CN107056899A - A kind of cell membrane localization signal peptide and its encoding gene and application - Google Patents

A kind of cell membrane localization signal peptide and its encoding gene and application Download PDF

Info

Publication number
CN107056899A
CN107056899A CN201710398887.8A CN201710398887A CN107056899A CN 107056899 A CN107056899 A CN 107056899A CN 201710398887 A CN201710398887 A CN 201710398887A CN 107056899 A CN107056899 A CN 107056899A
Authority
CN
China
Prior art keywords
cell membrane
signal peptide
cell
protein
target
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710398887.8A
Other languages
Chinese (zh)
Other versions
CN107056899B (en
Inventor
赵学潮
孔祥东
赵干业
刘宁
佘明聪
代鹏
赵勇江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Zhengzhou University
Original Assignee
First Affiliated Hospital of Zhengzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Zhengzhou University filed Critical First Affiliated Hospital of Zhengzhou University
Priority to CN201710398887.8A priority Critical patent/CN107056899B/en
Publication of CN107056899A publication Critical patent/CN107056899A/en
Application granted granted Critical
Publication of CN107056899B publication Critical patent/CN107056899B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0693Tumour cells; Cancer cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/033Fusion polypeptide containing a localisation/targetting motif containing a motif for targeting to the internal surface of the plasma membrane, e.g. containing a myristoylation motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16311Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16322New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of cell membrane localization signal peptide and its encoding gene and application, described signal peptide is (a) or (b);(a) polypeptide being made up of the amino acid sequence shown in SEQ ID NO.1;(b) substitution by the amino acid sequence shown in SEQ ID NO.1 by one or several amino acid residues and/or missing and/or addition and the derivative polypeptide with cell membrane localization signal peptide function.The present invention is another on the basis of the DNA sequence dna of coding Tat basic domains to have added 11 amino acid codings, and the targeting of endogenous and external source target protein can be positioned at cell membrane by the cell membrane localization signal peptide of formation.The cell membrane localization signal peptide that the present invention is provided and suitable target protein formation fusion protein, it is added to by intracellular overexpression or external source in cell culture medium, enhance the validity of endogenous and foreign protein cell membrane targeting positioning, the vaccine and medicine of virus, parasite, bacterium infection are treated available for exploitation, and realizes efficiently administration.

Description

A kind of cell membrane localization signal peptide and its encoding gene and application
Technical field
The present invention relates to a kind of cell membrane localization signal peptide, encoding gene and its application, belong to gene engineering technology field.
Background technology
Many human diseases, including nerve degenerative diseases, are currently what be can not be cured.Cell and tissue barrier are deposited In, such as blood-brain barrier (blood-brain barrier, BBB) under neurodegenerative disease particular case, treatment point is prevented The targeting transport of son, reduces the ability that treatment molecule reaches its own target.By with that can be worn through the cell of biomembrane The combination of saturating peptide (cell-penetrating peptides, CPP) is the heat of research with the bio distribution for increasing tissue treatment agent Point.CPP can carry different treatment molecules, be transported to their specific target spot and increase them them and be difficult to approach Tissue in concentration, so as to strengthen their therapeutic efficiency.
It is most to have prospect at present from the polypeptide of HIV-1 transcription factor Tat albumen basic domains, studies most clear CPP.It is expected to be used for treating various human diseases, particularly nerve degenerative diseases.It can be from different treatment molecule knots Close, including small molecule, antibody, polypeptide, liposome, nano particle and nucleic acid etc.;It can be effectively increased the tissue of therapeutic agent Permeability and the efficiency for reaching biological targets.
After the DNA sequence dna of coding Tat basic domains is merged with other GFPs, being overexpressed in target cell to drive Target protein is positioned in nucleus.And the penetrating peptide of Tat basic domains formation can be by endocytosis after being merged with foreign protein Approach enters cytoplasm, is accumulated in cytoplasm, has fraction to enter in nucleus.Therefore, it is possible to effectively make foreign protein The target spot acted in cytoplasm and nucleus.These characteristics of Tat basic domains, are that the new albumen of present invention identification turns Fortune signal peptide is laid a good foundation.The Protein transport signal peptide can drive fusion protein to be positioned on cell membrane, strengthen it is endogenous and The validity of foreign protein cell membrane targeting positioning.
The content of the invention
In order to solve the above problems, it is an object of the invention to provide a kind of cell membrane localization signal peptide, encoding gene and its Using endogenous (intracellular to be overexpressed) and the targeting of external source target protein can be positioned at cell membrane by the cell membrane localization signal peptide.
To achieve these goals, the technical solution adopted in the present invention is:
A kind of cell membrane localization signal peptide, described signal peptide is (a) or (b);
(a) polypeptide being made up of the amino acid sequence shown in SEQ ID NO.1;
(b) by the amino acid sequence shown in SEQ ID NO.1 is by the substitution of one or several amino acid residues and/or lacks Lose and/or addition and the derivative polypeptide with cell membrane localization signal peptide function.
A kind of gene order of cell membrane localization signal peptide described in coding, described gene order is (a), (b) or (c);
(a) nucleotide sequence as shown in SEQ ID NO.2;
(b) under strict conditions with the nucleotide sequence hybridization shown in SEQ ID NO.2 and coding have cell membrane localization The nucleotide sequence of signal peptide functional protein;
(c) there is more than 90% homology with the nucleotide sequence shown in SEQ ID NO.2 and encode and determine with cell membrane The nucleotide sequence of position signal peptide functional protein.
A kind of recombination fusion protein containing described cell membrane localization signal peptide.
A kind of recombinant expression carrier containing described gene order, recombinant bacterium or transgenic cell line.
A kind of described signal peptide is in the application that target protein is positioned in cell membrane.
A kind of method that target protein is positioned to cell membrane, will using described signal peptide as cell membrane localization signal peptide Target protein is positioned on cell membrane.
The described method that target protein is positioned to cell membrane, comprises the following steps:
(a) fusion is imported in target cell, so that target protein is positioned on the cell membrane of target cell;It is described to melt Close gene includes the gene order of encoded signal peptide and the gene order of encoding target albumen successively from upstream to downstream;Or
(b) external source fusion protein is added in target cell culture medium, so that cell membrane of the target protein across target cell It is positioned at into target cell, and finally on the cell membrane of target cell;The external source fusion protein includes successively from N-terminal to C-terminal The amino acid sequence of cell membrane localization signal peptide and target protein.
Described target cell is HeLa cells.
A kind of described cell membrane localization signal peptide is preparing the vaccine and medicine for the treatment of virus, parasite, bacterium infection In application.
Beneficial effects of the present invention:
The present invention has separately added 11 amino acid codings on the basis of the DNA sequence dna of coding Tat basic domains, is formed Cell membrane localization signal peptide endogenous (intracellular be overexpressed) and external source target protein can be targetted and be positioned at cell membrane.This is sent out The cell membrane localization signal peptide of bright offer and suitable target protein formation fusion protein, are added by intracellular overexpression or external source Enter into cell culture medium, enhance the validity of endogenous and foreign protein cell membrane targeting positioning, available for exploitation treatment disease Poison, parasite, the vaccine and medicine of bacterium infection, and realize efficiently administration.
Brief description of the drawings
Fig. 1 is the recombinant plasmid pcDNA3.1-21aa-EGFP of present invention Vector map.
The result figure that Fig. 2 builds for the recombinant plasmid pcDNA3.1-21aa-EGFP of the present invention, swimming lane 1,2 is attached most importance to Group plasmid pcDNA3.1-21aa-EGFP.
The fusion protein that Fig. 3 is expressed after the recombinant plasmid pcDNA3.1-21aa-EGFP transfection HeLa cells for the present invention Detection and localization figure.
Fig. 4 is recombinant plasmid pET-28a (+) -21aa-EGFP of present invention Vector map.
Fig. 5 is the result figure of recombinant plasmid pET-28a (+) -21aa-EGFP structures of the present invention, and swimming lane 1,2 is Recombinant plasmid pET-28a (+) -21aa-EGFP.
Detection and localization figures of the Fig. 6 for exogenous recombinant protein His-21aa-EGFP of the invention in HeLa cells.
Embodiment
Following examples facilitate a better understanding of the present invention, but do not limit the present invention.Experiment side in following embodiments Method, is conventional method unless otherwise specified.Test material used, is from routine biochemistry reagent business unless otherwise specified Shop is commercially available.
Embodiment 1, the positioning in the intracellular overexpression fusion proteins of HeLa
First, the structure of eukaryotic expression recombination plasmid
1st, primer is designed
Synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd comprising (the SEQ ID of expressed sequence table shown in SEQ ID NO.2 NO.1 is from the polypeptide of the 1st to 21 amino acid residues of N-terminal composition, abbreviation 21aa) nucleotide sequence pcr amplification primer thing, Specially:
Sense primer 21For:5’-CTGGTACCATGAAGTCGTGCTTCGCATGCCTAGTCTGCTTCATGGG It is Kpn I restriction enzyme sites at ACGTAAGAAGCGACGACAGCGACGACGAGTGAGCAAGGGCGAGGAGC-3 ', underscore (SEQ ID NO.3);
Anti-sense primer 21Rev:5’-CTGAATTCIt is EcoR I digestions position at TTACTTGTACAGCTCGTC-3 ', underscore Point (SEQ ID NO.4).
2nd, PCR is expanded:Using plasmid pEGFP-N1 as template, enter performing PCR amplification, obtain the PCR primer that size is 799bp. PCR amplification system (50 μ l) is:10×buffer 5μl、MgCl2(25mM)5μl、dNTP mixture(10mM each)1μl、 The 11 μ l of μ l, 21Rev (10 μM) of μ l, 21For (10 μM) of Taq polymerase (5U/ μ l) 0.5, the μ l of template 1, remaining addition ddH2O.PCR amplification conditions are:94℃5min;94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 60s, 30 circulations;72℃10min.
3rd, digestion:With the PCR primer (37 DEG C of digestion 4h) in restriction enzyme Kpn I and EcoR I double digestion steps 2, Obtain PCR digestion products.Meanwhile, with restriction enzyme Kpn I and EcoR I double digestion plasmid pcDNA3.1 (+), reclaim 5400bp or so linear plasmid DNA segment.
4th, connect:The PCR digestion products of step 3 and pcDNA3.1 (+) linear DNA fragment are connected, recombinant plasmid is obtained PcDNA3.1-21aa-EGFP, pcDNA3.1-21aa-EGFP plasmid map are shown in Fig. 1.Recombinated with Kpn I and EcoR I double digestions Plasmid pcDNA3.1-21aa-EGFP, obtains the DNA segment (Fig. 2) of the 799bp described in step 2.According to sequencing result, counterweight Group plasmid pcDNA3.1-21aa-EGFP architectural feature is described as:In plasmid pcDNA3.1 (+) Kpn I and EcoR I digestions What the gene order of gene order and encoding green fluorescent protein EGFP between site shown in insertion SEQ ID NO.2 was constituted Fragment is merged, 21aa and EGFP fusion protein, abbreviation 21aa-EGFP is expressed.
2nd, positioning of the fusion protein in HeLa cells
With recombinant plasmid pcDNA3.1-21aa-EGFP transfection HeLa cells, determining for HeLa intracellular fusion proteins is detected Position.Specific method is:
1st, the culture of HeLa cells:Cultured HeLa cells are digested to 0.25% pancreatin it is unicellular, with containing It is 1.5 × 10 that the DMEM culture mediums of 10% hyclone, which are resuspended to cell concentration,5Cells/ml, is inoculated to 12 hole cell culture In plate, 1ml/ holes, in 35 DEG C, 5%CO2Under the conditions of culture 18-24h to cell attachment, during transfection, cell density is with 70-80% It is advisable.
2nd, DNA/PEI mixtures are prepared:With the DMEM culture mediums without serum and antibiotic, by every 1 μ g recombinant plasmids PcDNA3.1-21aa-EGFP is diluted to 90 μ l;6 μ l 1mg/ml PEI (polyetherimides are added according still further to every 1 μ g recombinant plasmids Amine) ratio of solution adds PEI solution, gentle to mix, and is stored at room temperature 10min.
3rd, transfect:The old culture medium in Tissue Culture Plate is discarded, 900 μ l fresh cultures are added per hole and (contain 10% tire ox The DMEM culture mediums of serum);The DNA/PEI mixtures being incubated are added to cell according to the amount of every μ g recombinant plasmids of hole 1 and trained It is gentle to mix in each hole for supporting plate, in 35 DEG C, 5%CO2Under the conditions of continue cultivate;After 18-24h, marked with Hoechst dye liquors The positioning of measurement fusion albumen, is as a result shown in Fig. 3 under nucleus, fluorescence microscope.Fig. 3 results show, fusion protein 21aa-EGFP On the cell membrane for being primarily located within HeLa cells.
The positioning of embodiment 2, exogenous fusion protein in HeLa cells
First, the structure of RT-PCR expression plasmid
1st, primer is designed
Synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd comprising (the SEQ ID of expressed sequence table shown in SEQ ID NO.2 NO.1 is from the polypeptide of the 1st to 21 amino acid residues of N-terminal composition, abbreviation 21aa) nucleotide sequence pcr amplification primer thing, Specially:
The For of sense primer 21 ':
5’-CTGGATCCATGAAGTCGTGCTTCGCATGCCTAGTCTGCTTCATGGGACGTAAGAAGCGACGACAGC It is BamH I restriction enzyme sites (SEQ ID NO.5) at GACGACGAGTGAGCAAGGGCGAGGAGC-3 ', underscore;
The Rev of anti-sense primer 21 ':5’-GACTCGAGIt is Xho I restriction enzyme sites at CTTGTACAGCTCGTC-3 ', underscore (SEQ ID NO.6)。
2nd, PCR is expanded:Using plasmid pEGFP-N1 as template, enter performing PCR amplification, obtain the PCR primer that size is 799bp. PCR amplification system (50 μ l) is:10×buffer 5μl、MgCl2(25mM)5μl、dNTP mixture(10mM each)1μl、 The μ l of Taq polymerase (5U/ μ l) 0.5, the μ l of 21 ' For (10 μM) 1, the μ l of 21 ' Rev (10 μM) 1, the μ l of template 1, remaining addition ddH2O.PCR amplification conditions are:94℃5min;94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 60s, 30 circulations;72℃10min.
3rd, digestion:With the PCR primer (37 DEG C of digestion 4h) in restriction enzyme BamH I and Xho I double digestion steps 2, Obtain PCR digestion products.Meanwhile, with restriction enzyme BamH I and Xho I double digestion plasmid pET-28a (+), reclaim 5300bp or so linear plasmid DNA segment.
4th, connect:The PCR digestion products of step 3 and pET-28a (+) linear DNA fragment are connected, prokaryotic expression weight is obtained Group plasmid pET-28a (+) -21aa-EGFP, prokaryotic expression His-21aa-EGFP fusion proteins.pET-28a(+)-21aa-EGFP Plasmid map is shown in Fig. 4.During with BamH I and Xho I double digestions pET-28a (+) -21aa-EGFP plasmids, obtain described in step 2 799bp DNA segment (Fig. 5).According to sequencing result, the architectural feature to recombinant plasmid pET-28a (+) -21aa-EGFP is retouched State for:The gene order shown in SEQ ID NO.2 is inserted between plasmid pET-28a (+) BamH I and Xho I restriction enzyme sites The fusion fragment constituted with encoding green fluorescent protein EGFP gene order, expression with 6 × His labels 21aa and EGFP fusion protein, abbreviation His-21aa-EGFP.
2nd, fusion protein His-21aa-EGFP expression and purification
1st, induced expression:Plasmid pET-28a (+) -21aa-EGFP is converted in bacterial strain E.coli BL21, chosen after 12h The single bacterium colony of corresponding plasmid conversion is taken, 3-5ml LB culture mediums (the μ g/ml containing ampicillin 100), 37 DEG C of culture 12- is inoculated into 18h, i.e. OD600Stop culture during more than 1.5.By bacterium solution by volume 1:100 are inoculated into (benzyl containing ammonia in 200ml LB culture mediums The μ g/ml of penicillin 100), 37 DEG C of culture 2-3h, to OD600For 0.6-0.8.The control for taking 1ml bacterium solutions to be used as before induction, in residue IPTG is added in bacterium solution to final concentration 0.1mM, 20 DEG C of slow-speed of revolution incubated overnights are gone to.Second day, 1ml bacterium solutions are taken to be used as after induction Control, remaining bacterium solution collects thalline in 4 DEG C of 6000rpm centrifugation 8min.
2nd, cellular lysate:The thalline of collection is resuspended in 20ml phosphate buffers (phosphate-buffered Saline, PBS), the composition of phosphate buffer is 140mM NaCl, 10mM Na2HPO4, 2.7mM KCl, 1.8mM KH2PO4, pH 7.3.Re-suspension liquid is in 4 DEG C of 6000rpm centrifugation 8min washing thallines.Centrifuged supernatant is abandoned, by the thalline weight after washing It is suspended from 10ml lysis buffers (20mM Tris-HCl, pH 7.4,100mM NaCl, 100mM imidazole, 0.1% Triton X-100,1 × protease inhibitor) in prepare thalline suspension, ultrasonication to thalline suspension becomes clear Clearly, it is to avoid produce a large amount of foams, PMSF (phenylmethylsulfonyl fluoride) to final concentration 1mM is added in good time, to reduce the degraded of albumen.4 DEG C 14000rpm centrifugation 30min, collects supernatant, and with 0.22 μm of aperture membrane filtration removal of impurities.
3rd, affinity purification:In advance with level pad 5ml (20mM Tris-HCl, pH 7.4,100mM of 5 times of column volumes NaCl, 100mM imidazole) in equilibrium at room temperature 1ml Ni2+Sepharose magnetic beads.The magnetic bead balanced is added to cell Crack in supernatant, in 4 DEG C of overnight incubations, PMSF to final concentration 1mM is added in good time, to reduce the degraded of albumen.Second day, use 5ml 5mM imidazole (being dissolved in 20mM Tris-HCl, pH 7.4,500mM NaCl buffer solutions) elutions are non-specific Adhesion protein.Respectively with 5ml 50mM, 250mM, 500mM imidazole (be dissolved in 20mM Tris-HCl, pH 7.4, In 100mM NaCl buffer solutions) elution destination protein, merge three eluents.
4th, albumen dialysis, concentration:The concentration tube of suitable aperture filter membrane is selected according to the size of molecular weight of albumen, by eluent Add in concentration tube, 4 DEG C of 5000rpm centrifuge 10-30min, are concentrated into below 0.5ml, add after 10ml PBS are mixed and continue Concentration, is repeated 2-3 times.Low-temperature operation is to prevent protein degradation.
5th, protein concentration is determined
Protein concentration is determined using equation, and aids in being corrected using BSA standard items.Protein concentration=[(A280 ×1.5-A260× 0.75)/extinction coefficient] × extension rate, wherein A260And A280Respectively in 260nm after protein sample dilution Absorbance during with 280nm.
3rd, positioning of the fusion protein in HeLa cells
1st, the culture of HeLa cells
The culture of HeLa cells:Cultured HeLa cells are digested to 0.25% pancreatin it is unicellular, with containing 10% It is 1.5 × 10 that the DMEM culture mediums of hyclone, which are resuspended to cell concentration,5Cells/ml, is inoculated to 12 porocyte culture plates In, 1ml/ holes, in 35 DEG C, 5%CO2Under the conditions of cultivate 18-24h.
2nd, the addition of foreign protein
The old culture medium in Tissue Culture Plate is discarded, 900 μ l fresh cultures are added per hole;In each hole of Tissue Culture Plate Middle addition destination protein is gentle to mix to final concentration 30nM, in 35 DEG C, 5%CO2Under the conditions of continue cultivate;After 12h, use Hoechst dye liquors mark the positioning of measurement fusion albumen under nucleus, fluorescence microscope, as a result see Fig. 6.Fig. 6 results show, melt Hop protein His-21aa-EGFP is primarily located within the cell membrane of HeLa cells.
The optimal embodiment of the present invention is the foregoing is only, for those skilled in the art, the present invention can have Various modifications and variations.Within the spirit and principles of the invention, any modification, equivalent substitution and improvements made etc., all should Within protection scope of the present invention.
SEQUENCE LISTING
<110>Affiliated hospital of Zhengzhou University first
<120>A kind of cell membrane localization signal peptide and its encoding gene and application
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> PRT
<213>HIV Tat basic domains
<400> 1
Lys Ser Cys Phe Ala Cys Leu Val Cys Phe Met Gly Arg Lys Lys Arg
1 5 10 15
Arg Gln Arg Arg Arg
20
<210> 2
<211> 63
<212> DNA
<213>HIV Tat basic domains
<400> 2
aagtcgtgct tcgcatgcct agtctgcttc atgggacgta agaagcgacg acagcgacga 60
cga 63
<210> 3
<211> 93
<212> DNA
<213>Artificial sequence
<400> 3
ctggtaccat gaagtcgtgc ttcgcatgcc tagtctgctt catgggacgt aagaagcgac 60
gacagcgacg acgagtgagc aagggcgagg agc 93
<210> 4
<211> 26
<212> DNA
<213>Artificial sequence
<400> 4
ctgaattctt acttgtacag ctcgtc 26
<210> 5
<211> 93
<212> DNA
<213>Artificial sequence
<400> 5
ctggatccat gaagtcgtgc ttcgcatgcc tagtctgctt catgggacgt aagaagcgac 60
gacagcgacg acgagtgagc aagggcgagg agc 93
<210> 6
<211> 23
<212> DNA
<213>Artificial sequence
<400> 6
gactcgagct tgtacagctc gtc 23

Claims (9)

1. a kind of cell membrane localization signal peptide, it is characterised in that described signal peptide is (a) or (b);
(a) polypeptide being made up of the amino acid sequence shown in SEQ ID NO.1;
(b) substitution by the amino acid sequence shown in SEQ ID NO.1 by one or several amino acid residues and/or missing And/or addition and the derivative polypeptide with cell membrane localization signal peptide function.
2. a kind of gene order for encoding the cell membrane localization signal peptide described in claim 1, it is characterised in that described gene Sequence is (a), (b) or (c);
(a) nucleotide sequence as shown in SEQ ID NO.2;
(b) under strict conditions with the nucleotide sequence hybridization shown in SEQ ID NO.2 and coding have cell membrane localization signal The nucleotide sequence of peptide functional protein;
(c) there is more than 90% homology with the nucleotide sequence shown in SEQ ID NO.2 and coding has cell membrane localization letter The nucleotide sequence of number peptide functional protein.
3. a kind of recombination fusion protein of the cell membrane localization signal peptide containing described in claim 1.
4. a kind of recombinant expression carrier, recombinant bacterium or the transgenic cell line of the gene order containing described in claim 2.
5. the signal peptide described in a kind of claim 1 is in the application that target protein is positioned in cell membrane.
6. a kind of method that target protein is positioned to cell membrane, it is characterised in that using the signal peptide described in claim 1 as Target protein is positioned on cell membrane by cell membrane localization signal peptide.
7. the method according to claim 6 that target protein is positioned to cell membrane, it is characterised in that including following step Suddenly:
(a) fusion is imported in target cell, so that target protein is positioned on the cell membrane of target cell;The fusion base Because including the gene order of encoded signal peptide and the gene order of encoding target albumen successively from upstream to downstream;Or
(b) external source fusion protein is added in target cell culture medium, so that target protein enters across the cell membrane of target cell In target cell, and finally it is positioned on the cell membrane of target cell;The external source fusion protein includes cell successively from N-terminal to C-terminal The amino acid sequence of membrane positioning signal peptide and target protein.
8. the method according to claim 7 that target protein is positioned to cell membrane, it is characterised in that described target cell For HeLa cells.
9. the signal peptide described in a kind of claim 1 is in treatment virus, parasite, the vaccine and medicine of bacterium infection is prepared Using.
CN201710398887.8A 2017-05-31 2017-05-31 Cell membrane positioning signal peptide and coding gene and application thereof Active CN107056899B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710398887.8A CN107056899B (en) 2017-05-31 2017-05-31 Cell membrane positioning signal peptide and coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710398887.8A CN107056899B (en) 2017-05-31 2017-05-31 Cell membrane positioning signal peptide and coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN107056899A true CN107056899A (en) 2017-08-18
CN107056899B CN107056899B (en) 2020-07-17

Family

ID=59615337

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710398887.8A Active CN107056899B (en) 2017-05-31 2017-05-31 Cell membrane positioning signal peptide and coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN107056899B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109575116A (en) * 2018-11-09 2019-04-05 广东海洋大学 A kind of mitochondria positioning leads peptide and its discovery method and application
CN117417407A (en) * 2023-10-20 2024-01-19 宜兴食品与生物技术研究院有限公司 Method for forming reversible membraneless organelle in microorganism

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103097412A (en) * 2010-07-09 2013-05-08 克鲁塞尔荷兰公司 Anti-human respiratory syncytial virus (RSV) antibodies and methods of use
CN105085641A (en) * 2015-09-18 2015-11-25 中国水产科学研究院黄海水产研究所 Cytomembrane positioning signal peptide and coding sequence and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103097412A (en) * 2010-07-09 2013-05-08 克鲁塞尔荷兰公司 Anti-human respiratory syncytial virus (RSV) antibodies and methods of use
CN105085641A (en) * 2015-09-18 2015-11-25 中国水产科学研究院黄海水产研究所 Cytomembrane positioning signal peptide and coding sequence and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAIYAN JIA等: "Cysteine-Rich and Basic Domain HIV-1 Tat Peptides", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 *
M.HUSAIN等: "ACCESSION:AAG32109", 《GENBANK》 *
MITOLA S等: "Identification of Specific Molecular Structures of Human", 《JOURNAL OF VIROLOGY》 *
王望九等: "《医学生物学》", 30 November 2008 *
王海珍等: "TAT-EGFP融合蛋白的表达及在PC12细胞的转导活性", 《第四军医大学学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109575116A (en) * 2018-11-09 2019-04-05 广东海洋大学 A kind of mitochondria positioning leads peptide and its discovery method and application
CN109575116B (en) * 2018-11-09 2022-04-22 广东海洋大学 Mitochondrial localization leader peptide and discovery method and application thereof
CN117417407A (en) * 2023-10-20 2024-01-19 宜兴食品与生物技术研究院有限公司 Method for forming reversible membraneless organelle in microorganism

Also Published As

Publication number Publication date
CN107056899B (en) 2020-07-17

Similar Documents

Publication Publication Date Title
CN111499765B (en) Coronavirus fusion protein and preparation method and application thereof
KR20210102882A (en) Nucleic acid constructs and methods of use
US20030211590A1 (en) Fusion protein for use as vector
Yan et al. Multiple regions of NSR1 are sufficient for accumulation of a fusion protein within the nucleolus.
CA2143308A1 (en) Translocation signal facilitated nuclear delivery of macromolecules
US10000541B2 (en) Trail cell-penetrating peptide-like mutant MUR6 and preparation method thereof
CN109929839B (en) Split type single base gene editing system and application thereof
CN108752425A (en) The method for building cell-penetrating peptide expression library using display technique of bacteriophage
KR20030074702A (en) Modular transfection systems
CN107056899A (en) A kind of cell membrane localization signal peptide and its encoding gene and application
CN114317609A (en) Viral vectors and uses thereof
CN101343327A (en) Antiviral protein and uses thereof
Sloots et al. Recombinant derivatives of the human high‐mobility group protein HMGB2 mediate efficient nonviral gene delivery
CN114560915A (en) Modified high-titer SARS-CoV-2 pseudovirus
US10000552B2 (en) TRAIL cell-penetrating peptide-like mutant MuR5 and preparation method thereof
CN112279921A (en) Complexes for intracellular delivery of molecules
CN109055416A (en) A kind of preparation method of soluble recombinant protein
CN114057861A (en) Bio-PROTAC artificial protein targeting UBE2C
CN109207488B (en) Construction method and application of PE38KDEL gene expression plasmid mediated by tumor specific promoter
CN110372780B (en) Antitumor polypeptide and application thereof in antitumor field
CN105622732B (en) Simian virus 40 capsid protein VP1 is as the application in cell-penetrating albumen
TWI515203B (en) Nuclear localization signal peptides derived from vp2 protein of chicken anemia virus and uses of said peptides
CN109942715A (en) A kind of recombination fusion protein of targeting therapy on tumor and its preparation method and application
CN108379596A (en) Hirudin targeting positioning release gene delivery system and its preparation method and application
CN113388008B (en) Endoplasmic reticulum targeted self-release protein transport carrier LCA2 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant