beginning of 3 months, field planting is carried out to a greenhouse (plastic greenhouse) in 9 days 4 months, and 0.00L & ha is adopted in 20 days after field planting ^-1 (T0)、3.75L·ha ^-1 (T1)、11.25L·ha ^-1 (T2)、 18.75L·ha ^-1 The nanocarbon sol of concentration (T3) was applied dropwise 1 time (see fig. 2 to 4), followed by conventional field management. And (3) after the mature period of the flower balls, harvesting the treated flower balls, taking 5 uniform flower balls for each treatment, repeating the steps for 3 times, performing vacuum freeze drying, and then using the treated fresh flower balls for later-stage extraction and detection of glucosinolates, and simultaneously using liquid nitrogen treatment on the treated fresh flower buds for RNA extraction and qRT-PCR analysis.

Example 2

This example provides a method for extracting glucosinolates and HPLC analysis:

(1) crushing freeze-dried samples of each treatment sample, accurately weighing 0.2-0.5 g of the freeze-dried samples, placing the weighed samples into a 15.0 mL centrifuge tube, adding TRO (benzyl thioglycoside), quickly adding 100% preheated methanol, carrying out water bath at 80 ℃ for 20min, swirling once every 5min, centrifuging at 3500r/min for 10min, taking supernate, adding the supernate into a 15 mL centrifuge tube, placing the centrifuge tube under ice for cooling, extracting precipitates of the supernate with 70% methanol for 2 times, and combining the supernate (sample solution) in the same operation.

Adding glass wool into a disposable syringe, plugging the disposable syringe, adding 2.0mL of DEAE sol solution, washing with 2.0mL of double distilled water, adding 2.0mL of sample solution, adding 0.02M NaAc solution when the sample solution does not drip any more, adding 75 mu L of sulfatase solution, sealing the opening overnight, washing with double distilled water for 3 times, each time 0.5mL, extruding the syringe by using an injection head, transferring the liquid into a test tube as far as possible, filtering with a 0.45 mu M filter membrane, transferring into a small glass bottle, and storing at-40 ℃ for later use, and analyzing by HPLC.

(2) High performance liquid chromatograph of Waters: waters model 510 high pressure pump (HPLC), Waters model 2487 ultraviolet diode array detector, Waters 717plus autosampler, EC2000 chromatography workstation. Acetic acid and sodium acetate are analytically pure and purchased from Beijing chemical reagent company, sulfatase, methanol and acetonitrile are chromatographically pure, barium acetate and ammonium acetate are analytically pure, and glucontopaeolin (TRO) (purity higher than 98%, HPLC grade) is purchased from Sigma company.

(3) Conditions for HPLC analysis: Nova-PakR C18 chromatographic column (3.9150mm, 50 μm), detection wavelength 229nm, flow rate 1.0mL/min, temperature 25 deg.C (normal temperature), sample size 20 μ L, elution program is shown in Table 1. Solution A: 1.0g tetramethylammonium chloride was dissolved in 2.0L double distilled water, liquid B: 1.0g tetramethylammonium chloride was dissolved in 1.6L double distilled water, and 0.4L acetonitrile was added.

TABLE 1

(4) Results and analysis

The results showed that 11 glucosinolate components were detected in broccoli curd (FIGS. 5-6), 7 of which were aliphatic glucosinolates: glucoiberin, progoitrin, sinigrin, glucorapanin, glucolysin, glucorapin and glucoerucin, 4 is indole glucosinolate: 4-hydroxygluconobarasicin, gluconobarasicin, 4-methoxygluconobarasicin and neoglucobrassicin, and no aromatic glucosinolate component was detected. The Glucobrasicin has the highest Glucobrasicin content, and the variation range of each treatment content is 5.07-5.61 mu M.g ^-1 Accounts for 30.7 percent (16.38 to 17.75 mu M.g) of the average content of the total glucosinolates ^-1 DW), and secondly, neoglucobrassicin, the content variation range of which is 3.87 to 4.94 mu M g ^-1 The content variation range of DW, Glucorapanin (GRA) is 3.57-4.39 mu M g ^-1 DW, accounted for 23.9% of the average total glucosinolate content.

Meanwhile, the nano carbon sol can obviously improve the GRA content by each treatment, and 18.75L ha ^-1 The nanocarbon sol of (2) maximally improved the yield value, compared with the control (T0) (3.57. mu.M.g) ^-1 DW), can obviously improve the GRA content in the ball flower by 22.9 percent (p)<0.05) to 4.39. mu.M.g ^-1 DW, the content of which reaches or exceeds the medical efficacy concentration of the hydrolysate SFN, has important scientific, medical and market values.

More specifically, the glucosinolate content is shown in table 2 below:

TABLE 2

Example 3

This example provides total RNA extraction and qRT-PCR analysis:

(1) the extraction of the total RNA from the broccoli buds was carried out by Trizol method, and both of the RNA extraction kit and the reverse transcription kit (MMLV reverse transcription kit) were purchased from TaKaRa, Japan. First strand cDNA synthesis was performed according to TaKaRa kit requirements to remove trace amounts of total RNA of DNA.

(2) The amplification primers are designed by using software PrimerPremier 5.0, the gene design primers are shown in Table 3, the internal reference gene is actin-12, and the primer sequence F (5 '-3'): GGCTCTATCTTGGCTTCTCTCAGT and (5 '-3'): CCAGATTCATCATACTCGGCTTT is added.

Reference is made to TaKaRa

The Green PCR MasterMix protocol was run and PCR amplification was performed on an ABI 7500 real-time quantitative PCR machine. The reaction system is 50 μ L: 25 μ L

Premix, 5. mu.L of cDNA template, 1. mu.L of each of the two-way primers,mu.L Rox, 50. mu.L of distilled water.

The PCR reaction program is: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 58 ℃ for 30s, 40 cycles, each set up 3 replicates per sample (n-3). After the reaction is finished, the melting curve and the change curve of the fluorescence value are analyzed by adopting 2 ^-ΔΔCt The method calculates the relative expression of the target gene.

TABLE 3

(3) Data analysis

And (3) carrying out correlation analysis on the expression quantity of each regulation and control of the glucosinolate and the treatment of the nanocarbon sol by using a statistical method, and specifically adopting Pearson correlation analysis. Experimental data and graphs were processed using SPSS 19.0 and GraphPad Prism 8.2.0 software and experimental results presented as mean ± standard error (mean ± SD, n ═ 3), one-way ANOVA for significance testing, and multiple comparisons were analyzed using Duncan's new double-pole method (p < 0.05).

(4) GRA regulation and control molecular mechanism analysis in broccoli curd

In order to reveal the relationship of the significant increase of GRA content in nanocarbon sol and broccoli curd, 6 key genes for regulating and controlling aliphatic glucosinolate metabolism are analyzed by qRT-PCR (figure 7), and the results show that 4 GRA upstream regulation genes MAM1, IPMI2, CYP79F1 and FMogs-ox2 all show significant up-regulation expression, and 2 downstream regulation genes AOP2 and TGG1 all show up-regulation expression, but AOP2 gene is proved to be an ineffective gene in broccoli, and the insertion of 2 bases in the outer display region of the gene leads to the loss of gene function (alkenylation), thereby being beneficial to GRA accumulation and avoiding competitive relationship.

Meanwhile, the relationship of the nanocarbon solutions with different concentrations for regulating different genes is made as shown in the following table 4:

TABLE 4

The linear relationship diagram of different genes regulated by the nanocarbon solutions with different concentrations is shown in table 4, and it can be known that 4 upstream regulated genes are obviously expressed, only FMOgs-ox2 can directly regulate and control the generation of GRA, and a good linear relationship is presented (figure 8), so that the nanocarbon sol and each key regulated gene have a dose induction effect, and powerful scientific basis and support are provided for improving the beneficial glucosinolate GRA content in broccoli bulbs and other different organs by using the technology.

The applicant states that the application of the nanocarbon sol of the invention in increasing the content of aliphatic glucosinolates in broccoli bulbs is illustrated by the above examples, but the invention is not limited to the above process steps, i.e., the invention is not meant to be implemented only by relying on the above process steps. It will be apparent to those skilled in the art that any modifications to the present invention, equivalent substitutions of selected materials and additions of auxiliary components, selection of specific forms, etc., are within the scope and disclosure of the present invention.

Claims

1. An application of a nanocarbon sol in increasing the content of aliphatic glucosinolates in broccoli curd.

2. The use of claim 1, wherein the aliphatic glucosinolate comprises GRA and/or GER, preferably GRA.

3. The use according to claim 1 or 2, wherein the nano-carbon sol has a nano-carbon solid content of 0.1-1.0 wt%.

4. Use according to any one of claims 1 to 3, characterized in that the nanosized carbon in the nanocarbon sol has a particle size of 0.1 to 200nm, preferably 1 to 6 nm;

preferably, the content of the nano-scale carbon in the nano-carbon sol accounts for more than 95.5%.

5. The use according to any one of claims 1 to 4, wherein the pH of the nanocarbon sol is 2 to 4.

6. The use according to any one of claims 1 to 5, wherein the nanocarbon sol has a concentration of 1 to 20L-ha ^-1 Preferably 18-20 Lha ^-1 。

7. The use of any one of claims 1 to 6, wherein the level of GRA in the broccoli curd is increased to more than 20% of the total glucosinolate content.

8. A method for increasing the content of aliphatic glucosinolates in broccoli bulbs is characterized by comprising the following steps:

and (3) performing field management after the nanocarbon sol as claimed in any one of claims 1 to 7 is dripped on the planted broccoli curd, and realizing the improvement of the content of aliphatic glucosinolates in the broccoli curd after the curd is in a mature period.

9. The method of claim 8, wherein the colonization is specifically: sowing and seedling raising are carried out in spring, and the seedlings are planted in a greenhouse 30-35 days later;

preferably, the dropping of the nano carbon sol is 20 to 25 days after the permanent planting.

10. The method of claim 8 or 9, wherein the maturation period is 50-60 days after colonization.