CN114848808A

CN114848808A - Immunopotentiator based on cationic lipid polypeptide and cytokine, preparation method and application thereof

Info

Publication number: CN114848808A
Application number: CN202210293520.0A
Authority: CN
Inventors: 聂宇; 赵扬扬; 金蓉蓉
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2022-03-24
Filing date: 2022-03-24
Publication date: 2022-08-05
Anticipated expiration: 2042-03-24
Also published as: CN114848808B

Abstract

The invention discloses an immunopotentiator based on cationic lipid polypeptide and cytokine, a preparation method and application thereof, belongs to the technical field of biological medicine, and solves the problems of poor expression solubility, low immunogenicity, short immune duration and complex preparation of EG95 recombinant protein. The immunopotentiator provided by the invention is formed by combining plasmid pEG95-IL2 and cationic lipid polypeptide RLS through electrostatic interaction. The preparation method comprises the following steps: after the EG95 nucleotide sequence and the IL-2 nucleotide sequence are connected through a 2A nucleotide sequence, the nucleotide sequence is connected into a eukaryotic expression vector and then is compounded with a cationic lipid polypeptide RLS solution, and the immunopotentiator RLS @ EG95-IL2 is obtained. The invention also discloses application of the immunopotentiator in preparation of nucleic acid vaccines. The immunopotentiator of the present invention is transmitted to all parts of the body through a lymphatic system to induce antigen specific immune reaction, and has the advantages of long in-vivo maintenance time, simple preparation, low cost and good safety.

Description

Immunopotentiator based on cationic lipid polypeptide and cytokine, preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an immunopotentiator based on cationic lipid polypeptide and cytokine, a preparation method and application thereof.

Background

Echinococcosis, also known as echinococcosis, is a serious zoonosis caused by the parasitism of echinococcus larvae, echinococcosis, in human or animal bodies, is distributed globally, and is a high-incidence area in China. The method is mainly popular in vast pasturing areas such as the north, the northwest, the southwest and the like, and the method tends to spread from the pasturing areas to agricultural areas in recent years. The prevention and control of the disease in China mainly uses vaccines to carry out immune prevention on susceptible intermediate hosts such as sheep, goats and the like, and in recent years, the immunity of yaks is gradually strengthened in part of areas. It has been demonstrated that the EG95 protein is localized in echinococcus granulosus oncosphere, the fertile cyst development layer, the metacercaria, and the adult soma, and may play an important role in the process of oncosphere drilling through the small intestine villus epithelium layer.

The 2A peptide (18-22 aa) is an oligopeptide with 2 proteins, and the motif contained in the polypeptide sequence is' -DxExNPGP-. It is considered that 2A peptide changes the activity of ribosome, promotes the hydrolysis of the ester chain between 2A peptide residue Gly and tRNA, when ribosome reaches the last two amino acids Gly-Pro at C end of 2A, the downstream gene cannot be translated due to the change of internal structure of ribosome amide center, at this time, the upstream primary peptide is hydrolyzed to release ribosome, and then the downstream gene is translated by ribosome, so that the equivalent expression of two genes can be realized.

IL-2 is a lymphokine secreted by helper T cells, can promote differentiation and maturation of T/B lymphocytes, NK cells and the like and activate biological activity of the T/B lymphocytes, the NK cells and the like, can promote synthesis and release of cytokines such as IFN-gamma, TNF-alpha and the like and antibody generation, and has the functions of starting, promoting and widely up-regulating an immune system.

The RLS is an environment-responsive cationic lipopolypeptide, and the document DOI:10.1039/c8tb02650e discloses that the RLS is formed by connecting a hydrophilic arginine head with a double-chain oleic acid tail through a redox sensitive bond, can form nanoparticles with the diameter of 100-200 nm in an aqueous phase through self-assembly, and has a positive charge of 20-30 mV. Can be fragmented under specific environmental conditions, such as lysosomes or endosomes.

The current studies on the expression of EG95 recombinant protein are mainly as follows: (1) prokaryotic expression of the recombinant EG95 comprises escherichia coli expression, agrobacterium tumefaciens expression, mycobacterium tuberculosis expression, recombinant bifidobacterium expression and the like; (2) eukaryotic expression of recombinant EG95 antigen includes yeast system expression, baculovirus-insect cell expression, viral live vector expression, and the like; (3) EG95 DNA vaccine, and the like. But still has the defects of poor solubility of the expressed protein, low immunogenicity, short immune duration, strong virulence, complex production operation and the like.

Disclosure of Invention

One of the purposes of the invention is to provide an immunopotentiator based on cationic lipopeptide and cytokine, which has the advantages of simple preparation, low cost, long in-vivo maintenance time, easy storage and transportation, and solves the problems of poor expression solubility, low immunogenicity, short immune duration and complex production operation of EG95 recombinant protein in the prior art.

The second object of the present invention is to provide a method for producing the immunopotentiator.

The invention also aims to provide the application of the immunopotentiator in the preparation of nucleic acid vaccines.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the immunopotentiator based on the cationic lipid polypeptide and the cytokine is formed by combining plasmid pEG95-IL2 and cationic lipid polypeptide RLS through electrostatic interaction.

In some embodiments of the invention, plasmid pEG95-IL2 is formed by connecting EG95 nucleotide sequence with IL-2 nucleotide sequence and then connecting the nucleotide sequence with eukaryotic expression vector; preferably, the EG95 nucleotide sequence is linked to the IL-2 nucleotide sequence by a 2A nucleotide sequence; more preferably, the linkage is EG95-2A-IL2 or IL2-2A-EG 95;

preferably, the 2A peptide nucleotide sequence is as set forth in SEQ ID: 10:

ggcagcggcgtgcagtttggcagcctgctgaaactggcgggcgatgtggaaaacccgggcccg；

preferably, the cationic lipid polypeptide RLS is selected from R ₁ LS、R ₂ LS、R ₃ Any one of LS.

In some embodiments of the invention, the nucleotide sequence of EG95 is linked to the nucleotide sequence of IL-2 via Hind III and EcoR I cleavage sites and then linked to a eukaryotic expression vector, preferably, the eukaryotic expression vector comprises any one of pcDNA3.1, pCMV-LacZ and pEGFP-C1.

In some embodiments of the invention, the species of IL-2 sequence is selected from any one of human, livestock, poultry, and murine species.

The preparation method of the immunopotentiator provided by the invention comprises the following steps:

s1, connecting an EG95 nucleotide sequence with an IL-2 nucleotide sequence through a 2A nucleotide sequence to obtain an EG95-IL2 nucleotide sequence;

s2, connecting the EG95-IL2 nucleotide sequence into a eukaryotic expression vector to obtain a plasmid pEG95-IL 2;

s3, dissolving the cationic lipid polypeptide RLS in a solvent to serve as an organic phase;

s4, dropwise adding the organic phase into deionized water under a stirring state to obtain a cationic lipid polypeptide solution;

s5, adding the plasmid pEG95-IL2 into the cationic lipid polypeptide solution, and combining the plasmid pEG95-IL2 with the cationic lipid polypeptide through electrostatic interaction to obtain the immunopotentiator RLS @ EG95-IL 2.

In some embodiments of the invention, the solvent in S3 comprises dimethyl sulfoxide, dimethyl sulfone, sulfolane, methanol;

the concentration of the cationic lipid polypeptide RLS in the organic phase of the S3 is 5-20 mg/mL, preferably 10 mg/mL.

In some embodiments of the invention, the volume ratio of organic phase to deionized is: 1:5-20, preferably 1: 10;

in the S5, the mass ratio of RLS to plasmid pEG95-IL2 in the cationic lipid polypeptide solution is 1: 1-80.

In some embodiments of the present invention, in the S5, the action time of the plasmid pEG95-IL2 and the cationic lipid polypeptide is 10-60 min.

The immunopotentiator provided by the invention is applied to the preparation of nucleic acid vaccines.

In some embodiments of the invention, the nucleic acid vaccine is an injection, preferably, an intravenous, intramuscular, or subcutaneous injection.

Compared with the prior art, the invention has the following beneficial effects:

the immunopotentiator is ingenious in concept and scientific in design, is simple to prepare, low in cost, long in-vivo maintenance time, and easy to store and transport.

The invention creatively connects an EG95 nucleotide sequence with a cytokine IL-2 nucleotide sequence through a 2A polypeptide nucleotide sequence to obtain an EG95-IL2 sequence, inserts the EG95-IL2 sequence into a eukaryotic expression vector and then compounds the eukaryotic expression vector with a cationic lipid polypeptide RLS solution to obtain an immunopotentiator RLS @ EG95-IL 2. The invention has simple preparation steps, safety and stability, high yield, can be efficiently taken by somatic cells (such as DC cells and the like), can promote the maturation of DC2.4/BMDCs cells, and prolongs the retention and expression time of genes in vivo. The immunopotentiator of the present invention is transmitted to various parts of the body through the lymphatic system, and can induce antigen-specific immune reactions.

The preparation method of the invention reduces the synthesis cost, improves the safety and the yield, and is easy to realize large-scale preparation and production.

Drawings

FIG. 1 is a schematic diagram of the construction of plasmid pEG95-IL 2.

FIG. 2 is a cationic lipopolypeptide R ₂ LS, plasmid pEG95-IL2, immunopotentiator R ₂ LS @ EG95-IL 2.

FIG. 3a is a cationic lipopolypeptide R ₂ Electron microscopy of LS nanoparticles.

FIG. 3b is an immunopotentiator R ₂ LS @ EG95-IL2 nanoparticle electron micrograph.

FIG. 4 is a cationic lipopolypeptide R ₂ Particle size potential diagram of LS nanoparticle and plasmid pEG95-IL2 with different action time.

FIG. 5 is a cationic lipopolypeptide R ₂ Different mass ratios of LS to plasmid pcDNA3.1-eGFP in vitro transfection results.

FIG. 6a is an immunopotentiator R ₂ Indirect immunization of LS @ EG95-IL2 against protein IL-2 and protein EG95 in DC2.4 cellsFluorescence mapping.

FIG. 6b is an immunopotentiator R ₂ LS @ EG95-IL2 indirect immunofluorescence profiles of protein IL-2 and protein EG95 in BMDCs cells.

FIG. 7 shows immunopotentiator R ₂ Serum IgG antibody profile of LS @ EG95-IL2 after mouse immunization.

FIG. 8 shows immunopotentiator R ₂ Spleen cell T/B lymphocyte proliferation profiles 2 weeks after immunization of LS @ EG95-IL2 mice.

FIG. 9 shows immunopotentiator R ₂ LS @ EG95-IL2 immune mouse splenocyte IFN-gamma ⁺ CD8 ⁺ And IL-4 ⁺ CD4 ⁺ Graph of percentage of cells.

FIG. 10 is a cationic lipopolypeptide R ₂ LS and far infrared plasmid pEGL3-E2 are compounded, and then the gene retention expression time in the immune mouse body is shown.

FIG. 11a is an immunopotentiator R ₂ LS @ EG95-IL2 on DC2.4 cells related molecules contribute to the mature expression profile.

FIG. 11b is immunopotentiator R ₂ LS @ EG95-IL2 on BMDCs cells related molecules contribute to the maturation expression profile.

Detailed Description

The present invention will be further described in more detail and in more detail with reference to the following examples, which are not intended to limit the scope of the present invention in any way. Also, equivalent substitutions, combinations, improvements or modifications of the invention may be made by those skilled in the art based on the description of the invention, but these are included in the scope of the invention.

EXAMPLE 12 Synthesis of peptide A Gene

This example provides the gene sequence for the 2A peptide

According to the amino acid sequence of the foot-and-mouth disease virus (F2A) shown in SEQ 1, the amino acid sequence of the equine rhinitis A virus (E2A) shown in SEQ 2, the amino acid sequence of the poinhuanha moth virus (T2A) shown in SEQ 3 and the amino acid sequence of the swine Tesqin virus (P2A) shown in SEQ 4, the nucleotide sequence (shown in SEQ 10) and the amino acid sequence (shown in SEQ 9) of the 2A peptide are optimally designed according to the "-DxExNPGP-" characteristic of the 2A polypeptide motif and the codon preference of a mouse cell.

EXAMPLE 2 construction of plasmid pEG95-IL2

This example provides a method for constructing an expression vector containing the EG95-IL2 sequence, comprising the steps of:

the nucleotide sequence of EG95 (shown as SEQ ID: 11), the nucleotide sequence of IL-2 (shown as SEQ ID: 12) and the nucleotide sequence of 2A are artificially synthesized, and the sequences are connected according to EG95-2A-IL 2. Meanwhile, in order to realize cloning, EcoR I (gattac) and Hind III (aagctt) enzyme cutting sites are respectively introduced into the 5 'end and the 3' end of the synthetic EG95-2A-IL2 sequence.

The sequence of EG95-2A-IL2 synthesized by EcoR I/Hind III double restriction enzyme is used, meanwhile, PCR DNA3.1 plasmid DNA carrier agarose gel electrophoresis is used for identifying the restriction enzyme result by EcoR I/Hind III double restriction enzyme, and EG95-2A-IL2 and PCR DNA3.1 linear plasmid DNA after restriction enzyme are recovered by gel.

The double-enzyme cutting system of the EG95-2A-IL2 sequence is as follows: EG95-2A-IL2 sequence 20. mu.L (0.5. mu.g/. mu.L), 5 × CutSmart Buffer 6.0. mu.L, EcoR I/Hind III each (5U/. mu.L) each 2.0. mu.L, in a volume totaling 30. mu.L; the enzyme digestion conditions are as follows: the enzyme was cleaved at 37 ℃ for 2 h.

The digested EG95-2A-IL2 sequence fragment and pcDNA3.1 linear plasmid DNA (molar ratio 10: 1) were ligated at 25 ℃ for 30min using the Bolete ligation kit. Adding the ligation product into a competent cell suspension of an escherichia coli (E.coli) Top10 strain for transformation, coating 200 mu L of transformed bacterial liquid on an LB solid culture medium containing Amp, culturing at 37 ℃ for 14h, and picking out a single colony for subculture. Extracting recombinant plasmids, carrying out double enzyme digestion (EcoR I/Hind III) verification, carrying out sequencing verification on the plasmids with correct enzyme digestion verification, and naming the plasmids with correct construction as pEG95-IL2, wherein the concentration is adjusted to be 0.1mg/mL for later use.

Example 3 cationic lipopolypeptide R ₂ Preparation of LS solution 1

This example provides cationic lipid polypeptides R ₂ Preparation of LS solution, comprising the following steps:

weighing cationic lipid polypeptide R ₂ LS 1.0mg dissolved in 100. mu.L DMSO at a concentration of10mg/mL as organic phase; 900 μ L of deionized water was taken as the aqueous phase.

Dropwise adding the organic phase into the water phase at 500R/min, and stirring at room temperature for 10min to obtain cationic lipid polypeptide R ₂ LS solution with a final concentration of 1 mg/mL.

Example 4 cationic lipopolypeptide R ₂ Preparation of LS solution 2

weighing cationic lipid polypeptide R ₂ LS 1.0mg is dissolved in 100. mu.L DMSO with a concentration of 10mg/mL to serve as an organic phase; 900 μ L of deionized water was taken as the aqueous phase.

Dropwise adding the organic phase into water phase at 500R/min, and stirring at room temperature for 60min to obtain cationic lipid polypeptide R ₂ LS solution with a final concentration of 1 mg/mL.

The results of the particle size potential are shown in FIG. 4, which shows that the cationic lipopolypeptide R ₂ The LS nanoparticles and the plasmid pEG95-IL2 have no obvious difference in particle size potential after being acted for 10min, 20min, 30min, 40min, 50min and 60min, and the cationic lipid polypeptide R is prompted ₂ The action time of the LS nanoparticles and the plasmid DNA can be selected to be 10-60 min.

Example 5 cationic lipopolypeptide R ₂ Determination of transfection Effect of LS

This example provides cationic lipopolypeptide R ₂ Transfection effect of LS, comprising the following steps:

10. mu.L of plasmid pcDNA3.1-eGFP from Biotechnology engineering (Shanghai) Ltd. was added dropwise to 100. mu.L of the cationic lipopeptide R prepared by the method of example 3 ₂ Mixing with LS solution, and adding R in cationic lipid polypeptide solution ₂ The mass ratio of LS to the plasmid pcDNA3.1-eGFP is 1:1, 1:10, 1:20, 1: 40. 1: 80. Binding by electrostatic interaction for 20min to obtain R ₂ LS@eGFP。

Culturing DC2.4 cells and L929 cells in complete culture medium containing 10% fetal calf serum, and culturing with 5 μ L of R with different mass ratio when the cells grow up to about 80% ₂ LS @ eGFP was transfected in vitro,lipo2000@ eGFP and PEI @ eGFP were also set as control groups, and 3 replicate wells were transfected per group. And (3) placing the 2 cells in an incubator for culturing for 48h, and then carrying out expression detection on the eGFP fluorescent protein by using a come inverted microscope.

The results are shown in FIG. 5, and the experimental results show that the cationic lipopolypeptide R ₂ LS can be mixed with plasmid DNA (1:1, 1:10, 1:20, 1: 40, 1:80) in different mass ratios, and R is mixed after mixing ₂ LS @ eGFP has no obvious difference in transfection effect on dendritic cells DC2.4 and fibroblasts L929. The cationic lipid polypeptide RLS nanoparticles and the plasmid DNA can be mixed according to the mass ratio of 1: 1-80.

Example 6 immunopotentiator R ₂ Preparation of LS @ EG95-IL2

This example provides immunopotentiators R ₂ Preparation of LS @ EG95-IL2, comprising the following steps:

mu.L of plasmid pEG95-IL2 prepared according to the method of example 2 was taken and 100. mu.L of cationic lipopolypeptide R prepared according to the method of example 3 was added dropwise ₂ Mixing with LS solution, and adding R in cationic lipid polypeptide solution ₂ The mass ratio of LS to plasmid pEG95-IL2 was 1: 25. combining by electrostatic interaction for 60min to obtain immunopotentiator R ₂ LS@EG95-IL2。

Example 7 cationic lipopolypeptide R ₂ LS, plasmid pEG95-IL2, immunopotentiator R ₂ Determination of particle size potential of LS @ EG95-IL2

This example provides cationic lipid polypeptides R ₂ LS, plasmid pEG95-IL2, immunopotentiator R ₂ LS @ EG95-IL2 particle size potential determination comprises the following steps:

the particle size and potential distribution of the nanoparticles are measured by using a Malvern nano laser particle size analyzer. The plasmid pEG95-IL2 in example 2 and the cationic lipid polypeptide R in example 3 were taken respectively ₂ LS solution, immunopotentiator R of example 4 ₂ LS @ EG95-IL2 solution 10. mu.L each, the above sample and 1mL deionized water are mixed uniformly, added into the sample cell for detection, and the detection temperature is set at 20 ℃. Additionally, Lipo2000 (commercialized by Invitrogen)

2000 transfection reagent), PEI (Invitrogen commercial PEI transfection kit) and their mixtures with plasmid pEG95-IL2 solutions, respectively, were used as controls and the detection method was as above. The results are shown in FIG. 2, which are cationic lipopeptides R ₂ LS, plasmid pEG95-IL2 and immunopotentiator R ₂ LS @ EG95-IL2 particle size and potential.

As shown in FIG. 2, the plasmid pEG95-IL2 has a particle size of 250 to 260nm and a charge of-10 to-5 mV;

cationic lipid polypeptide R ₂ LS particle size is 100-150 nm, and charge is 25-30 mV;

the particle size of the control group Lipo2000 is 90-100 nm, and the charge is 30-35 mV;

the particle size of the PEI of the control group is 200-250 nm, and the charge is 10-15 mV;

immunopotentiating agent R ₂ LS @ EG95-IL2 has the particle size of 200-250 nm and the charge of 15-20 mV;

control group Lipo2000@ EG95-IL2 (commercialized for use of Invitrogen)

2000 transfection reagent and the plasmid pEG95-IL2 solution in example 2 were mixed in a volume ratio of 1: 2) with the particle size of 350-400 nm and the charge of 15-20 mV;

the control group PEI @ EG95-IL2 (prepared by using an Invitrogen commercial PEI transfection kit and plasmid pEG95-IL2 solution according to the volume ratio of 1: 2) has the particle size of 600-650 nm and the charge of 5-10 mV.

The results show that: prepared cationic lipopolypeptide R ₂ The LS particle size is in nanometer level, and the charge is micro positive. And the particle size and the potential of the transfection reagent are not obviously different from those of commercial Lipo2000 and PEI transfection reagents. Prepared immunopotentiator R ₂ The particle size of LS @ EG95-IL2 is nano-scale, the charge is slightly positive, and the particle size and the potential of the compound Lipo2000@ EG95-IL2 and PEI @ EG95-IL2 which are the compounds of commercial Lipo2000 and PEI transfection reagent and plasmid pEG95-IL2 are not obviously different.

Example 8 cationic lipid polypeptide R ₂ LS, immunopotentiator R ₂ LS @ EG95-IL2 shapeTopographic feature detection

This example provides cationic lipid polypeptides R ₂ LS, immunopotentiator R ₂ The LS @ EG95-IL2 morphology feature detection method comprises the following steps:

separately, the cationic lipopeptide R prepared by the method of example 3 was taken ₂ LS solution, immunopotentiator R prepared by the method of example 4 ₂ LS @ EG95-IL2 solutions are 10 mu L of each solution, are dripped on a copper net, are kept stand for 5min, are dyed for 30s by 2% phosphotungstic acid, filter paper is used for sucking away redundant dye liquor on the copper net, the sample is dried at room temperature, is observed under the condition of 200KV, and is photographed and observed by a transmission electron microscope.

The results are shown in FIG. 3a and FIG. 3b, where 3a is a cationic lipopolypeptide R ₂ LS TEM image, FIG. 3b is immunopotentiator R ₂ Transmission electron microscopy of LS @ EG95-IL 2. The cationic lipopolypeptide R can be known from the figure ₂ LS, immunopotentiator R ₂ LS @ EG95-IL2 are all round particles, and cationic lipopolypeptide R ₂ LS particle size is 100-150 nm, nucleic acid vaccine R ₂ LS @ EG95-IL2 has a particle size of 200-250 nm.

Test example 1 results of transient expression of target proteins EG95 and IL-2

Transient transfected cells were analyzed for the observation of transient expression of the proteins of interest EG95, IL-2.

DC2.4 cells and L929 cells were cultured in complete medium containing 10% fetal bovine serum, and the cells were collected while they were in logarithmic growth phase. 250 μ L (10 ten thousand/ml) were inoculated into 35mm glass plates. 5 mu L R is used when the next day cell growth is about 80% ₂ LS @ EG95-IL2 vaccine was transfected in vitro, while Lipo2000@ EG95-IL2 was provided as a control. Each group was transfected with 3 replicate wells and a blank was set. After the 2 cells are placed in an incubator and cultured for 48h, the instant expression fluorescence detection of EG95/IL-2 protein is carried out by using an immunofluorescence staining kit-anti-rabbit Cy3 of Beyotime according to the instruction.

As shown in FIGS. 4a and 4b, the experimental results show that the constructed gene expression vector p EG95-IL2 can express the target proteins EG95 and IL-2 not only in immune cells (such as dendritic cells DC2.4), but also in non-immune cells (such as fibroblasts L929) and EG95 and IL-2. And target proteins EG95 and IL-2 are highly expressed.

Test example 2 results of in vivo immunization test on mice-1

To observe immunopotentiator R ₂ LS @ EG95-IL2 immune effect, the immune mice were analyzed.

R in the present example ₂ LS @ EG95-IL2 was prepared according to the method of example 6;

plasmid pEG95-IL2 was prepared as in example 2;

lipo2000@ EG95-IL2 was prepared as in example 7.

In vivo immunization experiment of mice: day 0 immunization, BABL/c mice retreat hip intramuscular injection 100 μ L R ₂ LS @ EG95-IL2 immunopotentiator, and Lipo2000@ EG95-IL2, plasmid pEG95-IL2, saline (NS) group were set as controls. The results of examining the amount of IgG antibodies specific to EG95 in the serum on the day of tail-cutoff blood collection at 7d, 14d, 21d, 28d, and 35d are shown in FIG. 5.

As is clear from the test results, the immunopotentiator R of the present invention ₂ LS @ EG95-IL2 induced a significant increase in antibody levels compared to the NS control group. Compared with a control group of Lipo2000@ EG95-IL2 and plasmid pEG95-IL2, the control group of the plasmid pE is also obviously improved; r showing the invention ₂ LS @ EG95-IL2 has a remarkable effect of enhancing immunity.

Test example 3 results of in vivo immunization test on mouse-2

plasmid pEG95-IL2 was prepared as in example 2;

lipo2000@ EG95-IL2 was prepared as in example 7.

In vivo immunization experiment of mice: day 0 immunization, intramuscular injection of 100. mu. L R into the hind legs of BABL/c mice ₂ LS @ EG95-IL2 immunopotentiator, and Lipo2000@ EG95-IL2, plasmid pEG95-IL2, saline (NS) group were set as controls. 14d after immunization mice spleens were removed by sterile handling in a clean bench, erythrocytes were lysed, lymphocytes were collected and counted (1X 10) ⁷ Per mL). The samples were distributed in 96-well plates and inoculated with 9 wells, 100. mu.L/well, and ConA 5. mu.L/well (1. mu.g/. mu.L) or LPS 10. mu.L/well (1. mu.g/. mu.L) from BioLegend, 37 ℃ and 5% CO, respectively ₂ Culturing for 60 hr, adding 10 μ L of CCK-8 from DOJINDO, culturing for 90min, and measuring OD with microplate reader _450nm And (4) calculating the in vitro proliferation capacity of the T/B lymphocytes. The formula is as follows:

SI (stimulation index) — (OD) _450nm LPS or ConA-OD _450nm Blank): (RPMI 1640 control-OD _450nm Blank)

The results are shown in FIG. 6, where R is ₂ The proliferation capacity of T/B lymphocytes in the LS @ EG95-IL2 group is obviously higher than that of the control group Lipo2000@ EG95-IL2 and plasmid pEG95-IL2, and the value of p is less than 0.005, so that the statistical significance is realized, and the R of the invention ₂ LS @ EG95-IL2 has a remarkable effect of enhancing immunity.

Test example 4 results of in vivo immunization test on mouse-3

plasmid pEG95-IL2 was prepared as in example 2;

lipo2000@ EG95-IL2 was prepared as in example 7.

In vivo immunization experiment of mice: day 0 immunization, intramuscular injection of 100. mu. L R into the hind legs of BABL/c mice ₂ LS @ EG95-IL2 immunopotentiator, and Lipo2000@ EG95-IL2, plasmid pEG95-IL2, saline (NS) group were set as controls. And (3) killing the mice at 14d after immunization, taking spleens, cracking red blood cells to obtain splenic lymphocytes, inoculating the lymphocytes into a 12-well plate, adding EG95 polypeptide stimulators (10 mu L/well) or PMA (blank control group 10 mu L/well) respectively, then supplementing 500 mL/well 1640 culture medium, incubating in an incubator at 37 ℃ for 1h, adding Brefeldin A (10 mu L/well) of BioLegend, and continuing to incubate for 4-6 h. Lymphocytes were harvested and incubated with CD8a-FITC antibody from BioLegend or anti-mouse CD4-FITC antibody, respectively, for 30min at 4 ℃. And then washing, and incubating and fixing for 20min at room temperature in a dark place. The lymphocytes were subjected to membrane rupture using a Permeabilization Wash Buffer from BioLegent, and IFN-. gamma. -PE or IL-4-PE antibodies from BioLegent were added in the dark at room temperature for 20 min. After being washed and resuspended by PBS, the PBS is loaded on a machine for detectionAnd (3) analysis: CD4 ⁺ IL-4 ⁺ Double yang, CD8 ⁺ IFN-γ ⁺ Double yang.

The results are shown in FIGS. 7a and 7 b. Wherein FIG. 7a is

CD8 ⁺ IFN-γ ⁺ Double positive results: r ₂ LS @ EG95-IL2 (2.54%), control Lipo2000@ EG95-IL2 (1.00%), and control pEG95-IL2 (1.34%).

FIG. 7b shows CD4 ⁺ IL-4 ⁺ Double positive results: r ₂ LS @ EG95-IL2 (2.88%), control Lipo2000@ EG95-IL2 (1.60%), and control pEG95-IL2 (1.62%).

The test results show that R of the invention ₂ LS @ EG95-IL2 has a remarkable effect of enhancing immunity.

Test example 5 results of in vivo immunization test on mouse-4

In this example, plasmid pGL3-E2 was prepared according to the method described in DOI 10.1002/1878-0261.12162.

R in the present example ₂ LS @ pGL3-E2 is R in reference example 5 ₂ LS @ EG95-IL 2: 10. mu.L of plasmid pGL3-E2 was taken and 100. mu.L of cationic lipopolypeptide R prepared by the method of example 3 was added dropwise ₂ Mixing with LS solution, and adding R in cationic lipid polypeptide solution ₂ The mass ratio of LS to plasmid pGL3-E2 was 1: 25. Bonding by electrostatic interaction for 60min to obtain R ₂ LS@pGL3-E2。

The Lipo2000@ pGL3-E2 in this example was prepared according to the preparation method of Lipo2000@ EG95-IL2 in reference example 5: commercialization using Invitrogen

2000 transfection reagent and plasmid pGL3-E2 solution according to the volume ratio of 1: 2.

In vivo immunization experiment of mice: day 0 immunization, intramuscular injection of 100. mu. L R into hind legs of BABL/c nude mice ₂ LS @ pGL3-E2, along with Lipo2000@ pGL3-E2, pGL3-E2, saline (NS) groups as controls. Living was used 24h, 48h, 5d, 7d, 14d, 21d, 28d, 35d after immunization

Software4.4 for

The Lumina XRMS Series III instrument carries out far infrared protein expression tracing observation on the nude mice, and all parameters are photographed and adjusted to be consistent.

The results are shown in FIG. 8, R ₂ The peak period of far infrared protein expression of the LS @ pGL3-E2 group is 14d after immunization; the peak period of the far infrared protein expression of the Lipo2000@ pGL3-E2 group is 7d after immunization; the peak period of far-infrared protein expression of pGL3-E2 was 7 days after immunization. And R is ₂ The LS @ pGL3-E2 group still had a high far-infrared protein expression level at 35d, while the peak far-infrared protein expression levels of the control groups Lipo2000@ pGL3-E2 and pGL3-E2 were not observed at all under the same parameters. To illustrate the R ₂ The LS cationic lipid polypeptide can not only prolong the retention expression time of the gene in vivo but also increase the overall expression level of the target protein.

Test example 6R ₂ Maturation-promoting assay of LS @ EG95-IL2 on BMDCs and DC2.4 cells

the PEI @ EG95-IL2 described in this example was prepared by the method described in reference example 7;

the Lipo2000@ EG95-IL2 in this example was prepared according to the method of reference example 7.

Maturation-promoting assays for BMDCs, DC2.4 cells:

1) obtaining of BMDCs cells: selecting a C57BL/6 male mouse (6-10 weeks old) for cervical dislocation for killing, taking out bilateral femurs and shines under an aseptic condition, and flushing bone marrow with an RPMI 1640 culture medium to obtain a single-cell bone marrow suspension. The red blood cells were lysed and counted at 1.0X 10 ⁶ Spread in 24-well plates, and recombinant GM-CSF (20ng/mL) and IL-4(10ng/mL) were added at 37 ℃ with 5% CO ₂ Culturing in incubator by shaking gently on day 2 and day 4Plates were maintained, then fresh medium was replaced at 75% (0.75 mL/well) volume and the cytokines GM-CSF (20ng/mL) and IL-4(10ng/mL) were replenished. Loosely adherent cells were collected on day 6.

2) Induced differentiation of BMDCs, DC2.4 cells: the BMDCs cells and DC2.4 cells obtained above were inoculated into 24-well plates, and 1 ml/well of culture medium was added thereto, separately from R ₂ LS @ EG95-IL2(100ng/mL), Lipo2000@ EG95-IL2(100ng/mL), PEI @ EG95-IL2(100ng/mL), positive control lipopolysaccharide LPS (100ng/mL), negative control medium RPMI 1640 at 37 ℃ with 5% CO ₂ Incubate for 4h in the incubator, change the medium and add 2 ml/well of culture medium. After 48h incubation, cells were harvested and washed twice in PBS buffer and applied to the Trustain Face from BioLegend ^TM (anti-mouse CD16/32) Fc fragment antibody blocking was performed as described.

3) Surface dyeing: antibodies from BioLegend PerCP/cyanine5.5 anti-mouse I-A/I-E, APC anti-mouse CD11c, FITC anti-mouse CD80, PE/Cyanine7 anti-mouse CD40, PE anti-mouse CD86 were added, incubated in the dark on ice for 20min, and detected after washing.

The results are shown in FIGS. 9a and 9 b. FIG. 9a is R ₂ LS @ EG95-IL2, Lipo2000@ EG95-IL2, PEI @ EG95-IL2 caused maturation results on DC2.4 cells, LPS (lipopolysaccharide) as a positive control, RPMI 1640 as a negative control;

FIG. 9b is R ₂ LS @ EG95-IL2, Lipo2000@ EG95-IL2, PEI @ EG95-IL2 caused maturation results on BMDCs cells, LPS as a positive control, and RPMI 1640 as a negative control.

R can be obtained from the percentage of the expression of the co-stimulatory molecules CD40, CD80, CD86, MHC-II ₂ LS @ EG95-IL2 was significantly more aggressive in ripening than the other experimental groups. To illustrate the R ₂ LS @ EG95-IL2 has obvious effect of promoting ripening on DC2.4 and BMDCs.

In conclusion, the RLS @ EG95-IL2 disclosed by the invention is simple in preparation steps, safe, stable and high in yield, can be efficiently taken by somatic cells (such as DC cells and the like), can promote the maturation of DC2.4/BMDCs cells, and can prolong the retention and expression time of genes in vivo; the antigen-specific immune response can be induced by the lymphatic system to all parts of the body. Book (I)The cationic lipid polypeptides RLS described in the examples of the invention are all R ₂ LS (laser light). As known to those skilled in the art, RLS is formed by connecting a hydrophilic arginine head with a double-chain oleic acid tail through a redox sensitive bond, can form nanoparticles with the diameter of 100-200 nm in a water phase through self-assembly, and has a positive charge of 20-30 mV. R ₂ LS and other RLS, e.g. R ₁ LS、R ₃ LS mechanism is the same, therefore, when RLS in the present invention is R ₁ LS、R ₃ LS, can also be realized with R ₂ LS with the same technical effect.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

SEQUENCE LISTING

<110> Sichuan university

<120> immunopotentiator based on cationic lipid polypeptide and cytokine, preparation method and application thereof

<130> 20220316

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> PRT

<213> Artificial Synthesis

<400> 1

Gly Ser Gly Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala

1 5 10 15

Gly Asp Val Glu Ser Asn Pro Gly Pro

20 25

<210> 2

<211> 22

<212> PRT

<213> Artificial Synthesis

<400> 2

Gly Ser Gly Gln Cys Thr Asn Tyr Ala Leu Leu Lys Leu Ala Gly Asp

1 5 10 15

Val Glu Ala Thr Leu Asp

20

<210> 3

<211> 20

<212> PRT

<213> Artificial Synthesis

<400> 3

Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu

1 5 10 15

Glu Asn Pro Gly

20

<210> 4

<211> 22

<212> PRT

<213> Artificial Synthesis

<400> 4

Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val

1 5 10 15

Glu Glu Asn Pro Gly Pro

20

<210> 5

<211> 75

<212> DNA

<213> Artificial Synthesis

<400> 5

ggaagcggag tgaaacagac tttgaatttt gaccttctca agttggcggg agacgtggag 60

tccaaccctg gacct 75

<210> 6

<211> 68

<212> DNA

<213> Artificial Synthesis

<400> 6

ggaagcggac agtgtactaa ttatgctctc ttgaaattgg ctggagatgt tgaagcaacc 60

ctggacct 68

<210> 7

<211> 60

<212> DNA

<213> Artificial Synthesis

<400> 7

ggaagcggag agggcagagg aagtctgcta acatgcggtg acgtcgagga gaatcctgga 60

<210> 8

<211> 66

<212> DNA

<213> Artificial Synthesis

<400> 8

ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60

ggacct 66

<210> 9

<211> 21

<212> PRT

<213> Artificial Synthesis

<400> 9

Gly Ser Gly Val Gln Phe Gly Ser Leu Leu Lys Leu Ala Gly Asp Val

1 5 10 15

Glu Asn Pro Gly Pro

20

<210> 10

<211> 63

<212> DNA

<213> Artificial Synthesis

<400> 10

ggcagcggcg tgcagtttgg cagcctgctg aaactggcgg gcgatgtgga aaacccgggc 60

ccg 63

<210> 11

<211> 715

<212> DNA

<213> Artificial Synthesis

<400> 11

tccagttatg tctcattttg tttgcgactt cagttttggc tcaggaatac aaaggaatgg 60

gcgtagagac aaggacaaca gagactccgc tccgtaaaca cttcaatttg actcctgtgg 120

gttctcaggg cattcgctta agttgggaag tccaacactt gtctgacctc aaaggaacag 180

atatttctct aaaagcggtg aatccttctg acccgttagt ctacaaaaga caaactgcaa 240

aattctcaga tggacaactc actatcggcg aactgaagcc ctccacatta tacaaaatga 300

ctgtggaagc agtgaaagcg aaaaagacca ttttgggatt caccgtagac attgagacac 360

cgcgcgctgg caagaaggaa agcactgtaa tgactagtgg atccgcctta acatccgcaa 420

tcgctggttt tgtattcagc tgcatagtgg ttgtccttac ttgaactctc atgtaagtca 480

atgcaaatta tccactgctt ctatactgag tagcacgacc cataacttgc atttttcaaa 540

taactcttct tccacatcag gcttccttgg tgccgaagat gcacaaatca ccatttattt 600

tcgctttatt aacatttgta tgacctctca ttgtggatta ctcccgaatg acaaatacgg 660

gactttgtca tatttgcttc attgttatca cccttaattc caattcactg actcg 715

<210> 12

<211> 825

<212> DNA

<213> Artificial Synthesis

<400> 12

tatcaccctt gctaatcact cctcacagtg acctcaagtc ctgcaggcat gtacagcatg 60

cagctcgcat cctgtgtcac attgacactt gtgctccttg tcaacagcgc acccacttca 120

agctccactt caagctctac agcggaagca cagcagcagc agcagcagca gcagcagcag 180

cagcagcacc tggagcagct gttgatggac ctacaggagc tcctgagcag gatggagaat 240

tacaggaacc tgaaactccc caggatgctc accttcaaat tttacttgcc caagcaggcc 300

acagaattga aagatcttca gtgcctagaa gatgaacttg gacctctgcg gcatgttctg 360

gatttgactc aaagcaaaag ctttcaattg gaagatgctg agaatttcat cagcaatatc 420

agagtaactg ttgtaaaact aaagggctct gacaacacat ttgagtgcca attcgatgat 480

gagtcagcaa ctgtggtgga ctttctgagg agatggatag ccttctgtca aagcatcatc 540

tcaacaagcc ctcaataact atgtacctcc tgcttacaac acataaggct ctctatttat 600

ttaaatattt aactttaatt tatttttgga tgtattgttt actatctttt gtaactacta 660

gtcttcagat gataaatatg gatctttaaa gattcttttt gtaagcccca agggctcaaa 720

aatgttttaa actatttatc tgaaattatt tattatattg aattgttaaa tatcatgtgt 780

aggtagactc attaataaaa gtatttagat gattcaaata taaaa 825

Claims

1. An immunopotentiator based on a cationic lipid polypeptide and a cytokine, wherein the immunopotentiator is formed by combining plasmid pEG95-IL2 and cationic lipid polypeptide RLS through electrostatic interaction.

2. The immunopotentiator according to claim 1, wherein the plasmid pEG95-IL2 is obtained by linking EG95 nucleotide sequence with IL-2 nucleotide sequence and then connecting the nucleotide sequence with eukaryotic expression vector;

preferably, the EG95 nucleotide sequence is linked to the IL-2 nucleotide sequence by a 2A nucleotide sequence; more preferably, the linkage is EG95-2A-IL2 or IL2-2A-EG 95;

preferably, the 2A peptide nucleotide sequence is shown in SEQ.ID: 10;

3. The immunopotentiator according to claim 2, wherein the nucleotide sequence of EG95 is linked to the nucleotide sequence of IL-2 via Hind III and EcoR I cleavage sites and then linked to a eukaryotic expression vector, preferably, the eukaryotic expression vector comprises any one of pcDNA3.1, pCMV-LacZ and pEGFP-C1.

4. The immunopotentiator according to claim 2, wherein the species of IL-2 sequence is any one species selected from the group consisting of human, livestock, poultry, and mouse.

5. The method for producing an immunopotentiator according to any one of claims 1 to 4, which comprises the steps of:

s5, adding the plasmid pEG95-IL2 into the cationic lipid polypeptide solution, and combining the plasmid pEG95-IL2 with the cationic lipid polypeptide through electrostatic interaction to obtain the immunopotentiator.

6. The method according to claim 5, wherein the solvent in S3 comprises dimethyl sulfoxide, dimethyl sulfone, sulfolane, methanol;

7. The preparation method according to claim 6, wherein in S4, the volume ratio of the organic phase to the deionized water is: 1:5-20, preferably 1: 10;

in the S5, the mass ratio of RLS to plasmid pEG95-IL2 in the cationic lipid polypeptide solution is 1:1 to 80.

8. The method according to claim 5, wherein the action time of plasmid pEG95-IL2 and the cationic lipid polypeptide in S5 is 10-60 min.

9. Use of an immunopotentiator according to any one of claims 1-4 for the preparation of a nucleic acid vaccine.

10. Use according to claim 9, wherein the nucleic acid vaccine is an injection, preferably an intravenous, intramuscular or subcutaneous injection.