CN114807163B

CN114807163B - Application of TaSBE I Gene in Promoting Wheat Starch Synthesis

Info

Publication number: CN114807163B
Application number: CN202210310071.6A
Authority: CN
Inventors: 李鸽子; 康国章; 王鹏飞; 柳海涛; 韩巧霞; 刘国芹; 葛强
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2022-03-28
Filing date: 2022-03-28
Publication date: 2023-08-25
Anticipated expiration: 2042-03-28
Also published as: CN114807163A

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a TaSBEI gene in promoting wheat starch synthesis. The TaSBEI gene can improve the starch content and thousand seed weight of wheat seeds, influence the chain length distribution of wheat amylopectin, improve the branching degree of the wheat amylopectin, increase the branching number of the wheat amylopectin and is beneficial to improving the cooking quality related to the amylopectin of Gao Xiaomai seeds.

Description

Application of TaSBE I gene in promoting wheat starch synthesis

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a TaSBEI gene in promoting wheat starch synthesis.

Background

Wheat (Triticum aestivum L.) provides ration for about 1/3 of the world's population, and is one of the most important food crops worldwide (He M, zhu C, dong K, et al, comparative proteome analysis of embryo and endosperm reveals central differential expression proteins involved in wheat seed germination [ J ] BMC Plant Biology,2015,15 (1): 1-17.). Starch is a main constituent of wheat grain and accounts for about 75% of the total components of the wheat grain; starch exists mainly in the form of carbohydrates, which provide the human with the daily energy required. The appearance and mouthfeel of the pasta are affected by the starch content, the type (amylose, amylopectin, ratio of amylose to amylopectin) and physicochemical properties (gelatinization properties, swelling potential). In recent years, with the improvement of the living standard of people, more and more people have higher requirements on the quality of the food, so that the research on wheat starch is also more and more important.

Starch is divided into amylose and amylopectin according to different molecular structures, and the amylose and the amylopectin respectively account for 20% -35% and 65% -80% of the total starch content (Fang Xianwen, jiang Dong, dai Tingbo, and the like). Amylose and amylopectin both comprise a backbone of alpha-1, 4-glucose residues, but amylose is of lower molecular weight, typically between 105-106Da, with few branching points (less than 0.5% of alpha-1, 6 branching points); the amylose is mainly a polymer formed by connecting glucose molecules through alpha-1, 4-glycosidic bonds, is easy to dissolve in water to form a colloid solution, and is a type of starch which can be quickly digested and absorbed by human bodies; the branched polymer of amylopectin, which is mainly formed by linking glucose group through alpha-1, 4-glycosidic bond and alpha-1, 6-glycosidic bond, has a complex molecular structure similar to crotch (Jin Lichen, geng Zhiming, li Jinzhou, etc.. Rice starch composition and relationship between molecular structure and taste quality [ J ]. Jiangsu agricultural journal, 2011,27 (01): 13-18.), degree of polymerization (Degree of polymerization, DP), is not easily soluble in water, but swells to form paste when acted with hot water, and the solution becomes reddish purple when combined with iodine (Chen P, yu L, simon G P, et al International structures and phase-transitions of starch granules during gelatinization [ J ]. Carbohydrate Polymers,2011,83 (4): 1975-1983.). Among them, the chain of amylopectin can be divided into three categories: glucose in amylopectin is linked by alpha-1, 4-glycosidic bond to form straight chain without branch, called A chain; side chains formed on the A chain by alpha-1, 6-glycosidic linkages, called B chain; the other branched side chain with a reducing end, which is present on the B chain, is called the C chain. The non-random distribution of the linear chains and the regular ordering of the branching junction clusters require specific lengths for the A and B chains, and this structural difference can lead to differences in the grain crystal structure, further affecting the structure of the amylopectin branching clusters, and ultimately affecting the crystallinity, gelatinization properties and swelling properties etc. of the starch in the wheat grain (Baga M, glaze S, malgard CS, et al A starch branching enzyme gene in wheat produces alternatively spliced trans-carriers.plant Molecular Biology,1999,40:1019-1030;Mohan B H,Malleshi N G.Characteristics of native and enzymatically hydrolyzed common wheat (Triticum aestivum) and dicoccum wheat (Triticum dicoccum) starches [ J ]. European Food Research and Technology,2006,223 (3): 355-361 ]) and further affecting the quality of the pasta. However, few reports for researching wheat starch synthesis exist, and most of the reports only guess the functions of the wheat starch, and the functions cannot be effectively verified.

Disclosure of Invention

The invention aims to provide an application of a TaSBE I gene in promoting wheat starch synthesis, improving the starch and thousand seed weight of wheat and improving the quality of amylopectin.

The invention provides an application of TaSBE I gene in promoting wheat starch synthesis;

the nucleotide sequence of the TaSBE I gene is shown as SEQ ID NO. 1.

Preferably, the wheat starch comprises wheat amylopectin.

The invention also provides application of the TaSBE I gene in culturing transgenic plants with high starch and/or high thousand seed weight;

the nucleotide sequence of the TaSBE I gene is shown as SEQ ID NO. 1.

Preferably, the transgenic plant comprises wheat.

The invention provides an application of TaSBE I gene in improving the quality of plant amylopectin;

the nucleotide sequence of the TaSBE I gene is shown as SEQ ID NO. 1.

The invention provides a method for cultivating transgenic wheat, which is characterized in that the gene shown in SEQ ID NO.1 is overexpressed in wheat.

The TaSBE I gene participates in wheat starch synthesis, can increase thousand grain weight, total starch content and amylopectin content of wheat grains, is obviously higher than that of wild plants, reduces the ratio of wheat amylose to amylopectin, improves the swelling potential and gelatinization characteristics of grain starch, such as peak viscosity, loose value, low valley viscosity, rebound value and gelatinization time, improves the branching degree of grain amylopectin, increases the branching number of wheat amylopectin, and is beneficial to improving the cooking quality related to Gao Xiaomai grain amylopectin.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.

FIG. 1 shows the results of PCR amplification of gene TaSBE I;

FIG. 2 shows the result of the enzyme digestion detection of pWMB172-TaSBE I recombinant vector;

FIG. 3 is a map of the expression vector pWMB172-TaSBE I;

FIG. 4 shows the genetic transformation process of the overexpression vector pWMB172-TaSBE I;

FIG. 5 shows the PCR amplification result of Bar gene in transgenic plant;

FIG. 6 shows the results of PCR amplification of the TaSBE I gene in transgenic plants;

FIG. 7 is a transgenic line versus wild-type amylopectin chain length distribution;

FIG. 8 shows the branching degree of amylopectin of transgenic plants.

Detailed Description

the nucleotide sequence of the TaSBE I gene is shown as SEQ ID NO. 1.

The specific nucleotide sequence of the TaSBE I gene is

5' -ATGCTCTGCCTCACCGCCCCCTCCTGCTCGCCATCTCTCCCGCCGCGCCC CTCCCGTCCCGCTGCTGACCGGCCCGGACCGGGGATCTCGGGCGGCGGCAATGTGCGGCTGAGCGCGGTGCCCGCGCCCTCTTCGCTCCGCTGGTCGTGG CCGCGGAAGGCCAAGAGCAAGTTCTCTGTTCCCGTGTCTGCGCCAAGAGACTACACCATGGCAACAGCTGAAGATGGTGTTGGCGACCTTCCGATATACGA TCTGGATCCGAAGTTTGCCGGCTTCAAGGAACACTTCAGTTATAGGATGAAAAAGTACCTTGACCAGAAACATTCGATTGAGAAGCACGAGGGAGGCCTTG AAGAGTTCTCTAAAGGCTATTTGAAGTTTGGGATCAACACAGAAAATGACGCAACTGTGTACCGGGAATGGGCCCCTGCAGCAATGGATGCACAACTTATT GGTGACTTCAACAACTGGAATGGCTCTGGGCACAGGATGACAAAGGATAATTATGGTGTTTGGTCAATCAGGATTTCCCATGTCAATGGGAAACCTGCCATC CCCCATAATTCCAAGGTTAAATTTCGATTTCACCGTGGAGATGGACTATGGGTCGATCGGGTTCCTGCATGGATTCGTTATGCAACTTTTGATGCCTCTAAATT TGGAGCTCCATATGACGGTGTTCACTGGGATCCACCTTCTGGTGAAAGGTATGTGTTTAAGCATCCTCGGCCTCGAAAGCCTGACGCTCCACGTATTTACGA GGCTCATGTGGGGATGAGTGGTGAAAAGCCTGAAGTAAGCACATACAGAGAATTTGCAGACAATGTGTTACCGCGCATAAAGGCAAACAACTACAACACA GTTCAGCTGATGGCAATCATGGAACATTCATATTATGCTTCTTTTGGGTACC ATGTGACGAATTTCTTCGCAGTTAGCAGCAGATCAGGAACGCCAGAGGACCTCAAATATCTTGTTGACAAGGCACATAGTTTAGGGTTACGTGTTCTGATGG ATGTTGTCCATAGCCATGCGAGCAGTAATAAGACAGATGGTCTTAATGGCTATGATGTTGGGCAAAACACACAGGAGTCCTATTTCCACACAGGAGAAAGGG GCTATCATAAACTGTGGGATAGCCGCCTGTTCAACTATGCCAATTGGGAGG TCTTACGATTTCTTCTTTCTAATCTGAGATATTGGATGGACGAATTCATGTTTGATGGCTTCCGATTTGATGGGGTAACATCCATGCTATATAATCACCATGGTAT CAATATGTCATTCGCTGGAAGTTACAAGGAATATTTTGGTTTGGATACTGATGTAGATGCAGTTGTTTACCTGATGCTTGCGAACCATTTAATGCACAAACTCT TGCCAGAAGCAACTGTTGTTGCAGAAGATGTTTCAGGCATGCCAGTGCTTTGTCGGTCAGTTGATGAAGGTGGAGTAGGGTTTGACTATCGCCTGGCTATGG CTATTCCTGATAGATGGATCGACTACTTGAAGAACAAAGATGACCTTGAATGGTCAATGAGTGGAATAGCACATACTCTGACCAACAGGAGATATACGGAA AAGTGCATTGCATATGCTGAGAGCCATGATCAGTCTATTGTTGGCGACAAG ACTATGGCATTTCTCTTGATGGACAAGGAAATGTATACTGGCATGTCAGACTTGCAGCCTGCTTCGCCTACAATTGATCGTGGAATTGCACTTCAAAAGATGA TTCACTTCATCACCATGGCCCTTGGAGGTGATGGCTACTTGAATTTTATGGGTAATGAGTTTGGCCACCCAGAATGGATTGACTTTCCAAGAGAAGGCAACA ACTGGAGTTATGATAAATGCAGACGCCAGTGGAGCCTCGCAGACATTGATC ACCTACGATACAAGTACATGAACGCATTTGATCAAGCAATGAATGCGCTCGACGACAAATTTTCCTTCCTATCATCATCAAAGCAGATTGTCAGCGACATGAA TGAGGAAAAGAAGATTATTGTATTTGAACGTGGAGATCTGGTCTTCGTCTTCAATTTTCATCCCAGTAAAACTTATGATGGTTACAAAGTCGGATGTGACTTG CCTGGGAAGTACAAGGTAGCTCTGGACTCTGATGCTCTGATGTTTGGTGGA CATGGAAGAGTGGCCCATGACAACGATCACTTTACGTCACCTGAAGGAGTACCAGGAGTACCTGAAACAAACTTCAACAACCGCCCTAACTCATTCAAAA TCCTGTCTCCATCCCGCACTTGTGTGGCTTACTATCGCGTCGAGGAGAAAGCGGAAAAGCCCAAGGATGAAGGAGCTGCTTCTTGGGGGAAAACTGCTCTC GGGTACATCGATGTTGAAGCCACTGGCGTCAAAGACGCAGCAGATGGTGA GGCGACTTCTGGTTCCGAAAAGGCGTCTACAGGAGGTGACTCCAGCAAGAAGGGAATTAACTTTGTCTTTCTGTCACCCGACAAAGACAACAAATAA. The invention has no strict requirement on the source of the TaSBE I gene, and can be obtained by adopting an artificial synthesis or amplification mode.

The length of the nucleotide sequence of the TaSBE I gene is 2493bp, and the encoded protein can promote the synthesis of wheat amylopectin. Example results show that the TaSBE I gene is involved in wheat starch synthesis, affects wheat grain starch content and thousand kernel weight, and affects wheat grain amylopectin quality and characteristics. The results of the examples show that the TaSBE I gene can increase the thousand kernel weight of wheat kernels by 8.16-12.51%, increase the total starch content by 2.80-3.75%, increase the amylopectin content by 4.27-5.27%, and reduce the ratio of wheat amylose to amylopectin by 1.57-2.32%. Over-expression of the TaSBE I gene can influence the characteristics of the grain starch, and improve the swelling potential and gelatinization characteristics of the grain starch, such as peak viscosity, relaxation value, low valley viscosity, rebound value and gelatinization time; the branching degree of the amylopectin of the grains is improved, the branching number of the amylopectin of the wheat is increased, and the method is beneficial to improving the cooking quality related to the amylopectin of the Gao Xiaomai grains.

The invention also provides a method for cultivating transgenic wheat, which over-expresses TaSBE I gene in wheat. The method for over-expressing the TaSBE I gene is not strictly required, preferably, the TaSBE I gene is combined with an expression vector in a homologous recombination mode to obtain a recombinant vector, and the recombinant vector is transferred into target wheat to obtain transgenic wheat. The expression vector according to the invention is preferably a pMWB172 vector (Wang et al, plant Biotechnol J.2017, 15:61-623).

The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of TaSBE I overexpression vector

1. According to the map of the pMWB172 vector (provided by the national laboratory of Chinese agricultural sciences She Xing), an upstream primer TaSBE I-F and a downstream primer TaSBE I-R of TaSBE I are designed, and the nucleotide sequence of the upstream primer TaSBEI-F is shown as SEQ ID NO.2, specifically: 5'-TGCAGGTCGACTCTAGAGGA TCCCCGGG (Sma I) ATGCTCTGCCTCACCGCCCCCT-3'; the nucleotide sequence of the downstream primer TaSBE I-R is shown as SEQ ID NO.3, and specifically comprises the following steps: 5'-CGGGGAAATTCGAGCTC TCTAGAACTAGT (Spe I) TTATTTGTTGTCTTTGTCGGGT-3'. PCR amplification (pre-denaturation at 98 ℃ C., 5 min; denaturation at 98 ℃ C., 10s at then, annealing at 53 ℃ C., 20s at 72 ℃ C., total of 35 cycles; final extension at 72 ℃ C., 7min;16 ℃ C., preservation) was carried out using the above primers with the cDNA of Zheng wheat 7698 as a template, and agarose gel electrophoresis was carried out after the amplification was completed to detect the size of the amplified band, and the result was as shown in FIG. 1 (4 sets of PCR amplification were carried out). As can be seen from FIG. 1, the size of the amplified fragment was identical to the size of the objective gene TaSB EI (2493 bp), indicating that the PCR amplification was successful.

2. The single 2493bp fragment of interest (gel recovery kit, available from Tiangen) was recovered, while the Sma I and Spe I double digestion vector pMWB172 was used, as follows: 10. Mu.L (1 mg) of vector plasmid, 5. Mu.L of 10 Xrestriction buffer, 1. Mu.L of Sma I, 1.0. Mu.L of Spe I and ddH were taken ₂ The reaction system was replenished with O to 50. Mu.L and digested at 37℃for 2h. Separating the enzyme-digested product by agarose gel electrophoresis, and recovering the large fragment obtained after double enzyme digestion of the vector pMWB 172. Then, the PCR amplified target fragment of TaSBE I and the large vector fragment recovered by digestion of pMWB172 are connected by homologous recombination, and the specific process is as follows: the vector and the large fragment were taken, diluted to 10 ng/. Mu.L and 30 ng/. Mu.L, respectively, added with 2.0. Mu.L of the vector and 6.0. Mu.L of the fragment, then added with 0.75. Mu.L of homologous recombination ligase and 1.25. Mu.L of 10 Xligase buffer, mixed well, centrifuged, and ligated at 16℃for 1.5h. Then the ligation product was transformed into E.coli DH 5. Alpha. Competent cells, and E.coli was transformed. 5 single clones were randomly picked for expansion culture, plasmids were extracted using the Sma I and Spe I double restriction enzyme test using the Sma I and Spe I plasmid extraction kit, and the results are shown in fig. 2: double digestion of the target band excised from 5 plasmids, lanes 2,4 and 5, was consistent with the size of TaSBE I constructed into pMWB172 vector, double digestion confirmed that lanes 2,4 and 5 successfully constructed an overexpression vector of pMWB172-TaSBE I, with TaSBE I inserted between the SmaI and SpeI endonuclease sites of expression vector pMWB172, the map of the overexpression vector pMWB172-TaSBE I is shown in FIG. 3, comprising Dx5 (endosperm specific) promoter, taSBE I gene, and Nos (Agrobacterium rouge)Alkali synthase terminator).

Example 2

Acquisition and identification of TaSBE I transgenic wheat plants

(1) Acquisition of TaSBE I transgenic wheat plants

The wheat young embryo is transformed by adopting a gene gun method. The specific process is as follows: firstly, selecting young ears of wheat after flowering, and culturing the young ears at low temperature for about 1 week; separating wheat seeds and sterilizing the wheat seeds; young wheat embryos are peeled off by using sterilized forceps and a surgical knife and placed in a culture dish for standby. Meanwhile, bombarding the wheat embryo with a gene gun to obtain an overexpression vector pMWB172-TaSBE I in the example 1; the wheat young embryo culture process after bombardment is as follows: at N ₆ Dark culture at 25deg.C on induction culture medium (containing MS macroelement, MS microelement, 2,4-D, vitamin B5, etc.); transferring the young embryo with the callus onto differentiation medium (comprising MS, 2,4-D, MEG, G418, etc.), and culturing at 25deg.C for 12 hr in light/12 hr in dark; then, the receptor material with adventitious buds is transferred to a screening medium (comprising 1/2MS, NAA, G418 and the like), cultured at 25 ℃ in a growth room with 12h of light/12 h of darkness, the receptor material is rooted and positive seedlings are screened, the screened positive seedlings are transferred to a refrigerator for 14 days of vernalization culture and then transferred to soil for culture (Liu Huiyun, 2017, national institute of agricultural sciences, national institute of sciences and graduate). The growth process is shown in fig. 4.

(2) Identification of TaSBE I transgenic wheat plants

Extracting DNA of the T0 generation transgenic seedling in the step (1) by using a CTAB method (Li et al 2018) of a previous report method, detecting whether the transgenic TaSBEI contains a hygromycin (bar) gene or not by using a screening marker gene hygromycin primer, and designing the primer as F (SEQ ID NO. 4): 5'-ACCATCGTCAACCACTACATCG-3'; r (SEQ ID NO. 5): 5'-GCTGCCAGAAACCACGTCATG-3', the detection result is shown in fig. 5, wherein fig. 5 sequentially shows M from left to right: DL2000; p: pWMB172-TaSBE I plasmid; WT: zhengmai 7698;1-16: a TaSBE I transgenic line; h: negative control. As can be seen from FIG. 5, the other test plants except for Wild Type (WT) and negative control (H), transgenic line 9, contained hygromycin gene. It was demonstrated that these lines carried the selectable marker gene of the over-expression vector.

On this basis, an upstream forward primer F (SEQ ID NO. 6) was designed at the time of inserting the target gene: 5'-CAGTGGAGCCTCGCAGACATTG-3', downstream reverse primer R (SEQ ID NO. 7) was designed on the vector: 5'-TGCGGGACTCTAATCATAAAAA-3' the target gene amplification is carried out on the plants, and the result is shown in fig. 6, wherein fig. 6 shows that M is arranged in sequence from left to right: DL2000; p: pWMB172-TaSBE I plasmid; WT: zhengmai 7698;1-16: a TaSBE I transgenic line; h: negative control. As can be seen from FIG. 6, transgenic lines 1-16 all detected bands of the gene of interest and vector combination relative to control plants, indicating that the TaSBE I gene was overexpressed in these transgenic wheat lines.

Example 3

(1) Influence of the TaSBE I Gene on starch content and thousand kernel weight of wheat kernels

The transgenic lines 1 to 3 of example 2 were planted singly and their thousand seed weight and starch content were measured during the harvest period, and the results are shown in Table 1.

TABLE 1 thousand seed weight and starch content of transgenic plants

Note that: taSBE I-OE1, taSBE I-OE2, and TaSBE I-OE3 represent transgenic lines 1-3 of example 2; WT stands for zhengmai 7698.

As can be seen from table 2, the 3 lines transformed with the TaSBE I gene had an increase in thousand kernel weight of 8.16%, 12.51% and 8.78%, respectively, an increase in total starch content of 3.53%, 2.80% and 3.75%, respectively, an increase in amylopectin content of 5.14%, 4.27% and 5.27%, respectively, and the thousand kernel weight, total starch content and amylopectin content of the transgenic wheat were all significantly higher than that of wild-type (WT) wheat zheng 7698; and the amylose content of the transgenic wheat is lower than that of the wild type, the amplitude reduction is 2.09%, 2.321% and 1.57%, respectively, the straight/branch ratio (the ratio of the amylose to the amylopectin) of the transgenic strain is obviously lower than that of the wild type, and the amplitude reduction is 6.90%. It was demonstrated that transformation of the TaSBE I gene affected the amylopectin content of wheat kernels.

(2) Effect of TaSBE I Gene on quality Properties of wheat grain amylopectin

The effect of the TaSBE I gene on wheat starch quality was further studied on the basis of step (1), and the gelatinization characteristics (such as peak viscosity, relaxation value, low valley viscosity, rebound value, gelatinization time, gelatinization temperature, etc.) and swelling potential of the grain starch were measured, and the results are shown in Table 2, wherein TaSBE I-OE1, taSBE I-OE2, and TaSBE I-OE3 represent transgenic lines 1 to 3 of example 2.

TABLE 2 thousand seed weight and starch content of transgenic plants

Note that: taSBE I-OE1, taSBE I-OE2, and TaSBE I-OE3 represent 3 transgenic lines of TaSBE I; WT stands for zhengmai 7698.

As can be seen from table 2, the peak viscosity, the relaxation value, the low valley viscosity, the rebound value and the gelatinization time of the 3 transgenic lines were significantly higher than that of the wild type, wherein the peak viscosity increases of the 3 transgenic lines were 5.40%, 4.56% and 15.72%, respectively; the increase of the value of the relaxation is 7.63%, 3.12% and 23.79%; the increase of the low-valley viscosity is 4.0%, 4.7% and 11.9%; the increase in rebound was 2.1%,2.5% and 7.6%; the gelatinization time is increased by 0.5%, 1.1% and 0.7%; the expansion potential of the transgenic lines was also significantly higher than that of the wild type, with 2.28%, 1.17% and 2.73% amplifications, respectively. However, only the final viscosity of TaSBE I-OE3 is significantly higher than that of the wild type, the increase amplitude is 9.5%, and the final viscosities of TaSBE I-OE1 and TaSBE I-OE2 are higher than those of the wild type, but the difference is not significant; the gelatinization temperature of the transgenic line was not significantly different from that of the wild type. Overexpression of the TaSBE I gene can affect the grain starch characteristics, and improve the swelling potential and gelatinization characteristics of the grain starch, such as peak viscosity, relaxation value, valley viscosity, rebound value and gelatinization time.

(3) Effect of TaSBE I Gene on wheat amylopectin Properties

Further studies on the effect of the TaSBE I gene on wheat amylopectin properties were performed on the basis of step (1), and the chain length distribution and branching degree of the transgenic lines and wild-type amylopectin were determined, and the results are shown in Table 2 and FIGS. 7 to 8.

TABLE 3 transgenic lines and wild-type amylopectin chain length distribution

Strains of plants	ΣDP6-10	ΣDP11-24	ΣDP>25
				WT	15.12	62.50	22.19
TaSBE I-OE1	15.54	63.47	22.58
				TaSBE I-OE2	12.77	57.79	20.79
TaSBE I-OE3	15.40	53.11	18.80

As can be seen from Table 3 and the descriptions of FIGS. 7 to 8, the chain length distribution trend of amylopectin between the 3 transgenic lines and the wild type was almost uniform, the highest peak of the chain length was in (polymerization degree corresponding to each peak, degree of polymerization, DP) DP11, and the chain length distribution was mainly concentrated in DP 11-24. The variation of the chain length distribution (ΣDP6-10) of the transgenic TaSBE I gene line and the wild type is 12.77-15.54, wherein the value of ΣDP6-10 is the minimum value of TaSBE I-OE2 and the value is the maximum value of TaSBE I-OE1; the variation range of ΣDPs 11-24 is 53.11-62.50, wherein ΣDPs 11-24 have the minimum value of TaSBE I-OE3 and the maximum value of TaSBE I-OE1; the variation range of ΣDP >25 is 18.80-22.58, wherein ΣDP >25 is the minimum value of TaSBE I-OE3 and the maximum value of TaSBE I-OE1; the branching degree of three wheat strains transformed with the TaSBE I gene is higher than that of a wild plant, and the amplification is 21.8%, 17.5% and 33.7% respectively, so that the obvious difference level is achieved. The TaSBE I gene influences the chain length distribution of the wheat amylopectin, and the over-expression of the TaSBE I gene can improve the branching degree of the grain amylopectin, increase the branching number of the wheat amylopectin and is beneficial to improving the cooking quality related to the Gao Xiaomai grain amylopectin.

The TaSBE I gene can improve the starch content and thousand kernel weight of wheat, influence the chain length distribution of wheat amylopectin, improve the branching degree of the wheat amylopectin, increase the branching number of the wheat amylopectin and is beneficial to improving the cooking quality related to the amylopectin of Gao Xiaomai grains.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Sequence listing

<110> Henan agricultural university

<120> application of TaSBE I gene in promoting wheat starch synthesis

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2493

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgctctgcc tcaccgcccc ctcctgctcg ccatctctcc cgccgcgccc ctcccgtccc 60

gctgctgacc ggcccggacc ggggatctcg ggcggcggca atgtgcggct gagcgcggtg 120

cccgcgccct cttcgctccg ctggtcgtgg ccgcggaagg ccaagagcaa gttctctgtt 180

cccgtgtctg cgccaagaga ctacaccatg gcaacagctg aagatggtgt tggcgacctt 240

ccgatatacg atctggatcc gaagtttgcc ggcttcaagg aacacttcag ttataggatg 300

aaaaagtacc ttgaccagaa acattcgatt gagaagcacg agggaggcct tgaagagttc 360

tctaaaggct atttgaagtt tgggatcaac acagaaaatg acgcaactgt gtaccgggaa 420

tgggcccctg cagcaatgga tgcacaactt attggtgact tcaacaactg gaatggctct 480

gggcacagga tgacaaagga taattatggt gtttggtcaa tcaggatttc ccatgtcaat 540

gggaaacctg ccatccccca taattccaag gttaaatttc gatttcaccg tggagatgga 600

ctatgggtcg atcgggttcc tgcatggatt cgttatgcaa cttttgatgc ctctaaattt 660

ggagctccat atgacggtgt tcactgggat ccaccttctg gtgaaaggta tgtgtttaag 720

catcctcggc ctcgaaagcc tgacgctcca cgtatttacg aggctcatgt ggggatgagt 780

ggtgaaaagc ctgaagtaag cacatacaga gaatttgcag acaatgtgtt accgcgcata 840

aaggcaaaca actacaacac agttcagctg atggcaatca tggaacattc atattatgct 900

tcttttgggt accatgtgac gaatttcttc gcagttagca gcagatcagg aacgccagag 960

gacctcaaat atcttgttga caaggcacat agtttagggt tacgtgttct gatggatgtt 1020

gtccatagcc atgcgagcag taataagaca gatggtctta atggctatga tgttgggcaa 1080

aacacacagg agtcctattt ccacacagga gaaaggggct atcataaact gtgggatagc 1140

cgcctgttca actatgccaa ttgggaggtc ttacgatttc ttctttctaa tctgagatat 1200

tggatggacg aattcatgtt tgatggcttc cgatttgatg gggtaacatc catgctatat 1260

aatcaccatg gtatcaatat gtcattcgct ggaagttaca aggaatattt tggtttggat 1320

actgatgtag atgcagttgt ttacctgatg cttgcgaacc atttaatgca caaactcttg 1380

ccagaagcaa ctgttgttgc agaagatgtt tcaggcatgc cagtgctttg tcggtcagtt 1440

gatgaaggtg gagtagggtt tgactatcgc ctggctatgg ctattcctga tagatggatc 1500

gactacttga agaacaaaga tgaccttgaa tggtcaatga gtggaatagc acatactctg 1560

accaacagga gatatacgga aaagtgcatt gcatatgctg agagccatga tcagtctatt 1620

gttggcgaca agactatggc atttctcttg atggacaagg aaatgtatac tggcatgtca 1680

gacttgcagc ctgcttcgcc tacaattgat cgtggaattg cacttcaaaa gatgattcac 1740

ttcatcacca tggcccttgg aggtgatggc tacttgaatt ttatgggtaa tgagtttggc 1800

cacccagaat ggattgactt tccaagagaa ggcaacaact ggagttatga taaatgcaga 1860

cgccagtgga gcctcgcaga cattgatcac ctacgataca agtacatgaa cgcatttgat 1920

caagcaatga atgcgctcga cgacaaattt tccttcctat catcatcaaa gcagattgtc 1980

agcgacatga atgaggaaaa gaagattatt gtatttgaac gtggagatct ggtcttcgtc 2040

ttcaattttc atcccagtaa aacttatgat ggttacaaag tcggatgtga cttgcctggg 2100

aagtacaagg tagctctgga ctctgatgct ctgatgtttg gtggacatgg aagagtggcc 2160

catgacaacg atcactttac gtcacctgaa ggagtaccag gagtacctga aacaaacttc 2220

aacaaccgcc ctaactcatt caaaatcctg tctccatccc gcacttgtgt ggcttactat 2280

cgcgtcgagg agaaagcgga aaagcccaag gatgaaggag ctgcttcttg ggggaaaact 2340

gctctcgggt acatcgatgt tgaagccact ggcgtcaaag acgcagcaga tggtgaggcg 2400

acttctggtt ccgaaaaggc gtctacagga ggtgactcca gcaagaaggg aattaacttt 2460

gtctttctgt cacccgacaa agacaacaaa taa 2493

<210> 2

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tgcaggtcga ctctagagga tccccgggat gctctgcctc accgccccct 50

<210> 3

<211> 51

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cggggaaatt cgagctctct agaactagtt tatttgttgt ctttgtcggg t 51

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

accatcgtca accactacat cg 22

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gctgccagaa accacgtcat g 21

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cagtggagcc tcgcagacat tg 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tgcgggactc taatcataaa aa 22

Claims

1.TaSBE IThe application of the gene in improving the quality of wheat amylopectin;

the saidTaSBE IThe nucleotide sequence of the gene is shown as SEQ ID NO. 1;

the amylopectin quality is the swelling potential, peak viscosity, relaxation value, low valley viscosity, rebound value and gelatinization time of the starch.