CN111718956A

CN111718956A - Preparation method and application of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid

Info

Publication number: CN111718956A
Application number: CN202010607204.7A
Authority: CN
Inventors: 郭慧君; 李宏梅; 周金润
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2020-06-30
Filing date: 2020-06-30
Publication date: 2020-09-29
Anticipated expiration: 2040-06-30
Also published as: CN111718956B

Abstract

The invention discloses a preparation method and application of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid. The invention obtains pMD18-T-ChTRIM25 by connecting chicken-derived TRIM25 gene amplification products into pMD18-T vector; then, a pEGFPC1 vector and pMD18-T-ChTRIM25 are respectively digested by BamH I and EcoRI, the pEGFPC1 vector and the fragment of ChTRIM25 containing a promoter are recovered and are connected by T4-ligase, recombinant plasmids are extracted, and the chicken-derived TRIM25 gene recombinant fluorescent expression plasmids are constructed through restriction enzyme digestion identification. The recombinant fluorescent expression plasmid constructed by the invention can be used for researching the functions of chicken TRIM25 and preparing anti-RNA virus transgenic chickens.

Description

Preparation method and application of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid

Technical Field

The invention relates to the technical field of bioengineering, in particular to a preparation method and application of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid.

Background

Since the first member of the TRIM family of proteins, Xenopus laevis nuclear factor 7, was cloned and identified in 1991, nearly 80 TRIM family proteins have been found in the human genome. TRIM family proteins are also called zinc finger proteins due to their specific RBCC (RING/B-box/coiled-coil) structure. From N-to C-terminus, the RING domain begins, one or two B-box domains in the middle, and a coil-coiled domain at the C-terminus. Members of the TRIM family play important physiological roles in numerous biological processes such as cell differentiation, proliferation, development, apoptosis and the like, and particularly have a limiting role on retroviruses in a series of biological processes of natural immunity.

The TRIM25 protein is one of the TRIM protein families belonging to the C-IV subfamily, and has a RING, B-box, woven-coil (RBBC) domain typical of the TRIM protein family at the N-terminal and a PRY/SPRY domain at the C-terminal. It is expressed primarily in female reproductive organs (uterus, ovary and breast) as well as in breast and ovarian cancers; in addition, TRIM25 protein has been found to play an important role in the re-immune-related signaling pathway and antiviral immune response, for example, it can inhibit the replication of RNA viruses such as human HIV, murine leukemia virus, avian leukemia virus and B-type hepatitis B virus in cells by participating in innate anti-RNA viral response in the body.

The chicken TRIM25 whole gene is firstly reported in 2015, the full-length cDNA of chicken TRIM25 is cloned, and fluorescent quantitative detection finds that the TRIM25 protein has high content in immune tissues of chicken such as thymus, bursa of fabricius, lung and the like. Comparison revealed that the homology of chicken TRIM25 protein to human and mouse TRIM25 was only 47.6% and 45.7%, respectively (Feng et al, 2015). Furthermore, the changes in the expression level of TRIM25 protein in Chicken Embryo Fibroblasts (CEF) stimulated by Poly (I: C) or Poly (dA: dT) after infection with Newcastle Disease Virus (NDV) in vitro and in vivo were also analyzed. Due to the particularity of immune organs of chickens, little is known about the functions and action mechanisms of the TRIM25 of chickens, and further intensive research is urgently needed.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide a chicken-derived TRIM25 gene recombinant fluorescent expression plasmid. The recombinant fluorescent expression plasmid can be used for researching the functions of the chicken TRIM25 and preparing anti-RNA virus transgenic chickens.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a preparation method of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid, which comprises the following steps:

(1) extracting RNA in chicken spleen tissue cells, carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by using the primers shown by SEQ ID NO.1 and SEQ ID NO.2 by using the cDNA as a template to obtain a chicken-derived TRIM25 gene amplification product with the size of 1881 bp;

(2) connecting the chicken-derived TRIM25 gene amplification product obtained in the step (1) into a pMD18-T vector to obtain pMD18-T-ChTRIM 25; then, a pEGFPC1 vector and pMD18-T-ChTRIM25 are respectively digested by BamH I and EcoRI, the pEGFPC1 vector and the fragment of ChTRIM25 containing a promoter are recovered and are connected by T4-ligase, recombinant plasmids are extracted, and the recombinant fluorescent expression plasmids of chicken source TRIM25 genes with the size of about 6500bp are constructed through restriction enzyme digestion identification.

Preferably, in step (1), the PCR amplification system is 25. mu.L, and comprises 2. mu.L of cDNA template, 1.0. mu.L of each of primers shown in SEQ ID NO.1 and SEQ ID NO.2, 2 × EsTaq Master Mix 12.5. mu.L, ddH₂O 8.5μL。

Preferably, in step (1), the PCR amplification conditions are: 4min at 94 ℃; 30s at 94 ℃; at 58 ℃ for 30 s; circulating for 37 times at 72 ℃ for 1min50 s; 72 ℃ for 6 min.

Preferably, in the step (3), the temperature of T4-ligase ligation is 23 ℃ and the ligation time is 2 h.

In a second aspect of the invention, a chicken-derived TRIM25 gene recombinant fluorescent expression plasmid constructed by the above method is provided.

The third aspect of the invention provides an application of the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid in chicken TRIM25 overexpression research.

The fourth aspect of the invention provides an application of the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid in preparation of anti-RNA virus transgenic chickens.

The invention has the beneficial effects that:

the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid is constructed, can be used for researching the functions and the application of chicken TRIM25, and can also be used for preparing anti-RNA virus transgenic chickens.

Drawings

FIG. 1: the construction and identification of chicken-derived TRIM25 gene recombinant fluorescence expression plasmid (ChTRIM25-GFP) are carried out; wherein, A: amplification of the target gene of the chicken TRIM25 open reading frame (Lane M1, DNA marker;

Lane

1 and 2, chicken TRIM25 target gene, 1881 bp); b: enzyme digestion identification of recombinant cloning vector containing chicken TRIM25 gene (Lane M1 and M2, both DNAmarker; Lane 3 and Lane 4, cloning vector TRIM25-T double enzyme digestion); c: recombinant overexpression plasmid containing chicken TRIM25 and GFP gene (Lane M3, DNAmarker; Lane 5, TRIM 25-GFP; Lane 6, TRIM25-GFP single cleavage); d: intracellular green fluorescence signals after DF1 cells are transfected by TRIM25-GFP plasmids; e: change in TRIM25mRNA transcript levels after DF1 cells transfected with TRIM25-GFP plasmid (×, between-group differential significance P < 0.01); f: intracellular TRIM25 protein level expression was changed after DF1 cells were transfected with TRIM25-GFP plasmid.

FIG. 2: DF1 cell chicken TRIM25 overexpression has inhibition effect on ALV-A virus replication; wherein, dpi, days after chicken TRIM25 overexpression plasmid inoculation; ALV-A/K virus titer in DF1 cell supernatant was calculated using IDEXX ALV P27 antigen ELISA kit assay; (. P < 0.01).

FIG. 3: DF1 cell chicken TRIM25 overexpression has inhibition effect on ALV-K virus replication; wherein, dpi, days after chicken TRIM25 overexpression plasmid inoculation; ALV-A/K virus titer in DF1 cell supernatant was calculated using IDEXX ALV P27 antigen ELISA kit assay; (. P < 0.01).

FIG. 4: the live body imaging system observes a GFP fluorescence signal image in each tissue of the shelled chicks.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As described in the background section, since homology between chicken TRIM25 protein and human and mouse TRIM25 is only 47.6% and 45.7%, respectively, and due to the particularity of chicken immune organs, little is known about functions and action mechanisms of chicken TRIM25, and further intensive research is needed.

The green fluorescent protein gene (gfp) as a reporter gene does not need the participation of a substrate, an inducer and the like, is non-toxic and harmless, can be autonomously expressed and spontaneously generates fluorescence in heterologous cells, can be simply and sensitively dynamically detected, overcomes the defects that the traditional reporter gene has high cost and complicated operation and cannot reflect the real process in vivo, and is an ideal reporter gene. Therefore, the construction of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid is very beneficial to the research of functions and action mechanisms of chicken TRIM 25. However, no recombinant fluorescent expression vector constructed by the chicken TRIM25 gene is available at present. The protein is constructed by human or other mammal TRIM25 gene, and the obtained TRIM25 protein has great structural difference (homology is less than 60%) with the chicken TRIM25 protein expressed by the invention.

Based on the above, the invention designs and constructs a chicken-derived TRIM25 gene recombinant fluorescent expression plasmid for researching the functions and action mechanisms of chicken TRIM 25.

Although there are many reports on the construction of recombinant expression vectors, there are still many technical difficulties for the construction of the fluorescent expression plasmid of chicken-derived TRIM25 gene recombination, specifically:

firstly, for the selection of the length of the target gene segment of the linked vector, if the length of the target gene segment is too long, on one hand, amplification errors are easy to occur in the PCR amplification process, and on the other hand, the difficulty of loading the vector is increased due to the too long length; however, if the length of the target gene fragment is too short, the main functional region of the coding region cannot be covered, and thus the research value of the target gene is lost.

The length of the target gene fragment of the selected ligation vector is 1881bp (the specific sequence is shown as SEQ ID NO. 3), and the gene fragment can encode the complete chicken TRIM25 protein and has stronger biological activity such as antiviral function, ubiquitination activity and the like.

Second, the design of primers for specific amplification of a target gene by PCR is a crucial part, and the use of inappropriate primers is liable to cause assay failure. Furthermore, in the construction of recombinant plasmids, it is not only simple PCR amplification but also subsequent ligation of the desired fragment to an expression vector, and therefore, the addition of restriction enzyme cleavage sites is also considered in the design of primers. The invention carries out optimization design on the amplification primer, the adopted primer can accurately and completely amplify the 1881bp target gene fragment connected into the vector, and the subsequent connection of the target fragment and the expression vector is convenient.

Thirdly, the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid (ChTRIM25-GFP) constructed by the invention stably expresses a GFP gene and a chicken TRIM25 gene at the same time, and the expression of the chicken TRIM25 gene is displayed through fluorescent protein gene expression in the application process, which needs to be solved by selecting proper connecting parts and ligase.

Fourthly, in the application process, chicken-derived cells (lines) and chicken embryos are also selected to carry out application research, and proper transfection reagents and approaches such as liposome, lentiviral vector and the like are selected to transfect into the chicken-derived cells or the chicken embryos.

In the construction process of the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid, firstly, a target gene fragment (1881bp) with a specific length is obtained through amplification, then the target gene fragment is connected with a pMD18-T vector to obtain a large number of plasmids containing the chicken TRIM25 gene, more chicken TRIM25 genes can be obtained, and then the positive recombinant vector obtained by connecting the vector with pEGFPC1 is enough, and the screening of positive plasmids or thalli is easy; if the target gene fragment is directly connected with the vector pEGFPC1, the recombinant expression vector ChTRIM25-GFP formed by direct connection is few, and a positive plasmid is difficult to obtain during screening.

The chicken-derived TRIM25 gene recombinant fluorescent expression plasmid finally constructed by the invention can stably express GFP gene and chicken TRIM25 gene at the same time, and the expression of the chicken TRIM25 gene is displayed through fluorescent protein gene expression in the application process; moreover, the plasmid constructed by the invention is stably expressed in chicken-derived cells and chicken embryos, and is a biological material with very good function for researching chicken TRIM 25.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments. If the experimental conditions not specified in the examples are specified, the conditions are generally conventional or recommended by the reagent company; reagents, consumables, and the like used in the following examples are commercially available unless otherwise specified.

Example 1:

1. designing a primer:

the present invention designs primers containing all key domains based on the published TRIM25 gene sequence (NM — 001318458.1), and adds enzyme cleavage sites according to the expression vector to be inserted. The sequences of the primers synthesized are shown below:

F：5’-GGAATTCTGATGAGCGGGAGAATGGCGACG-3’；(SEQ ID NO.1)

R：-5’-GGATCCCGAAAATAACCAGAAGGCAGGGTACAC-3’。(SEQ ID NO.2)

2. extraction of tissue RNA:

taking spleen of 2-week-old kalanchoe brown chicks under aseptic low-temperature conditions, cutting into pieces, grinding with liquid nitrogen, picking about 40mg, placing the pieces in a 1.5mL EP tube without RNase, adding 1mL of Trizol, blowing, uniformly mixing, cracking at room temperature for 6min, adding chloroform with the volume 0.4 times that of the Trizol, oscillating for 20s, standing for 3min, centrifuging at the constant temperature of 12000rpm (13400 × g) for 10min at 3 min.4 ℃, taking an upper aqueous phase, adding isopropanol with the same volume as that of the aqueous phase into the aqueous phase solution, oscillating in a vortex, uniformly mixing, centrifuging, discarding a supernatant, washing and precipitating, preparing 75% ethanol by DEPC water, adding ethanol with the volume 1 time that of the Trizol, centrifuging for 2min at the constant temperature of 12000rpm (13400 × g), discarding the supernatant, standing for 3min after uncovering, dissolving 50-100 mu L of DEPC water in the precipitate, placing the precipitate in a refrigerator at-80 ℃, standing for standby, observing_260nm、OD_280nmAnd (4) calculating the absorbance value, calculating the ratio of the absorbance values, identifying the RNA quality of the sample, and storing at-80 ℃ for later use.

3. Reverse transcription synthesis of chicken TRIM25 cDNA:

reverse transcriptase 5 × FastKing-RT SuperMix 4.0 μ L, RNase-Free ddH₂O15.0. mu.L and 1.0. mu.L of template RNA were dissolved on ice, centrifuged briefly before use and mixed well. After 20 mul of system is mixed evenly, a PCR instrument is added for reverse transcription operation, and the reaction procedure is as follows: at 42 ℃ for 15min and at 95 ℃ for 3min, and thenAfter the reaction is finished, the product is stored at the temperature of minus 20 ℃.

4. Amplification of chicken TRIM25 Gene:

the TRIM25-GFP primers (SEQ ID NO.1 and SEQ ID NO.2) were briefly centrifuged and diluted, and then 25. mu.L of PCR amplification system (cDNA template 2. mu.L, primers shown in SEQ ID NO.1 and SEQ ID NO.2 each 1.0. mu.L, 2 × EsTaq Master Mix 12.5. mu.L, ddH) was performed using chicken spleen genomic DNA as a template₂O8.5 μ L), and PCR amplification conditions: 4min at 94 ℃; 30s at 94 ℃; at 58 ℃ for 30 s; circulating for 37 times at 72 ℃ for 1min and 50 s; 72 ℃ for 6 min. And (5) carrying out electrophoresis identification on the 1.5% agarose gel. The results are shown in FIG. 1A. As can be seen from FIG. 1A, the amplified PCR product was electrophoresed through agarose gel, and a band of 1881bp in size was ChTRIM25 gene (the sequence is shown in SEQ ID NO. 3).

5. Construction and verification of chicken-derived TRIM25 gene recombinant fluorescence expression plasmid (ChTRIM25-GFP)

Cutting a positive strip gel block containing a target fragment ChTRIM25 after gel electrophoresis, recovering, connecting with a pMD 18-Tprime carrier to obtain a recombinant connecting carrier pMD18-T-ChTRIM25, further transforming to DH5 alpha competent cells, selecting white colonies with good state and smooth edges, inoculating the white colonies into a test tube containing 5mL of LB liquid culture medium (50 mu g/mL Amp +), shaking for 8h at 37 ℃, extracting recombinant plasmids by using a DNA plasmid kit, carrying out double digestion identification on the recombinant plasmids by using BamH I and EcoRI, carrying out digestion reaction for 4h at 37 ℃, taking 2 mu L of 10 XLoading Buffer to terminate the digestion reaction, and carrying out 1% agar gel electrophoresis verification on the digestion products. The results are shown in FIG. 1B.

After the concentration of the enzyme digestion product is measured, the enzyme digestion product is connected with a pEGFP-C1 vector recovery product of the same operation (double enzyme digestion of BamH I and EcoRI) at 23 ℃ for 2h, and is transformed into TOP10 competent cells, the above-mentioned strain selection, enlarged culture and enzyme digestion sequencing are repeatedly carried out, and the electrophoresis verification result is shown in figure 1C. Carrying out amplification culture on the strain, extracting plasmids according to an endotoxin-free plasmid extraction box to obtain the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid (ChTRIM25-GFP) which is successfully constructed, and freezing and storing at 20 ℃.

The extracted endotoxin-free plasmid was quantified using a spectrophotometer and diluted to working concentration using Opti-MEM. Meanwhile, DF-1 cells are all paved on a six-hole plate, when the cell coverage rate reaches 70% -80%, the ChTRIM25-GFP plasmid and the transfection reagent lipo3000 are mixed according to the proportion of 1: DF-1 cells were mixed and transfected at a ratio of 2, and 6 hours after transfection, cell supernatants were removed and culture was continued using a medium with a 1% serum concentration. At 12h intervals, the expression of GFP green fluorescence in the cells was observed by inverted fluorescence microscopy. The results are shown in FIG. 1D. Detection of a GFP green fluorescence signal indicates expression of fluorescent protein in ChTRIM 25-GFP.

Detecting the change of the transcription level of the chicken TRIM25mRNA by fluorescent quantitative RT-PCR: collecting transfected cells with positive fluorescence signals, grinding with liquid nitrogen, extracting total RNA of the cells according to an RNA extraction kit after treatment, immediately performing concentration determination on the obtained RNA, mixing reverse transcriptase and sterile water according to different concentrations to 20 mu L, and performing reverse transcription to obtain cDNA at 42 ℃ for 15min and 95 ℃ for 3min according to reaction conditions. And (3) after briefly centrifuging the synthesized quantitative primer, diluting the primer by using sterile water, and premixing the primer by using a 20-mu-L reaction system, wherein the premixing system is as follows:

SYBR MIX 10.5μL

cDNA 1μL

ddH₂O 7.5μL

Forward-Primer(5’-TACAACCACCACCCTCA-3’)0.5μL

Reverse–Primer(5’-GATGCCAATGCCACAG-3’)0.5μL。

the PCR reaction program is: 10min at 95 ℃; 15S at 95 ℃, 60S at 60 ℃ and 40 cycles; the relative expression level was calculated by the delta-delta Ct method with addition of the melting curve. The results are shown in FIG. 1E. A significant increase compared to the blank and GFP empty plasmids indicates efficient transcription of the ChTRIM25 mRNA.

The WB method verifies that ChTRIM25 protein expression: the cells were collected, added to an IP cell lysate containing 1% PMSF, and digested at 4 ℃ for 30 min. And (3) carrying out ultrasonic crushing at an interval of 1S for 3 times, and repeating the steps at an ultrasonic power of 200W. The supernatant was collected by centrifugation at 12000rpm (13400 Xg) at 4 ℃ for 10 min. Cellular protein and SDS protein loading buffer the following 4: 1, mixing with 15 μ L of the mixture, boiling in boiling water for 7min, centrifuging at 4 deg.C and 12000rpm (13400 × g) for 10min, immediately placing on ice block, and rapidly cooling (to make protein denatured and not renatured) for use. 5% of upper layer concentrated glue and 12% of lower layer separation glue are prepared. After sample addition, electrophoresis was performed according to 70V 50A1h, 90V 50A 1-1.5 h. After the electrophoresis is finished, the PVDF membrane is activated by methanol, a gel block containing the target band is cut and covered on the membrane, the membrane is switched according to the current from negative to positive, the membrane switching current is kept at 200A, and the time is 2-2.5 h. After the membrane transfer is finished, preparing 5% bovine serum albumin from TBST eluent, oscillating and incubating the PVDF membrane at room temperature for 2h to further seal the foreign protein, and oscillating and eluting for 4 times (7 min each time) by TBST after the incubation is finished. The ChTRIM25 murine antibody was mixed with primary antibody dilutions at a ratio of 1: the PVDF membrane was diluted at 2000 ℃ and immersed after elution, and left overnight at 4 ℃. The PVDF membrane was removed and eluted 4 times with TBST shaking for 7min each time. HRP-labeled murine secondary antibody was reacted with TBST according to 1: the PVDF membrane after dilution at 2000 ℃ and immersion washing is incubated for 1.5h at 37 ℃. The PVDF membrane was removed and eluted 4 times with TBST shaking for 7min each time. ECL (ethylene-vinyl acetate) ultra-sensitive developing kit, wherein developing solutions A and B are mixed according to the ratio of 1: 1 after mixing, the protein bands were revealed by exposure in a protein imaging machine. The results are shown in FIG. 1F. As a result, a specific positive band which is over-expressed relative to an empty plasmid control appears, and the ChTRIM25 protein is effectively expressed.

Application example 1:

the verified ChTRIM25-GFP plasmid was assayed for concentration, diluted to working concentration and stored at-20 ℃.

Culturing DF-1 cells by a six-hole plate, transfecting ChTRIM25-GFP plasmid when the coverage rate reaches 70% -80%, maintaining the transfection for 6h, washing cell supernatant by PBS, and maintaining for 24 h.

ALV-A virus was inoculated, incubated for 2h, and then PBS was used to wash out cell supernatants and maintained in growth medium or maintenance medium for 72 h. Cell supernatants and cells were removed and ALV-A viral titers and viruses were isolated using ALV P27 antigen ELISA and IFA. The results are shown in FIG. 2.

Application example 2:

ALV-K virus was inoculated, incubated for 2h, and PBS was used to wash the cell supernatant for 72h in growth medium or maintenance medium. Cell supernatants and cells were taken and ALV-K viral titers and viruses were isolated using ALV P27 antigen ELISA and IFA. The results are shown in FIG. 3.

Application example 3:

preparing chicken embryos: 120 SPF chick embryos are purchased and placed in a full-automatic incubator for incubation. The eggs are monitored by an egg candler every day, and dead embryos and unrefined embryos are removed.

Preparation of ChTRIM25-GFP Lentiviral vectors: construction of recombinant vector 5. mu.L (10. mu.L) Using ChTRIM25-GFP plasmid and Lentiviral vector⁸TU/mL) and 5. mu.L ploybrene transfection enhancer (20. mu.g/mL) were mixed and left to stand at room temperature for use;

yolk sac injection: placing the chick embryo air chamber end upwards on an egg tray, respectively sterilizing the air chamber part by using 3% iodine tincture and 75% ethanol, then drilling a small hole at the center of the chick embryo air chamber by using an alcohol-sterilized puncher, and then injecting a two-thirds of ChTRIM25-GFP lentiviral vector transfection mixed solution into the chick embryo yolk sac by using an autoclaved microinjector to needle insertion from the small hole in a mode of facing downwards vertically to a table surface; and (3) sterilizing the small holes of the transfected chick embryos by using 3% iodine tincture and 75% ethanol, immediately sealing the small holes by using melted paraffin, and continuously placing the chick embryos in a full-automatic incubator for incubation.

And randomly extracting 2 chickens in each group after the chick embryos are grown for 3 days after the chick embryos are shelled, and observing GFP fluorescent signals in each tissue of the shelled chicks by using a living body imaging system. The results are shown in FIG. 4.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong university of agriculture

<120> preparation method and application of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid

<130>2020

<160>5

<170>PatentIn version 3.5

<210>1

<211>30

<212>DNA

<213> Artificial sequence

<400>1

ggaattctga tgagcgggag aatggcgacg 30

<210>2

<211>33

<212>DNA

<213> Artificial sequence

<400>2

ggatcccgaa aataaccaga aggcagggta cac 33

<210>3

<211>1881

<212>DNA

<213> Artificial sequence

<400>3

agcgggagaa tggcgacgtt gaccaaagct cagtcggagc cgaatctgtt ggcgctggag 60

gaggacctga cgtgctccat ctgcctcagc atcttcgacg cccccgtgac ggtgccctgc 120

gggcacaact tctgtgccta ctgcctggag caaacctggg ccagccaggt gcgggacttc 180

agctgcccgc agtgccgcac caccttcccg gaccgcccgc agctccacaa gaacacggtg 240

ctgtgccggg tggtggagca gctgcagggc tgcggggacg ggaaggagga cgatgagcac 300

gaggaggaag agcaggaggc ggcagccccc atctactgcg acagttgtct gcaagcggcc 360

gccacgcaga cctgcctcac ctgcatggcc tccttctgcc ccgagcacct gcggccgcac 420

tacgacagcc cggccttccg ccaccatcag ctgtgcccgc ccgtgcggga cctgcagcag 480

aggaagtgcc cgcagcacaa caagctcttt gagttcttct gcagccagca cagctgctgc 540

atctgctcgc tctgcctgct gagccacaag ctgtgccaca ccagcccgct gcagcaggcc 600

aaagacaacg ctgagtcagc actgaagaag aggctggcag agctgcacaa tcagagtgaa 660

agatctgtgc aagcaatgaa ctctgtgaaa acaatccaaa gacaagctgc tgagacagct 720

gccagaaagc gagatttgctgagagctgag tttttggaaa ttaaagcttt aattgaagaa 780

aaagaaaacc agaccctaaa agtatttatg gaagaagaaa aaagagtttg caataagttt 840

gattacgtat ataaaattct gggaaataag aagaatgaaa ttcagtctct gagagaccag 900

attgagatgg cactgactga aggtgatgac gttctctttt taaagagagc agcagcgctg 960

caacgaacat caataaaaga ggcttttgtc ccagtaattg aaatggacaa caacatgata 1020

catgctgctt atcagtctgc cattaacctt aaagatgttg tcaaacttgc agtgaatgtg 1080

tctgtggata aaagaacgga tgcaaaacca ccacctggga aaacaaagcc tccttcagtg 1140

ccttccccaa acaaacccgt tgttaaaaaa aagcttgctg cagactcacg tacccacaaa 1200

gacaaaatcc ctcacccaac taaaaccact ctgctggagg agacagatac ccaagacaaa 1260

aggaatcctg ttaaacttgc accaagcatg ggagcaccaa gcatgggagc accaagcgct 1320

gcaaatgctg ctaaagtgaa agaacttatt agcagcttcc tgaaaaaacc cagagcggag 1380

cttttgcagt atgctgctaa cgtcacgctg gatttcaaca cagctcacag caaagtggct 1440

ctgtctgaga gatacaccaa gatgtctgtt tcagacaccc aactgaatta caaccaccac 1500

cctcagcgtt tcaccgactg cccccaggtg ctggggttcc agtgcttcaa gagaggcatc 1560

cactactggg aagtggaaat gcagcagaac aacttctgtg gcattggcat ctgctatggc 1620

agcatggagc ggcaggggcc ggacagccgc ctgggtagga acagcagttc ttggtgtatc 1680

gagtggttta attccaaaat ttcagcctgg cataatgatg ttgaaaagtg cttacccaat 1740

acaaaggcca ctaagattgg tgtgctgctc cactgtgatg gagggttcgt gcttttcttg 1800

actgttgagg aaaagcttaa tttgatctat aaattcaaag cccagtttac tgaagctgtg 1860

taccctgcct tctggttatt t 1881

<210>4

<211>17

<212>DNA

<213> Artificial sequence

<400>4

tacaaccacc accctca 17

<210>5

<211>16

<212>DNA

<213> Artificial sequence

<400>5

gatgccaatg ccacag 16

Claims

1. A preparation method of chicken-derived TRIM25 gene recombinant fluorescent expression plasmid is characterized by comprising the following steps:

(1) extracting RNA in chicken histiocyte, carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by using the cDNA as a template and primers shown by SEQ ID NO.1 and SEQ ID NO.2 to obtain chicken-derived TRIM25 gene amplification product with the size of 1881 bp;

(2) connecting the chicken-derived TRIM25 gene amplification product obtained in the step (1) into a pMD18-T vector to obtain pMD18-T-ChTRIM 25; then, a pEGFPC1 vector and pMD18-T-ChTRIM25 are respectively digested by BamH I and EcoRI, the pEGFPC1 vector and the fragment of ChTRIM25 containing a promoter are recovered and are connected by T4-ligase, recombinant plasmids are extracted, and the chicken source TRIM25 gene recombinant fluorescent expression plasmids are constructed through restriction enzyme digestion and identification.

2. The recombinant fluorescent expression plasmid of chicken-derived TRIM25 gene constructed by the method of claim 1.

3. The chicken-derived TRIM25 gene recombinant fluorescent expression plasmid of claim 2, and application thereof in chicken TRIM25 overexpression research.

4. The application of the chicken-derived TRIM25 gene recombinant fluorescent expression plasmid of claim 2 in preparing anti-RNA virus transgenic chicken.