CN114807228A

CN114807228A - Expression system of T7RNA polymerase and T7 promoter and method for expressing protein in eukaryote by using same

Info

Publication number: CN114807228A
Application number: CN202210513779.1A
Authority: CN
Inventors: 王文雅; 李君�; 李强
Original assignee: Beijing University of Chemical Technology
Current assignee: Beijing University of Chemical Technology
Priority date: 2020-04-27
Filing date: 2020-04-27
Publication date: 2022-07-29
Anticipated expiration: 2040-04-27
Also published as: CN111534533B; CN114807228B; CN111534533A

Abstract

The present application relates to an expression system of T7RNA polymerase and T7 promoter and a method for expressing protein in eukaryote using the same. The expression system described herein, which comprises Vpu protein and/or Rev-RRE regulatory elements in HIV-1 retrovirus, allows mRNA transcribed by T7 without 5' cap structure to be transported across nuclear membrane to cytoplasm in eukaryotic cells, thereby achieving continuous, stable and efficient expression of foreign proteins.

Description

Expression system of T7RNA polymerase and T7 promoter and method for expressing protein in eukaryote by using same

The present application is a divisional application of the original application with application number 202010343730.7, filed on year 2020, 4/27, entitled "expression system of T7RNA polymerase and T7 promoter and method for expressing protein in eukaryote using the same".

Technical Field

The present application relates to an HIV-1Vpu and Rev-RRE element based T7RNA polymerase (T7 RNAP) and T7 promoter expression system which can be used for sustained, stable and efficient protein expression in eukaryotic cells.

Background

The T7 expression system has been widely used for expression of proteins, and among them, the application in prokaryotes is most common (see, patent document 1). The most typical representative is the pET series plasmid developed by Novagen, which has been widely used for efficient protein expression in E.coli.

In the case of eukaryotes, researchers have conducted studies on the T7 expression system using yeast strains, but have not obtained positive results, and only expression of T7RNAP was detected, and synthesis of target protein under the control of the T7 promoter was not detected (see, non-patent documents 1 and 2).

Researchers have also constructed T7 expression systems in mammalian cells using viruses (e.g., vaccinia virus) as vectors, which are found in the cytoplasm and lost as cells divide; at the same time, the large number of replicated vaccinia viruses will eventually kill the host cells as well. Therefore, the T7 expression system can achieve only transient expression of the protein in the cytoplasm, and it is difficult to achieve sustained and stable expression of the target protein (see non-patent documents 1 and 3).

In order to achieve the continuous and stable expression of proteins in eukaryotic cells, the key point is that eukaryotic mRNA which is processed after transcription in the nucleus is successfully transported to cytoplasm through the nuclear membrane, and then the translation of mRNA into proteins in cytoplasm can be realized. However, since mRNA transcribed from T7RNAP in the nucleus has no 5 'cap structure and 3' poly (A) tail, and cannot be transported out of the nucleus, it affects the translation synthesis of proteins in the cytoplasm, and thus proteins cannot be expressed efficiently.

For the mRNA lacking the 5' cap structure transcribed by T7RNAP, it was found that translation of a protein from a eukaryotic mRNA lacking the 5' cap structure can be facilitated by utilizing an IRES structure in the cytoplasm (see, non-patent document 4), but this study does not address the problem of transport of the mRNA lacking the 5' cap structure transcribed by T7RNAP in the nucleus to the cytoplasm. Also, it has been shown that the addition of a eukaryotic terminator sequence to a transcription unit initiated by the T7 promoter can help the T7RNAP transcript to produce a 3 'poly (A) tail (see, non-patent document 5), but this study does not solve the problem of how to transport mRNA lacking a 5' cap structure from the nucleus to the cytoplasm.

Prior art documents:

patent document 1: CN102643851A

Non-patent document 1: (iii) ELROY-STEIN O, FUERST T R, MOSS B. Cap-induced transformation of mRNA conjugated by alphalobar microorganisms 5' sequence improvements of the performance of the vaccinia virus/bacterial T7hybrid expression system [ J ]. Proceedings of the National Academy of Sciences,1989,86(16):6126-30.

Non-patent document 2: benton B M, Eng W-K, Dunn J, et al, Signal-mediated import of bacterial T7 RNA' polymerase in the Saccharomyces cerevisiae nucleus and specific transcription of target genes [ J ]. Molecular and Cellular Biology,1990,10(1):353-60.

Non-patent document 3: wang W, Li Y, Wang Y, et al bacteriophage T7 transformation system: an engineering tool in synthetic biology [ J ] Biotechnology Advances,2018.

Non-patent document 4: Elroy-Stein O, Moss B.cytoplasmatic expression system based on constitutive synthesis of bacterial T7RNA polymerase in mammalian cells [ J ]. Proceedings of the National Academy of Sciences,1990,87(17):6743-7.

Non-patent document 5: ken Down, Michael Rosbash, T7RNA polymerase-directed transcription area processing in yeast and link 3' end formation to mRNA nuclear export [ J ] RNA,2002,8: 686. 697.

Disclosure of Invention

Problems to be solved by the invention

The invention mainly solves the problems that mRNA without a 5' cap structure transcribed by a T7 expression system in eukaryote is transported to cytoplasm across nuclear membrane to continuously, stably and efficiently express recombinant protein.

Means for solving the problems

The present inventors found that a gene encoding a Rev protein is present in the genome of human immunodeficiency virus (HIV-1) retrovirus, and that RNA that specifically binds to the Rev protein is called Rev-responsive element (RRE). Rev protein can bind RRE, inhibit splicing by interacting with splicing factors, spliceosomes, and interact with nuclear porin, transporting incompletely spliced mRNA carrying RRE from the nucleus to the cytoplasm.

The HIV-1 retrovirus also encodes a small regulatory protein in which the Vpu protein is a membrane protein formed by an oligomerization of 81 amino acids, folded into two distinct domains, an N-terminal transmembrane hydrophobic domain and a C-terminal cytoplasmic domain. With this structure, Vpu protein penetrates cell membranes in an oligomeric form to form channels, and can improve permeability of cell membranes.

The Nuclear Localization Signal (NLS) is usually a short amino acid sequence that can assist the target protein to enter the nucleus, and the introduction of the Nuclear Localization signal can make the protein enter the nucleus. When NLS is added upstream of the membrane protein, the membrane protein will localize on the nuclear membrane of the nucleus.

The present inventors have made the above-mentioned facts, and have proposed two design schemes for solving the problem of trans-nuclear membrane transport of mRNA transcribed by the T7 expression system to the cytoplasm:

1) introducing Rev-RRE regulatory elements in HIV-1 retrovirus into T7 expression system, wherein Rev protein can specifically bind RRE sequence, and mRNA lacking 5' cap structure T7RNAP transcription with RRE sequence is transported from nucleus to cytoplasm;

2) the vpu gene with nuclear localization sequence is introduced into T7 expression system, so that the protein is localized on nuclear membrane of nucleus, thereby changing permeability of nuclear membrane, and the transcription product of T7RNAP can enter cytoplasm through osmotic diffusion.

The above design scheme is not particularly limited with respect to the eukaryote to which it is applied, as long as mRNA lacking the 5' cap structure, which can achieve transcription of T7RNAP, is transported across the nuclear membrane to the cytoplasm. Preferably, it is applicable to yeast, mammals, insects. More preferably, it is applied to Saccharomyces cerevisiae (Saccharomyces cerevisiae), Pichia pastoris (Pichia pastoris), Kluyveromyces marxianus), hamster, human kidney cell, human Hela cell, CHO, COS, BHK, SP2/0, NIH3T3, silkworm, Drosophila. Most preferably, it is applied to Saccharomyces cerevisiae (Saccharomyces cerevisiae) and human Hela cells.

Preferably, the following two expression systems are used for different eukaryotes:

(one) for yeast, a T7 expression system based on Vpu of HIV-1 was constructed.

(II) for mammals, a T7 expression system based on the Vpu or Rev-RRE element of HIV-1 was constructed.

In order to verify whether the T7 expression system expresses a target protein in eukaryotes, the hygromycin resistance protein (Hph), Nanoluc luciferase (Nluc) or Enhanced Green Fluorescent Protein (EGFP) is used and is constructed in a transcription unit started by a T7 promoter.

The test proves that the reasonability of the two design schemes is proved, and the expected effect is realized by the two T7 expression systems. The result shows that the Vpu protein plays a role in changing nuclear membrane permeability, helps mRNA transcribed by T7RNAP to go out of nucleus and completes the translation process; the RRE-carrying mRNA also binds to Rev protein, helping the mRNA transcribed by T7RNAP to enucleate, completing the translation process.

Specifically, the technical scheme of the invention comprises the following steps:

[1] an expression system comprising a T7RNA polymerase and a T7 promoter, wherein said expression system comprises a Vpu protein and/or a Rev-RRE regulatory element of an HIV-1 retrovirus.

[2] The expression system according to [1], wherein the T7RNA polymerase consists of SEQ ID No: 1, and coding the sequence represented by the symbol 1.

[3] The expression system according to [1] or [2], wherein the gene of T7RNA polymerase further comprises a nuclear localization sequence.

[4] The expression system according to [3], wherein the nuclear localization sequence is SV40T-Antigen nuclear localization sequence, Nucleoplasmin nuclear localization sequence, EGL-13 nuclear localization sequence, c-Myc nuclear localization sequence or TUS-protein nuclear localization sequence.

[5] A method for expressing a protein in a eukaryote using an expression system of T7RNA polymerase and T7 promoter, characterized in that said expression system comprises the Rev-RRE regulatory element in HIV-1 retrovirus.

[6] The method according to [5], characterized in that the method comprises:

1) constructing a vector expressing T7RNA polymerase and Rev, wherein the T7RNA polymerase consists of SEQ ID No: 1, coding the sequence represented by the formula;

2) transferring a DNA fragment containing a T7 promoter, a T7 terminator, an IRES, an RRE and a target protein gene to the vector to construct a vector capable of expressing T7RNA polymerase, Rev and a target protein;

3) transfecting by using the vector constructed in the step 2) to finish slow virus packaging; and

4) infecting target eukaryotic cells with the lentivirus, obtaining a target transformant through resistance screening, and determining the expression system through verifying target protein.

[7] The method according to [5] or [6], wherein the gene of T7RNA polymerase further contains a nuclear localization sequence.

[8] The method according to [6] or [7], wherein in the step 1), a mammalian promoter is selected as a promoter for expressing T7RNA polymerase and Rev, and a eukaryotic polycistronic structure containing 2A or IRES is constructed to obtain a vector for simultaneously expressing T7RNA polymerase and Rev.

[9] The method according to any one of [6] to [8], wherein the protein of interest expressed by the expression system is verified using a hygromycin-resistant protein, Nanoluc luciferase or enhanced green fluorescent protein.

[10] The method according to any one of [5] to [9], wherein the eukaryote is a mammal.

ADVANTAGEOUS EFFECTS OF INVENTION

The invention remarkably improves the transport of mRNA lacking a 5' cap structure transcribed by T7RNAP from a cell nucleus to a cell nucleus through a transmembrane to a cytoplasm by constructing a T7 expression system based on Vpu and/or Rev-RRE elements of HIV-1, promotes the translation and synthesis of proteins, and realizes the continuous, stable and efficient expression of recombinant proteins based on a T7 expression system in eukaryotic cells.

Drawings

FIG. 1 is a diagram showing the construction of the pS-T7RNAP plasmid.

FIG. 2 is a PCR verification diagram of the construction result of Saccharomyces cerevisiae genetically engineered strain BY4741(HO:: NLS-T7 RNAP). Wherein, lane 1 is an electrophoretogram of the control bacterium BY4741 genome PCR result; lane 2 is an electropherogram of the BY4741(HO:: NLS-T7RNAP) genomic PCR results.

FIG. 3 is a diagram showing the construction of the pS-hph plasmid.

FIG. 4 is a diagram showing the construction of the pS-vpu plasmid.

FIG. 5 is a diagram showing the construction of the pS-vpu/hph plasmid.

FIG. 6 is a graph showing the effect of hygromycin on the growth rate of different recombinant strains of Saccharomyces cerevisiae. Wherein, control represents BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; yhph represents the BY4741(HO:: NLS-T7RNAP, pS-hph) strain; yVpu-hph stands for BY4741(HO:: NLS-T7RNAP, pS-vpu/hph) strain.

FIG. 7 is a graph showing the effect of hygromycin on colony growth of different recombinant strains of Saccharomyces cerevisiae. Wherein, control represents BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; yhph represents the BY4741(HO:: NLS-T7RNAP, pS-hph) strain; yVpu-hph represents the BY4741(HO:: NLS-T7RNAP, pS-vpu/hph) strain, hygromycin concentrations of 0. mu.g/ml, 50. mu.g/ml, 100. mu.g/ml, 150. mu.g/ml, 200. mu.g/ml, respectively.

FIG. 8 is a graph showing the effect of Vpu on the expression of Nluc in s.cerevisiae for the T7 expression system. Wherein, control represents BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; yNluc stands for BY4741(HO:: NLS-T7RNAP, pS-Nluc) strain; yVpu-Nluc stands for BY4741(HO:: NLS-T7RNAP, pS-Vpu/Nluc) strain.

FIG. 9 is a graph showing the effect of Vpu on the expression of EGFP in s.cerevisiae by the T7 expression system. Wherein, control represents BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; yEGFP stands for BY4741(HO:: NLS-T7RNAP, pS-EGFP) strain; yVpu-EGFP stands for BY4741(HO:: NLS-T7RNAP, pS-Vpu/EGFP) strain.

FIG. 10 is a schematic diagram of the construction of pMSCVpuro-T7RNAP and pMSCVpuro-T7RNAP-Rev plasmids.

FIG. 11 is a schematic diagram of the construction of pMSCVpuro-T7RNAP-Nluc-RRE and pMSCVpuro-T7RNAP-Rev-Nluc-RRE plasmids.

FIG. 12 is a graph showing the effect of Rev-RRE on the expression of Nluc by T7 in human Hela cell line. Wherein W is a wild-type human Hela cell line; W-T7RP is a human Hela cell line into which pMSCVpuro-T7RNAP-Rev has been introduced; W-Rev-T7RP is a human Hela cell line into which pMSCVpuro-T7RNAP-Rev-Nluc-RRE was introduced.

FIG. 13 is a schematic diagram of the construction of the pMSCVpuro-T7RNAP-Vpu plasmid.

FIG. 14 is a schematic diagram of plasmid construction of pMSCVpuro-T7RNAP-Nluc and pMSCVpuro-T7 RNAP-Vpu-Nluc.

FIG. 15 is a graph showing the effect of Vpu on the expression of Nluc by the T7 expression system in human Hela cell lines. Wherein W is a wild-type human Hela cell line; W-T7RP is a human Hela cell line introduced with pMSCVpuro-T7 RNAP-Nluc; W-Vpu-T7RP is a human Hela cell line introduced with pMSCVpuro-T7 RNAP-Vpu-Nluc.

FIG. 16 is a diagram showing the construction of the pS-Rev/EGFP/RRE plasmid.

FIG. 17 is a schematic diagram of the construction of pMSCVpuro-T7RNAP-EGFP and pMSCVpuro-T7RNAP-Rev-EGFP-RRE plasmids.

Detailed Description

The present invention is further explained by the following examples, which are only used to illustrate the present invention, and the scope of the present invention is not limited thereto.

< Experimental Material >

Carrier: pMRI 31(GenBank: KJ 502281.1); pESC-URA (GenBank: AF 063585.2); pMSCVpuro, available from Shanghai enzyme research Biotech, Inc.; pumvc, available from shanghai enzyme research biotechnology limited; pMD2.G, available from Addgene (Catalog: 12259).

The strain is as follows: saccharomyces cerevisiae strain BY4741, purchased from Invitrogen.

Cell lines: 293T cells, purchased from the institute of Biotechnology, Chuanglian, Beijing; hela cells, purchased from the institute of biotechnology, north beijing, inc.

Culture medium: YPD medium purchased from Beijing Soilebao Tech Co., Ltd; SD-URA medium purchased from Beijing Soilebao Tech Co., Ltd; DEME medium, purchased from Beijing Soilebao Tech Co., Ltd; Opti-MEM serum-reduced medium was purchased from Beijing Sorley technologies, Inc.

Reagent: fetal Bovine Serum (FBS) available from total gold biotechnology limited, beijing; 10 XPBS buffer, available from Beijing Solaibao Tech Co., Ltd;

the Luciferase Assay System kit purchased from Promega Beijing Biotechnology Ltd; seamless cloning kit (Infusion) from china motai and biotechnology (beijing) ltd; fugene 9, available from beijing solibao technologies ltd; sorbitol, available from beijing solibao technologies ltd; hygromycin B, available from Beijing Solaibao Tech Co., Ltd; puromycin, available from Beijing Sorbao technologies, Inc.

< construction of plasmid and vector and method for expressing protein >

The conventional methods for constructing plasmids and vectors, expressing proteins, and packaging lentiviruses, etc., which are disclosed in the present application, can be referred to Molecular Biology and genetic methods known in the art, for example, the methods described in publications such as "conventional biological methods in the art", "Current Protocols in Molecular Biology, Wiley publication", "Molecular Cloning Manual, Cold spring harbor Laboratory publication", etc.

< example 1> construction and expression of HIV-1Vpu protein-based T7 expression System in Saccharomyces cerevisiae

Construction of pS-T7RNAP plasmid

Design and synthesis of T7RNAP (GenBank: KY484013.1) with Nuclear Localization Signal (NLS), wherein the nucleotide sequence of T7RNAP is shown as SEQ ID No: 1, the nucleotide sequence with a Nuclear Localization Signal (NLS) is shown as SEQ ID No: 2, respectively.

SEQ ID No：2：ATGCCCAAGAAGAAGCGGAAGGTC

The NLS-T7RNAP gene fragment was inserted downstream of the gal1,10 inducible promoter (GenBank: K02115.1) of pMRI 31 vector to construct a plasmid named pS-T7RNAP, and the T used _CYC1 The nucleotide sequence is shown as SEQ ID No: 3, the construction process is as shown in fig. 1.

2. Construction of genetically engineered Strain BY4741(HO:: NLS-T7RNAP)

Plasmid pS-T7RNAP was linearized using the sfi I endonuclease. The linearized plasmid fragment was recovered, and then transformed into Saccharomyces cerevisiae strain BY4741, and selection of geneticin G418 resistance resulted in the recombinant strain BY4741(HO:: NLS-T7RNAP) of Saccharomyces cerevisiae, into which the T7RNAP gene was integrated. To ensure positive transformants, the genomes of the recombinant strain and the blank strain of Saccharomyces cerevisiae were extracted and verified by the specific primer HO3 to determine whether the T7RNAP gene was correctly inserted into the HO region of the Saccharomyces cerevisiae genome, the result of which is shown in FIG. 2.

The nucleotide sequence of HO3 is as follows:

HOF3:CGTGCCTGCGATGAGATAC(SEQ ID No：4)

HOR3:GGCGTATTTCTACTCCAGCA(SEQ ID No：5)

a fragment with the size of 2947bp amplified BY the control group shows no insertion fragment, while a fragment with the size of 7672bp amplified BY the experimental group shows that the T7RNAP gene is successfully inserted into a saccharomyces cerevisiae BY4741 chromosome.

3. Construction of plasmid pS-vpu/hph

Synthesis of P based on the Gene sequences provided _T7 IRES-hph fragment, P _T7 The sequence is SEQID No: 6, the sequence of hph is SEQ ID No: 7, T _T7 The sequence is SEQ ID No: 8, the fragment is inserted into a vector pESC-URA by a seamless cloning method to complete the construction of a plasmid pS-hph, and the construction flow is shown as the figure 3. Meanwhile, a vpu gene (shown as SEQ ID No: 9) carrying a Nuclear Localization Sequence (NLS) was inserted into the downstream of the gal bidirectional promoter in the vector pESC-URA to construct a plasmid pS-vpu, the construction flow of which is shown in FIG. 4.

Amplification of P Using plasmid pS-hph as template _T7 IRES-hph DNA fragment, the primers used are as follows:

F:TCAAGGAGAAAAAACCAAAAAACCCCTCAAGGCCC(SEQ ID No：

10)

R:TTAATGCAGCTGGATTAATACGACTCACTATAGGT(SEQ ID No：11)

finally P to be recovered _T7 The IRES-hph fragment was inserted into the plasmid vector pS-vpu by the same method of seamless cloning to construct the plasmid pS-vpu/hph, and the vector construction process is shown in FIG. 5.

4. Construction of genetically engineered Strain BY4741(HO:: NLS-T7RNAP, pS-vpu/hph)

And transferring the final target plasmid pS-vpu/hph into saccharomyces cerevisiae BY4741(HO:: NLS-T7RNAP) to obtain a saccharomyces cerevisiae recombinant strain BY4741(HO:: NLS-T7RNAP, pS-vpu/hph). The specific operation refers to the following steps of saccharomyces cerevisiae competence preparation and transformation.

The preparation process of the saccharomyces cerevisiae competence is as follows:

(1) single yeast colonies were picked from the plates and cultured in 5mL YPD liquid medium at 30 ℃ for 12 hours. Then, 500. mu.L of the culture medium was aspirated to 50mL of YPD liquid medium, and the medium was further cultured at 30 ℃ for 18-24 hours to OD ₆₀₀ About 2.

(2) Transferring the bacterial liquid to a sterilized 50ml centrifuge tube, centrifuging at 5000rpm for 5min, removing supernatant, then re-suspending the thalli with 30ml of precooled sterile water, and centrifuging at 5000rpm for 5min to remove supernatant.

(3) The cells were resuspended in 20ml of precooled and sterilized 1M sorbitol and the supernatant removed. And finally, transferring the 1M sorbitol heavy suspension cells with 200-500 mul to a 1.5ml centrifuge tube to obtain the saccharomyces cerevisiae competent cells. Fresh competence is required to be prepared each time yeast transformation is performed to ensure high transformation rate.

The saccharomyces cerevisiae electrotransformation steps are as follows:

(1) and (3-5) mu L of linear plasmid or plasmid (the concentration is more than or equal to 300 ng/mu L) and 40 mu L of saccharomyces cerevisiae competent cells are uniformly mixed in a precooled 1.5mL centrifuge tube, transferred into a 2mm electric transfer cup and precooled on ice for 5 min.

(2) The water drops on the electric revolving cup are wiped off with paper, and the electric revolving apparatus is adopted to shock under the electric shock strength of 1500V.

(3) 1mL of YPD medium was added to an electric rotor, and the mixture was transferred to a sterilized 1.5mL centrifuge tube by gentle suspension and allowed to stand at 30 ℃ for 2 hours for recovery. After recovery, the cells were washed 3 times with sterile water and plated on appropriate plates. The culture was incubated at 30 ℃ for 2-3 days until single colonies appeared.

5. Detection of recombinant protein expression effect of constructed T7 expression system in saccharomyces cerevisiae

The expression of the T7RNAP gene is controlled by a Gal promoter which needs to be expressed under the induction condition of taking galactose as a carbon source, so that the recombinant strain of the saccharomyces cerevisiae can be firstly cultured in SD-URA for 24h and then induced and cultured for 48h by SG-URA, otherwise, T7RNA polymerase does not participate in the T7 expression system to play the self function.

Expression detection of hygromycin resistance protein (Hph) reporter gene in saccharomyces cerevisiae recombinant strain

< growth Rate of Strain >

The vectors pESC-URA and pS-hph were transferred into recombinant strain BY4741 of Saccharomyces cerevisiae (HO:: NLS-T7RNAP) according to the method of 4 in example 1, to obtain control strain BY4741(HO:: NLS-T7RNAP, pESC-URA) and strain BY4741(HO:: NLS-T7RNAP, pS-hph), respectively. These two control and experimental group strains BY4741(HO:: NLS-T7RNAP, pS-vpu/hph) were cultured in SD-URA liquid medium for 24 hours, and OD was adjusted BY dilution ₆₀₀ OD of three strains ₆₀₀ The values are consistent, inoculating the strain to SG-URA liquid culture medium according to 1% transfer quantity, adding hygromycin with the final concentration of 400 mu g/ml, and measuring the OD of the strain liquid every 12h ₆₀₀ The amount of the expressed resistance protein was reflected by the growth of the strain, and the results are shown in FIG. 6.

As can be seen from FIG. 6, the control strain BY4741(HO:: NLS-T7RNAP, pESC-URA) (denoted BY control) did not grow substantially at a hygromycin concentration of 400. mu.g/ml, and the strain BY4741(HO:: NLS-T7RNAP, pS-vpu/hph) (denoted BY yVpu-hph) carrying the vpu gene grew faster than the strain BY4741(HO:: NLS-T7RNAP, pS-hph) (denoted BY yhph) not carrying the vpu gene, indicating that the strain carrying the vpu gene expressed more resistance protein and thus grew faster. The experimental result shows that the T7 expression system containing Vpu protein utilizes Vpu protein to improve the permeability of nuclear membrane of cell nucleus, so that more mRNA transcribed by T7RNAP is transported to cytoplasm, the translation process is completed, and more resistance protein is synthesized.

< colony size and growth status >

Culturing Saccharomyces cerevisiae BY4741(HO:: NLS-T7RNAP, pESC-URA), recombinant strain BY4741(HO:: NLS-T7RNAP, pS-hph) and recombinant strain BY4741(HO:: NLS-T7RNAP, pS-vpu/hph) in SD-URA liquid culture medium for 24h, and diluting to adjust the thallus concentration of the three strains to make the OD of the three strains ₆₀₀ The values remained consistent, and the diluted inoculum was spotted on SG-URA solid plates containing different concentrations of hygromycin, which were 0. mu.g/ml, 50. mu.g/ml, 100. mu.g/ml, 150. mu.g/ml and 200. mu.g/ml in this order (see FIG. 7, the uppermost digit represents the concentration of hygromycin). The size and growth state of colonies were observed after 3 days, and the results are shown in FIG. 7.

As can be seen from FIG. 7, the strain grew normally at a hygromycin concentration of 0. mu.g/ml; with increasing hygromycin concentration, BY4741(HO:: NLS-T7RNAP, pESC-URA), which does not carry a resistance gene, is inhibited from growing until it fails to grow, expressed as control. BY4741(HO:: NLS-T7RNAP, pS-Vpu/hph) carrying Vpu gene (expressed as yVpu-hph) has more colonies than BY4741(HO:: NLS-T7RNAP, pS-hph) not carrying Vpu gene (expressed as yhph), which indicates that the introduction of Vpu protein can improve the permeability of nuclear membrane, so that more mRNA transcribed BY T7RNAP passes through the nuclear membrane into cytoplasm to synthesize hygromycin-resistant protein.

NanoLuc ^TM Detection of luciferase (Nluc) reporter Gene expression in recombinant Saccharomyces cerevisiae strains

Plasmids and recombinant strains of Saccharomyces cerevisiae were constructed BY the methods of 3 and 4 in example 1 to obtain yeast strains BY4741(HO:: NLS-T7RNAP, pESC-URA), BY4741(HO:: NLS-T7RNAP, pS-Nluc), BY4741(HO:: NLS-T7RNAP, pS-Vpu/Nluc). The nucleotide sequence of Nluc is shown as SEQ ID No: shown at 12.

The three strains are respectively subjected to the following operations: culturing in SD-URA liquid culture medium for 24 hr, inoculating to SG-URA liquid culture medium according to 1% inoculum size, culturing to a certain concentration, centrifuging, collecting thallus, washing with filter sterilized PBS for 3 times, and suspending in sterile PBS.

The detection method comprises the following steps: reacting Nano-Glo ^TM Substrate and lysis buffer provided with kit diluted at 1:50 and mixed with yeast cells at 1:10, transferring 200. mu.l of sample to white 96-well plate, immediately using Luminence mode of multifunctional microplate reader to determine bioluminescence intensity, transferring 200. mu.l of sample to 96-well transparent plate for determining OD ₆₀₀ . To compare the differences between different bacteria, the mean bioluminescence intensity in the experiment was divided by the OD ₆₀₀ . The sample is diluted to the appropriate concentration (OD) prior to measurement ₆₀₀ 0.3 to 0.8), the results are shown in fig. 8.

As can be seen in FIG. 8, the bioluminescent signal was not substantially detected in the control strain containing no luciferase gene (denoted BY control), and the bioluminescent intensity of the strain BY4741 carrying the Vpu gene (HO:: NLS-T7RNAP, pS-Vpu/Nluc) (denoted BY yVpu-Nluc) was 2.0 times higher than that of the strain BY4741 not carrying the Vpu gene (HO:: NLS-T7RNAP, pS-Nluc) (denoted BY yNluc). The result shows that the Vpu protein improves the permeability of nuclear membranes of cell nuclei, thereby promoting the mRNA transcribed by T7RNAP to be transported to cytoplasm through membrane, so that more protein is synthesized than a T7 expression system not carrying the Vpu protein, and the aim of efficiently expressing recombinant protein is fulfilled.

Expression detection of Enhanced Green Fluorescent Protein (EGFP) reporter gene in recombinant saccharomyces cerevisiae strain

Plasmids and recombinant strains of Saccharomyces cerevisiae were constructed in accordance with the methods of 3 and 4 in example 1 to obtain yeast strains BY4741(HO:: NLS-T7RNAP, pESC-URA), BY4741(HO:: NLS-T7RNAP, pS-EGFP) and BY4741(HO:: NLS-T7RNAP, pS-Vpu/EGFP). The nucleotide sequence of EGFP is shown as SEQ ID No: shown at 13.

The three strains were subjected to the following operations: after culturing in SD-URA liquid culture medium for 24h, transferring to SG-URA liquid culture medium according to 1% inoculum size, culturing to a certain concentration, centrifuging, collecting thallus, washing with sterile water for 3 times, suspending in sterile water, and detecting fluorescent gene expression by a multifunctional microplate reader, wherein the results are shown in Table 1 and FIG. 9.

TABLE 1 mean fluorescence intensity of different Saccharomyces cerevisiae recombinant strains

In Table 1, control represents BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; yEGFP stands for BY4741(HO:: NLS-T7RNAP, pS-EGFP) strain; yVpu-EGFP stands for BY4741(HO:: NLS-T7RNAP, pS-Vpu/EGFP) strain.

As can also be seen from FIG. 9, the fluorescence intensity of BY4741(HO:: NLS-T7RNAP, pS-Vpu/EGFP) strain is significantly higher than that of BY4741(HO:: NLS-T7RNAP, pESC-URA) strain and BY4741(HO:: NLS-T7RNAP, pS-EGFP), indicating that Vpu protein increases the permeability of nuclear membrane of nucleus, thereby promoting the transport of mRNA transcribed BY T7RNAP into cytoplasm through membrane, and therefore synthesizing more protein than T7 expression system without Vpu protein, and achieving the purpose of efficiently expressing recombinant protein.

< example 2> construction and expression of T7 expression System based on HIV-1Rev-RRE regulatory element in mammalian cells

1. Construction of Lentiviral expression vector pMSCVpuro-T7RNAP-Rev-Nluc-RRE

The promoter of human phosphoglycerate kinase 1(PGK1) gene (shown as SEQ ID No: 14) is selected as the promoter for expressing T7RNAP and Rev, the co-expression of T7RNAP and Rev (shown as SEQ ID No: 15) proteins is realized by connecting 2A (shown as SEQ ID No: 16) or IRES (shown as SEQ ID No: 17), and pMSCVpuro-T7RNAP-Rev plasmids are finally constructed. Taking the 2A connection as an example, the construction flow is shown in fig. 10.

Respectively synthesizing PGK1, NLS-T7RNAP, SV40poly (A) (shown as SEQ ID No: 18) and 2A-Rev-SV40poly (A) fragments, fusing the fragments by adopting a fusion PCR technology to obtain large fragments of PGK1-T7RNAP-SV40 poly (A) and PGK1-T7RNAP-2A-Rev-SV40poly (A), and finally transferring the DNA fragments of PGK1-T7RNAP-SV40 poly (A) and PGK1-T7RNAP-2A-Rev-SV40poly (A) to a lentivirus expression vector pMSCUro to complete the construction of plasmids pMSCVpuro-T7RNAP and pMSCuro-T7 RNAP-Rev.

Synthesis of P _T7 -IRES-Nluc-RRE fragment, RRE sequence SEQ ID No: 19, or a sequence shown in seq id no. Finally, the DNA fragment P is added _T7 And transferring the IRES-Nluc-RRE to vectors pMSCVpuro-T7RNAP and pMSCVpuro-T7RNAP-Rev to complete the construction of plasmids pMSCVpuro-T7RNAP-Nluc-RRE and pMSCVpuro-T7RNAP-Rev-Nluc-RRE, wherein the specific construction flow is shown in figure 11.

2.293 packaging lentivirus from T cell, infecting human Hela cell

The vectors pMSCVpuro-T7RNAP-Nluc-RRE and pMSCVpuro-T7RNAP-Rev-Nluc-RRE constructed above are transfected into 293T cells to complete lentivirus packaging. Successfully transformed transformants were selected by puromycin. For specific manipulations, reference is made to the following procedure for packaging of 293T cells with lentiviruses and for infecting cells of interest with lentiviruses.

The 293T cell packaging lentivirus process is as follows:

(1) when the cells grew to nonagorean, the cell culture medium was discarded, gently rinsed once with sterile PBS, and digested with 1ml of 0.25% pancreatin. After the cells were observed to be digested and rounded under a microscope, the pancreatic enzymes were discarded, the 293T cells were resuspended in a 10% FBS-containing DMEM medium, and the number of 5X 10 cells was counted ⁵ Individual cells were divided into each well of a 6-well cell culture plate.

(2) After 24h, 293T cells were transfected:

a: 30ul of Fugene 9 was diluted with 470. mu.l of Opti-MEM, gently mixed well, and allowed to stand at room temperature for 5 min.

B: preparing a target plasmid and a packaging vector plasmid:

two packaging vector plasmids, pUMVC: 1 mu g of the solution; pmd2. g: 0.5. mu.g

Target plasmid: 1 μ g.

C: dropwise adding the prepared plasmid mixture into a mixed solution of Opti-MEM and Fugene 9, and standing at room temperature for 20 min; to each well of a 6-well plate inoculated with cells and containing 100. mu.l of medium, 2 to 10. mu.l of the above mixture was added. And (4) blowing and sucking or shaking by using a shaker for 10-30 s for uniformly mixing, and putting the cells back into the incubator for continuous culture.

D: after 6-8 h, the 293T cells were changed, and the cells were placed in a 37 ℃ cell incubator for further culture for 48h without blowing up the cells (by gently adding new culture medium along the dish wall) when the liquid was added.

(3) Plating of target cells:

the cells of interest need to be plated one day in advance into six-well cell culture plates (the number of cell inoculations is 2X 10) ⁵ ～3×10 ⁵ One) to ensure that the density is 30-40% during infection; a control group not infected with the virus was also prepared. The following day the supernatant was discarded and virus-containing medium was added for infection.

(4) Collecting slow virus liquid:

48h after transfection (this time with 293T cells), the supernatant was collected in a 15ml centrifuge tube, centrifuged at 3000rpm for 20min and the supernatant was filtered through a 0.45 μm filter tip. Adding appropriate amount of culture solution into six-well plate, collecting supernatant after 24 hr, subpackaging according to dosage, and storing in-80 deg.C refrigerator.

The steps for lentivirus infection of the cells of interest (human Hela cells) are as follows:

(1) preparing 3ml of culture medium 1640 (10% FBS), adding 3ml of virus supernatant (storing the rest virus supernatant in a refrigerator at-80 ℃), supplementing 4ml of 1640 culture solution after 24 hours, and ensuring that cells are in a good state;

(2) placing the cell culture plate in a cell culture box for further culture for 24 hours;

(3) after 48 hours, discarding the supernatant, replacing 6-8 ml of fresh culture medium, adding puromycin with corresponding concentration for screening, and killing cells which are not transferred into DNA;

(4) after 72h, cells with all dead negative control groups and proper amount of viable transfected DNA groups are selected for monoclonal culture, and the cells in the holes are divided into single cells by a limiting dilution method to be cultured in a 96-well plate for cell culture.

(5) Culturing for about 10 days, selecting cell monoclone, and detecting.

3. And (3) detecting the effect of the constructed T7 expression system on recombinant protein expression in mammalian cells.

Expression detection of Nluc reporter gene in human Hela cell line

Wild human Hela cell line was used as a control, wild Hela cells and lentivirus-infected cells were trypsinized to suspension, washed 3 times with sterile PBS, and the cells were resuspended in sterile PBS.

The detection method comprises the following steps: will be provided with

The substrate and lysis buffer provided in the kit were diluted 1:50 and mixed with the cells in a ratio of 1:10, 200. mu.l of the sample was transferred to a white 96-well plate, and bioluminescence was immediately measured using the luciferase mode of a multi-functional microplate reader, the results of which are shown in FIG. 12.

As can be seen from FIG. 12, substantially no bioluminescent signal was detected from the wild-type human Hela cell line (denoted by W). The bioluminescence intensity of the human Hela cell strain (represented by W-Rev-T7 RP) carrying the Rev-RRE element is 4.3 times of that of the human Hela cell strain (represented by W-T7 RP) not carrying the Rev-RRE element, which indicates that mRNA carrying the RRE element can be combined with Rev protein to promote the nuclear extraction of mRNA transcribed by T7RNAP, complete the translation process and continuously and stably express the target protein.

< example 3> construction and expression of HIV-1Vpu protein-based T7 expression System in mammalian cells

1. Construction of Lentiviral expression vector pMSCVpuro-T7RNAP-Vpu-NLuc

The promoter PGK1 of the human phosphoglycerate kinase gene is selected as the promoter for expressing T7RNAP and Vpu, the expression of T7RNAP and Vpu protein is realized by 2A or IRES connection, and pMSCVpuro-T7RNAP-Vpu is finally constructed. Taking the 2A connection as an example, the construction flow is shown in fig. 13.

Respectively synthesizing fragments PGK1, NLS-T7RNAP and 2A-Vpu-NLS-SV40 poly (A), fusing the three fragments by adopting a fusion PCR technology to obtain a large fragment PGK1-T7RNAP-2A-Vpu-SV40poly (A), and finally transferring the DNA fragment PGK1-T7RNAP-2A-Vpu-SV40poly (A) to a lentivirus expression vector pMSCVpuro by a seamless cloning method to complete the construction of the plasmid pMSCVpuro-T7 RNAP-Vpu.

Synthesis of P _T7 IRES-Nluc fragment, DNA fragment P by means of seamless cloning _T7 IRES-Nluc was transferred to the vectors pMSCVpuro-T7RNAP and pMSCVpuro-T7RNAP-Vpu, and the construction of the plasmids pMSCVpuro-T7RNAP-Nluc and pMSCVpuro-T7RNAP-Vpu-Nluc was completed, and the specific construction flow is shown in FIG. 14.

2.293 packaging lentivirus from T cell, infecting human Hela cell

The vectors constructed above, pMSCVpuro-T7RNAP-Nluc and pMSCVpuro-T7RNAP-Vpu-Nluc, were transfected into 293T cells to complete lentiviral packaging. Transformants successfully transformed by puromycin screening were specifically manipulated according to the procedure of example 2 in which 293T cells were packaged with lentivirus and the lentivirus infected cells of interest.

3. And (3) detecting the effect of the constructed T7 expression system on the expression of the recombinant protein in mammalian cells.

Expression detection of Nluc reporter gene in human Hela cells

The wild human Hela cell line was used as a control, wild human Hela cells and lentivirus-infected cells were trypsinized to suspension, washed 3 times with sterile PBS, and the cells were resuspended in sterile PBS.

The detection method comprises the following steps: will be provided with

The substrate was diluted 1:50 with lysis buffer provided in the kit and mixed with cells at a ratio of 1:10, 200. mu.l of the sample was transferred to a white 96-well plate, and bioluminescence was immediately measured using the Luminescene mode of a multifunctional microplate reader, the results of which are shown in FIG. 15.

As can be seen from FIG. 15, substantially no bioluminescent signal was detected from the wild-type human Hela cell line (denoted by W). The bioluminescence intensity of the human Hela cell strain (represented by W-Vpu-T7 RP) carrying the Vpu protein is 4.5 times of the bioluminescence intensity of the human Hela cell strain (represented by W-T7 RP) not carrying the Vpu protein, which shows that the Vpu protein can improve the nuclear membrane permeability of cell nuclei, help the mRNA transcribed by T7RNAP to go out of the nuclei, complete the translation process and realize the continuous, stable and high-efficiency expression of the target protein.

< example 4> difference in protein expression in Saccharomyces cerevisiae and human Hela cells by Rev-RRE-based T7 expression System

Referring to example 1 to construct a Rev-RRE-based T7 expression system suitable for s.cerevisiae, a Rev gene fragment (see, SEQ ID No: 3 in the sequence Listing) was first inserted downstream of the pESC-URAgal bidirectional promoter to construct a plasmid vector pS-Rev. Synthesis of P _T7 IRES-EGFP-RRE fragment, and the above fragment was inserted into plasmid pS-Rev by a seamless cloning method to construct plasmid pS-Rev/EGFP/RRE, the vector construction process being shown in FIG. 16. Saccharomyces cerevisiae strain BY4741(HO:: NLS-T7RNAP, pS-Rev/EGFP/RRE) was constructed BY reference to method 4 in example 1. Referring to example 2, a Rev-RRE-based T7 expression vector pMSCVpuro-T7RNAP-Rev-EGFP-RRE suitable for human Hela cells was constructed using EGFP as a reporter gene, and the construction process is shown in FIG. 17. The effect of the Rev-RRE regulatory element-based T7 expression system on recombinant protein expression in Saccharomyces cerevisiae and human Hela cells was compared as determined in example 1 using Enhanced Green Fluorescent Protein (EGFP) as a reporter gene, and the results are shown in Table 2.

TABLE 2 mean fluorescence intensity of Saccharomyces cerevisiae and human Hela cells

In Table 2, control 1 represents Saccharomyces cerevisiae BY4741(HO:: NLS-T7RNAP, pESC-URA) strain; control 2 represents wild human Hela cell line; yRev-RRE-EGFP represents Saccharomyces cerevisiae BY4741(HO:: NLS-T7RNAP, pS-Rev/EGFP/RRE) strain; W-T7RP-Rev-EGFP-RRE represents the human Hela cell strain introduced with pMSCVpuro-T7 RNAP-Rev-EGFP-RRE.

As can be seen from Table 2, the T7 expression system based on Rev-RRE regulatory element has little difference in fluorescence intensity between Control 1 and yRev-RRE-EGFP in Saccharomyces cerevisiae, which indicates that yRev-RRE-EGFP has no green fluorescent protein expression. In human Hela cells, the fluorescence intensity of W-T7RP-Rev-EGFP-RRE is 21.3 times that of Control 2, which shows that the protein expression of the T7 expression system based on Rev-RRE element is better than that of Saccharomyces cerevisiae in mammalian cells.

Industrial applicability

The application develops an expression system for producing proteins by eukaryotes, and the mRNA transcribed by T7RNAP and lacking a 5' cap structure is transported to cytoplasm by the HIV-1Vpu membrane protein and Rev-RRE regulatory element, so that the recombinant protein can be continuously, stably and efficiently expressed in eukaryotic cells.

Sequence listing

<110> Beijing university of chemical industry

<120> an expression system of T7RNA polymerase and T7 promoter and method for expressing protein in eukaryote using the same

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2652

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaacacga ttaacatcgc taagaacgac ttctctgaca tcgaactggc tgctatcccg 60

ttcaacactc tggctgacca ttacggtgag cgtttagctc gcgaacagtt ggcccttgag 120

catgagtctt acgagatggg tgaagcacgc ttccgcaaga tgtttgagcg tcaacttaaa 180

gctggtgagg ttgcggataa cgctgccgcc aagcctctca tcactaccct actccctaag 240

atgattgcac gcatcaacga ctggtttgag gaagtgaaag ctaagcgcgg caagcgcccg 300

acagccttcc agttcctgca agaaatcaag ccggaagccg tagcgtacat caccattaag 360

accactctgg cttgcctaac cagtgctgac aatacaaccg ttcaggctgt agcaagcgca 420

atcggtcggg ccattgagga cgaggctcgc ttcggtcgta tccgtgacct tgaagctaag 480

cacttcaaga aaaacgttga ggaacaactc aacaagcgcg tagggcacgt ctacaagaaa 540

gcatttatgc aagttgtcga ggctgacatg ctctctaagg gtctactcgg tggcgaggcg 600

tggtcttcgt ggcataagga agactctatt catgtaggag tacgctgcat cgagatgctc 660

attgagtcaa ccggaatggt tagcttacac cgccaaaatg ctggcgtagt aggtcaagac 720

tctgagacta tcgaactcgc acctgaatac gctgaggcta tcgcaacccg tgcaggtgcg 780

ctggctggca tctctccgat gttccaacct tgcgtagttc ctcctaagcc gtggactggc 840

attactggtg gtggctattg ggctaacggt cgtcgtcctc tggcgctggt gcgtactcac 900

agtaagaaag cactgatgcg ctacgaagac gtttacatgc ctgaggtgta caaagcgatt 960

aacattgcgc aaaacaccgc atggaaaatc aacaagaaag tcctagcggt cgccaacgta 1020

atcaccaagt ggaagcattg tccggtcgag gacatccctg cgattgagcg tgaagaactc 1080

ccgatgaaac cggaagacat cgacatgaat cctgaggctc tcaccgcgtg gaaacgtgct 1140

gccgctgctg tgtaccgcaa ggacaaggct cgcaagtctc gccgtatcag ccttgagttc 1200

atgcttgagc aagccaataa gtttgctaac cataaggcca tctggttccc ttacaacatg 1260

gactggcgcg gtcgtgttta cgctgtgtca atgttcaacc cgcaaggtaa cgatatgacc 1320

aaaggactgc ttacgctggc gaaaggtaaa ccaatcggta aggaaggtta ctactggctg 1380

aaaatccacg gtgcaaactg tgcgggtgtc gataaggttc cgttccctga gcgcatcaag 1440

ttcattgagg aaaaccacga gaacatcatg gcttgcgcta agtctccact ggagaacact 1500

tggtgggctg agcaagattc tccgttctgc ttccttgcgt tctgctttga gtacgctggg 1560

gtacagcacc acggcctgag ctataactgc tcccttccgc tggcgtttga cgggtcttgc 1620

tctggcatcc agcacttctc cgcgatgctc cgagatgagg taggtggtcg cgcggttaac 1680

ttgcttccta gtgaaaccgt tcaggacatc tacgggattg ttgctaagaa agtcaacgag 1740

attctacaag cagacgcaat caatgggacc gataacgaag tagttaccgt gaccgatgag 1800

aacactggtg aaatctctga gaaagtcaag ctgggcacta aggcactggc tggtcaatgg 1860

ctggcttacg gtgttactcg cagtgtgact aagcgttcag tcatgacgct ggcttacggg 1920

tccaaagagt tcggcttccg tcaacaagtg ctggaagata ccattcagcc agctattgat 1980

tccggcaagg gtctgatgtt cactcagccg aatcaggctg ctggatacat ggctaagctg 2040

atttgggaat ctgtgagcgt gacggtggta gctgcggttg aagcaatgaa ctggcttaag 2100

tctgctgcta agctgctggc tgctgaggtc aaagataaga agactggaga gattcttcgc 2160

aagcgttgcg ctgtgcattg ggtaactcct gatggtttcc ctgtgtggca ggaatacaag 2220

aagcctattc agacgcgctt gaacctgatg ttcctcggtc agttccgctt acagcctacc 2280

attaacacca acaaagatag cgagattgat gcacacaaac aggagtctgg tatcgctcct 2340

aactttgtac acagccaaga cggtagccac cttcgtaaga ctgtagtgtg ggcacacgag 2400

aagtacggaa tcgaatcttt tgcactgatt cacgactcct tcggtaccat tccggctgac 2460

gctgcgaacc tgttcaaagc agtgcgcgaa actatggttg acacatatga gtcttgtgat 2520

gtactggctg atttctacga ccagttcgct gaccagttgc acgagtctca attggacaaa 2580

atgccagcac ttccggctaa aggtaacttg aacctccgtg acatcttaga gtcggacttc 2640

gcgttcgcgt aa 2652

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcccaaga agaagcggaa ggtc 24

<210> 3

<211> 246

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag 60

ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa 120

cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca 180

ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcggcc 240

ggtacc 246

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtgcctgcg atgagatac 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcgtatttc tactccagca 20

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactatagg 19

<210> 7

<211> 1026

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60

agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120

gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180

cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240

ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300

caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360

gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420

atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480

cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540

ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600

tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660

atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720

tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780

cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840

ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900

gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960

tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020

gaatag 1026

<210> 8

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctagcataac cccttggggc ctctaaacgg gccttgaggg gttttttg 48

<210> 9

<211> 243

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgcaaccta tacaaatagc aatagtagca ttagtagtag caataataat agcaatagtt 60

gtgtggtcca tagtaatcat agaatatagg aaaatattaa gacaaagaaa aatagacagg 120

ttaattgata gactaataga aagagcagaa gacagtggca atgagagtga aggaaaaata 180

tcagcacttg tggagatggg ggtggagatg gggcaccatg ctccttggga tgttgatgat 240

ctg 243

<210> 10

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcaaggagaa aaaaccaaaa aacccctcaa ggccc 35

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttaatgcagc tggattaata cgactcacta taggt 35

<210> 12

<211> 516

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atggtcttca cactcgaaga tttcgttggg gactggcgac agacagccgg ctacaacctg 60

gaccaagtcc ttgaacaggg aggtgtgtcc agtttgtttc agaatctcgg ggtgtccgta 120

actccgatcc aaaggattgt cctgagcggt gaaaatgggc tgaagatcga catccatgtc 180

atcatcccgt atgaaggtct gagcggcgac caaatgggcc agatcgaaaa aatttttaag 240

gtggtgtacc ctgtggatga tcatcacttt aaggtgatcc tgcactatgg cacactggta 300

atcgacgggg ttacgccgaa catgatcgac tatttcggac ggccgtatga aggcatcgcc 360

gtgttcgacg gcaaaaagat cactgtaaca gggaccctgt ggaacggcaa caaaattatc 420

gacgagcgcc tgatcaaccc cgacggctcc ctgctgttcc gagtaaccat caacggagtg 480

accggctggc ggctgtgcga acgcattctg gcgtaa 516

<210> 13

<211> 795

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgtctaaag gtgaagaatt attcactggt gttgtcccaa ttttggttga attagatggt 60

gatgttaatg gtcacaaatt ttctgtctcc ggtgaaggtg aaggtgatgc tacttacggt 120

aaattgacct taaaatttat ttgtactact ggtaaattgc cagttccatg gccaacctta 180

gtcactactt tcggttatgg tgttcaatgt tttgctagat acccagatca tatgaaacaa 240

catgactttt tcaagtctgc catgccagaa ggttatgttc aagaaagaac tatttttttc 300

aaagatgacg gtaactacaa gaccagagct gaagtcaagt ttgaaggtga taccttagtt 360

aatagaatcg aattaaaagg tattgatttt aaagaagatg gtaacatttt aggtcacaaa 420

ttggaataca actataactc tcacaatgtt tacatcatgg ctgacaaaca aaagaatggt 480

atcaaagtta acttcaaaat tagacacaac attgaagatg gttctgttca attagctgac 540

cattatcaac aaaatactcc aattggtgat ggtccagtct tgttaccaga caaccattac 600

ttatccactc aatctgcctt atccaaagat ccaaacgaaa agagagacca catggtcttg 660

ttagaatttg ttactgctgc tggtattacc catggtatgg atgaattgta caaatctaga 720

actagtggat cccccgggct gcaggaattc gatatcaagc ttatcgatac cgtcgacctc 780

gagtcatgta attag 795

<210> 14

<211> 500

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg 60

gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc accggtaggc 120

gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 180

ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac 240

gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg gtaggccttt 300

ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg ctgggaaggg 360

gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 420

ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 480

cctcatctcc gggcctttcg 500

<210> 15

<211> 348

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atggcaggaa gaagcggaga cagcgacgaa gaactcctca aggcagtcag actgatcaag 60

tttctctacc aaagcaaccc acctcccagc ccagagggga cccgacaggc ccgaaggaat 120

cgaagaagaa ggtggagaga gagacagaga cagatccgag cacttagtgg atggattctt 180

agcactcatc tgggtcgatc tgcggagcct gtgcctcttc agctaccacc gcttgagaga 240

cttactcttg attgtaacga ggattgtgga aattctggga cgcagggggt gggaaatcat 300

caagtattgg tggagtctcc tacaatattg gagtcaggaa ctaaagaa 348

<210> 16

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aattttgacc tgctcaagtt ggccggagac gttgagtcca accctgggcc c 51

<210> 17

<211> 627

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgtttattca agtggaagca gatttgtacg ctcaagcggt tgaataaact agttaacgtt 60

actggccgaa gtcgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc 120

atattgccgt cttttggcaa tgtgagggcc cggaaacctg gccctgtctt cttgacgagc 180

attcctaggg gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag 240

gaagcagttc ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg 300

cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg tgtataagat 360

acacctgcaa aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga 420

gtcaaatggc tctcctcaag cgtattcaac aaggggctga aggatgccca gaaggtaccc 480

cattgtatgg gatctgatct ggggcctcgg tgcacatgct ttacatgtgt ttagtcgagg 540

ttaaaaaaac gtctaggccc cccgaaccac ggggacgtgg ttttcctttg aaaaacacga 600

tgataatatg gccacaacgt cgatatg 627

<210> 18

<211> 122

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210> 19

<211> 234

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aggagctatg ttccttgggt tcttgggagc agcaggaagc actatgggct cagcgtcaat 60

ggcgctgacg gtacaggcca ggctattgtt gtctggtata gtgcaacagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gaccaacagc tcct 234

Claims

1. An expression system for T7RNA polymerase and T7 promoter, comprising a Rev-RRE regulatory element in HIV-1 retrovirus.

2. The expression system of claim 1, wherein the T7RNA polymerase consists of SEQ ID No: 1, and coding the sequence represented by the symbol 1.

3. The expression system of claim 1 or 2, wherein the gene for T7RNA polymerase further comprises a nuclear localization sequence.

4. The expression system of claim 3, wherein the nuclear localization sequence is an SV40T-Antigen nuclear localization sequence, a Nucleoplasmin nuclear localization sequence, an EGL-13 nuclear localization sequence, a c-Myc nuclear localization sequence or a TUS-protein nuclear localization sequence.

5. A method for expressing a protein in a eukaryote using an expression system of T7RNA polymerase and T7 promoter, wherein said expression system comprises the Rev-RRE regulatory element in HIV-1 retrovirus.

6. The method of claim 5, wherein the method comprises:

1) constructing a vector expressing T7RNA polymerase and Rev, wherein the T7RNA polymerase consists of SEQ ID No: 1;

7. The method of claim 5 or 6, wherein the T7RNA polymerase gene further comprises a nuclear localization sequence.

8. The method as claimed in claim 6 or 7, wherein in the step 1), a mammalian promoter is selected as a promoter for expressing T7RNA polymerase and Rev, and a eukaryotic polycistronic structure containing 2A or IRES is constructed to obtain a vector for simultaneously expressing T7RNA polymerase and Rev.

9. The method according to any one of claims 6 to 8, wherein the protein of interest expressed by the expression system is verified using a hygromycin resistance protein, Nanoluc luciferase or enhanced green fluorescent protein.

10. The method according to any one of claims 5 to 9, wherein the eukaryote is a mammal.