CN114807163B - Application of TaSBE I Gene in Promoting Wheat Starch Synthesis - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a TaSBEI gene in promoting wheat starch synthesis. The TaSBEI gene can improve the starch content and thousand seed weight of wheat seeds, influence the chain length distribution of wheat amylopectin, improve the branching degree of the wheat amylopectin, increase the branching number of the wheat amylopectin and is beneficial to improving the cooking quality related to the amylopectin of Gao Xiaomai seeds.

Description

Application of TaSBE I Gene in Promoting Wheat Starch Synthesis

technical field

The invention belongs to the technical field of genetic engineering, and in particular relates to the application of TaSBEI gene in promoting the synthesis of wheat starch.

Background technique

Wheat (Triticum aestivum L.) provides food for about one-third of the world's population and is one of the most important food crops in the world (He M, Zhu C, Dong K, et al. Comparative proteome analysis of embryo and endosperm reveals central Differential expression proteins involved in wheat seed germination [J]. BMC Plant Biology, 2015, 15(1): 1-17.). Starch is the main component of wheat grains, accounting for about 75% of the total components of wheat grains; starch mainly exists in the form of carbohydrates, which provide human with daily energy. The starch content, type (amylose, amylopectin, ratio of amylose to amylopectin) and physical and chemical properties (gelatinization properties, swelling potential) all affect the appearance and taste of pasta products. In recent years, with the improvement of people's living standards, more and more people have higher requirements for the quality of pasta products, so the research on wheat starch is becoming more and more important.

Starch is divided into amylose and amylopectin according to different molecular structures, accounting for 20%-35% and 65%-80% of the total starch content respectively (Fang Xianwen, Jiang Dong, Dai Tingbo, etc. Different quality types of wheat grain protein , Genotype differences in the process of starch accumulation [J]. Journal of Wheat Crops, 2002, 22:42-45). Both amylose and amylopectin include a backbone of α-1,4-glucose residues, but the molecular weight of amylose is low, generally between 105-106 Da, and there are few branch points (α-1,6 branch points less than 0.5%); amylose is mainly composed of glucose molecules connected by α-1,4-glucosidic bonds. It is easily soluble in water to form a colloidal solution. It is a type of starch that can be quickly digested and absorbed by the human body; Amylopectin is a branched polymer mainly composed of glucose groups connected by α-1,4-glycosidic bonds and α-1,6-glycosidic bonds, and has a complex molecular structure similar to tree branches (Jin Lichen, Geng Zhiming , Li Jinzhou, et al. The relationship between rice starch composition and molecular structure and eating quality [J]. Journal of Jiangsu Agricultural Science, 2011, 27(01): 13-18.), degree of polymerization (Degree of polymerization, DP), not easily soluble in Water, but it will swell to form a paste when it reacts with hot water, and the solution is reddish purple after combining with iodine (Chen P, Yu L, SimonG P, et al.Internal structures and phase-transitions of starch granules during gelatinization[J].Carbohydrate Polymers, 2011, 83(4):1975-1983.). Among them, the chains of amylopectin can be divided into three types: the glucose in amylopectin is connected by α-1,4-glycosidic bonds to form a straight chain without branches, called A chain; , The side chain formed by the 6-glycoside bond is called the B chain; another branched side chain with a reducing end that appears on the B chain is called the C chain. The non-random distribution of linear chains and the regular order of branched clusters require specific lengths of A and B chains, and this structural difference will lead to differences in the crystal structure of starch granules, further affecting the amylopectin branched clusters. structure, ultimately affecting the degree of crystallization, gelatinization properties and expansibility of wheat grain starch (BagaM, Glaze S, Mallard CS, et al. A starch branching enzyme gene in wheat produce salt alternatively spliced transcripts. Plant Molecular Biology, 1999, 40:1019-1030; Mohan B H, Malleshi N G.Characteristics of native and enzymatically hydrolyzed common wheat(Triticum aestivum)and dicoccum wheat(Triticum dicoccum)starches[J].European Food Research and Technology,2006,223(3):355 -361.), thereby affecting the quality of pasta products. However, there are almost no reports on the synthesis of wheat starch, and most of them are just speculations about its function, which have not been effectively verified.

Contents of the invention

The purpose of the present invention is to provide the application of TaSBE I gene in promoting the synthesis of wheat starch, improve the starch and thousand-grain weight of wheat, and improve the quality of amylopectin.

The invention provides the application of TaSBE I gene in promoting the synthesis of wheat starch;

The nucleotide sequence of the TaSBE I gene is shown in SEQ ID NO.1.

Preferably, the wheat starch includes wheat amylopectin.

The present invention also provides the application of the TaSBE I gene in cultivating high starch and/or high thousand-grain weight transgenic plants;

The nucleotide sequence of the TaSBE I gene is shown in SEQ ID NO.1.

Preferably, the transgenic plants include wheat.

The invention provides the application of TaSBE I gene in improving the quality of plant amylopectin;

The nucleotide sequence of the TaSBE I gene is shown in SEQ ID NO.1.

The invention provides a method for cultivating transgenic wheat, in which the gene described in SEQ ID NO.1 is overexpressed in wheat.

The TaSBE I gene of the present invention participates in the synthesis of wheat starch, which can increase the thousand-grain weight, total starch content and amylopectin content of wheat grains significantly higher than that of wild-type plants, reduce the ratio of wheat amylose to amylopectin, and improve the grain yield. The expansion potential and gelatinization characteristics of starch, such as peak viscosity, slack value, trough viscosity, rebound value and gelatinization time, increase the branching degree of grain amylopectin and the number of branches of wheat amylopectin, which is beneficial to improve the wheat grain Amylopectin-related cooking qualities.

Description of drawings

In order to illustrate the embodiments of the present invention or the technical solutions in the prior art more clearly, the following will briefly introduce the drawings required in the embodiments.

Fig. 1 is the PCR amplification result of gene TaSBE I;

Fig. 2 is pWMB172-TaSBE I recombinant vector enzyme digestion detection result;

Fig. 3 is the map of quantitative expression vector pWMB172-TaSBE I;

Fig. 4 is the genetic transformation process of overexpression vector pWMB172-TaSBE I;

Fig. 5 is the PCR amplification result of Bar gene in the transgenic plant;

Fig. 6 is the PCR amplification result of TaSBE I gene in the transgenic plant;

Figure 7 is the chain length distribution of transgenic lines and wild-type amylopectin;

Figure 8 is the branching degree of amylopectin in transgenic plants.

Detailed ways

The invention provides the application of TaSBE I gene in promoting the synthesis of wheat starch;

The nucleotide sequence of the TaSBE I gene is shown in SEQ ID NO.1.

The specific nucleotide sequence of the TaSBE I gene of the present invention is

5’-ATGCTCTGCCTCACCGCCCCCTCCTGCTCGCCATCTCTCCCGCCGCGCCC CTCCCGTCCCGCTGCTGACCGGCCCGGACCGGGGATCTCGGGCGGCGGCAATGTGCGCTGAGCGCGGTGCCCGCGCCCTCTTCGCTCCGCTGGTCGTGGCCGCGGAAGGCCAAGAGCAAGTTCTCTGTTCCCGTGTCTGCGCCAAGAGACTACC ATGGCAACAGCTGAAGATGGTGTTGGCGACCTTCCGATATACGA TCTGGATCCGAAGTTTGCCGGCTTCAAGGAACACTTCAGTTATAGGATGAAAAAGTACCTTGACCAGAAACATTCGATTGAGAAGCACGAGGGAGGCCTTG AAGAGTTCTCTAAAGGCTATTTGAAGTTTGGGATCAACACAGAAAATGACGCAACTGTGTACCGGGAATG GGCCCCTGCAGCAATGGATGCACAACTTATT GGTGACTTCAACAACTGGAATGGCTCTGGGCACAGGATGACAAAGGATAATTATGGTGTTTGGTCAATCAGGATTTCCCATGTCAATGGGAAACCTGCCATC CCCCATAATTCCAAGGTTAAAATTTCGATTTCACCGTGGAGATGGACTATGGGTCGATCGGGTTCCTGCATGGATTCGTTAT GCAACTTTTGATGCCTCTAAATT TGGAGCTCCATATGACGGTGTTCACTGGGATCCACCTTCTGGTGAAAGGTATGTGTTTAAGCATCCTCGGCCTCGAAAGCCTGACGCTCCACGTATTTACGA GGCTCATGTGGGGATGAGTGGTGAAAAGCCTGAAGTAAGCACATACAGAGAATTTGCAGACAATGTGTTACCGCGCATAAAGGCAACAACTACAA CACA GTTCAGCTGATGGCAATCATGGAACATTCATATTATGCTTCTTTTGGGTACC ATGTGACGAATTTCTTCGCAGTTAGCAGCAGATCAGGAACGCCAGAGGACCTCAAATATCTTGTTGACAAGGCACATAGTTTAGGGTTACGTGTTCTGATGG ATGTTGTCCATAGCCATGCGAGCAGTAATAAGACAGATGGTCTTAATGGCTATGAT GTTGGGCAAAACACACAGGAGTCCTATTTCCACACAGGAGAAAGGGGCTATCATAAACTGTGGGATAGCCGCCTGTTCAACTATGCCAATTGGGAGG TCTTACGATTTCTTCTTTCTAATCTGAGATATTGGATGGACGAATTCATGTTTGATGGCTTCCGATTTGATGGGGTAACATCCATGCTATATAATCACCATGGTAT CAATATG TCATTCGCTGGAAGTTACAAGGAATATTTTGGTTTGGATACTGATGTAGATGCAGTTGTTTACCTGATGCTTGCGAACCATTTAATGCACAAACTCT TGCCAGAAGCAACTGTTGTTGCAGAAGATGTTTCAGGCATGCCAGTGCTTTGTCGGTCAGTTGATGAAGGTGGAGTAGGGTTTGACTATCGCCTGGCTATGGCTATTCCTGATAGATG GATCGACTACTTGAAGAACAAAGATGACCTTGAATGGTCAATGAGTGGAATAGCACATACTCTGACCAACAGGAGATACATCGGAA AAGTGCATTGCATATGCTGAGAGCCATGATCAGTCTATTGTTGGCGACAAG ACTATGGCATTTCTCTTGATGGACAAGGAAATGTATACTGGCATGTCAGACTTGCAGCCTGCTTCGCCTACAATTGATCGTGGA ATTGCACTTCAAAAAGATGA TTCACTTCATCACCATGGCCCTTGGAGGTGATGGCTACTTGAATTTTATGGGTAATGAGTTTGGCCACCCAGAATGGATTGACTTTCCAAGAGAAGGCAACA ACTGGAGTTATGATAAATGCAGACGCCAGTGGAGCCTCGCAGACATTGATC ACCTACGATACAAGTACATGAACGCATTTGATCAAGCAATGAATGCGC TCGACGACAAATTTTCCTTCCTATCATCATCAAAGCAGATTGTCAGCGACATGAA TGAGGAAAAGAAGATTATTGTATTTGAACGTGGAGATCTGGTCTTCGTCTTCAATTTCATCCCAGTAAAACTTATGATGGTTACAAAGTCGGATGTGACTTGCCTGGGAAGTACAAGGTAGCTCTGGACTCTGATGCTCTGATGTTTGGTGGA CATGGAAGAGT GGCCCATGACAACGATCACTTTACGTCACCTGAAGGAGTACCAGGAGTACCTGAAACAAACTTCAACAACCGCCCTAACTCAATTCAAAATCCTGTCTCCATCCCGCACTTGTGTGGCTTACTATCGCGTCGAGGAGAAAGCGGAAAAGCCCAAGGATGAAGGAGCTGCTTCTTGGGGGAAAACTGCTCTCGGGTACATCGATGTTGAAGCCACTGGCGTCA AAGACGCAGCAGATGGTGAGGCGACTTCTGGTTCCGAAAAGGCGTCTACAGGAGGTGACTCCAGCAAGAAGGGAATTAACTTTGTCTTTCTGTCACCCGACAAAGACAACAAATAA. The present invention has no strict requirements on the source of the TaSBE I gene, which can be obtained by artificial synthesis or amplification.

The nucleotide sequence length of the TaSBE I gene of the present invention is 2493bp, and the encoded protein can promote the synthesis of wheat amylopectin. The results of the examples show that the TaSBE I gene is involved in the synthesis of wheat starch, affects the starch content and thousand-grain weight of wheat grains, and affects the quality and characteristics of wheat grain amylopectin. The results of the examples show that the TaSBE I gene of the present invention can increase the thousand-grain weight of wheat grains by 8.16% to 12.51%, the total starch content by 2.80% to 3.75%, and the amylopectin content by 4.27% to 5.27%. The ratio of starch decreased by 1.57%-2.32%. Overexpression of TaSBE I gene can affect grain starch characteristics, improve swelling potential and gelatinization properties of grain starch, such as peak viscosity, slack value, trough viscosity, rebound value and gelatinization time; increase the branching degree of grain amylopectin, increase wheat The number of branches of amylopectin is beneficial to improve the cooking quality of wheat grain amylopectin.

The invention also provides a method for cultivating transgenic wheat, in which the TaSBE I gene is overexpressed in the wheat. The present invention does not have strict requirements on the way of overexpressing the TaSBE I gene, preferably using homologous recombination to combine the TaSBE I gene with an expression vector to obtain a recombinant vector, and then transfer the recombinant vector into target wheat to obtain a transgenic wheat. The expression vector of the present invention is preferably a pMWB172 vector (Wang et al., Plant Biotechnol J.2017, 15:61-623).

In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

Example 1

Construction of TaSBE I overexpression vector

1. According to the map of the pMWB172 carrier (provided by Ye Xingguo Laboratory, Chinese Academy of Agricultural Sciences), design the upstream primer TaSBE I-F and downstream primer TaSBE I-R of TaSBE I, the nucleotide sequence of the upstream primer TaSBEI-F is as shown in SEQ ID NO.2, Specifically: 5'-TGCAGGTCGACTCTAGAGGA TCCCCGGG(Sma I)ATGCTCTGCCTCACCGCCCCCT-3'; the nucleotide sequence of the downstream primer TaSBE I-R is shown in SEQ ID NO.3, specifically: 5'-CGGGGAAATTCGAGCTC TCTAGAACTAGT(Spe I)TTATTTGTTGTCTTTGTCGGGT-3 '. Using the cDNA of Zhengmai 7698 as a template, the above primers were used for PCR amplification (pre-denaturation at 98°C for 5 min; then denaturation at 98°C for 10 s, annealing at 53°C for 5 s, extension at 72°C for 20 s, a total of 35 cycles; final extension at 72°C for 7 min ; 16°C, stored), agarose gel electrophoresis was performed after the amplification was completed, and the size of the amplified band was detected. The results are shown in Figure 1 (4 sets of PCR amplifications were performed). As can be seen from Figure 1, the size of the amplified fragment is consistent with the size of the target gene TaSB EI (2493bp), indicating that the PCR amplification was successful.

2. Recover a single 2493bp target fragment of the amplified band (gel recovery kit, purchased from Tiangen Company), and at the same time, use Sma I and Spe I to double-enzyme-cut the vector pMWB172. The specific process is as follows: take 10 μL (1 mg) of the vector plasmid, Add 5 μL of 10x digestion buffer, 1 μL of Sma I, and 1.0 μL of Spe I, add ddH ₂ O to supplement the reaction system to 50 μL, and digest at 37°C for 2 hours. The digested products were separated by agarose gel electrophoresis, and the large fragments obtained after the double digested vector pMWB172 were recovered. Then, the large fragment of the vector recovered by pMWB172 digestion and the PCR-amplified target fragment of TaSBE I were connected by homologous recombination. The specific process was as follows: take the vector and the large fragment, and dilute the vector and the large fragment to 10 ng/μL respectively and 30ng/μL, add 2.0 μL of carrier and 6.0 μL of fragment, then add 0.75 μL of homologous recombination ligase and 1.25 μL of 10× ligase buffer, mix well, centrifuge, and ligate at 16°C for 1.5h. Then the ligation product was transformed into Escherichia coli DH5α competent cells to transform Escherichia coli. Randomly pick 5 single clones for expansion culture, and use the Tiangen Plasmid Extraction Kit to extract the plasmid, and use Sma I and Spe I double enzyme digestion to verify, the results are shown in Figure 2: Lane 2 of the 5 plasmids was double digested, The target band cut out in lane 4 and lane 5 is the same size as the TaSBE I constructed into the pMWB172 vector. Double enzyme digestion verified that lane 2, lane 4 and lane 5 successfully constructed the overexpression vector of pMWB172-TaSBE I, and inserted TaSBE I Between the Sma I and Spe I endonuclease sites of the expression vector pMWB172, the map of the overexpression vector pMWB172-TaSBE I is shown in Figure 3, including the Dx5 (endosperm-specific) promoter, the TaSBE I gene, and the Nos (Agrobacterium nopaline synthase terminator).

Example 2

Obtaining and Identification of TaSBE I Transgenic Wheat Plants

(1) Obtaining of TaSBE I transgenic wheat plants

Wheat immature embryos were transformed by gene gun method. The specific process is as follows: First, select the young ears of wheat after flowering, and culture them in low-temperature hydroponics for about 1 week; separate the wheat seeds and sterilize them; use sterilized tweezers and a scalpel to peel off the young wheat embryos, and place them in a petri dish for later use . Simultaneously, the immature embryos of wheat were bombarded with a gene gun to the overexpression vector pMWB172-TaSBE I of Example ₁ ; 4-D, vitamin B5, etc.) at 25°C for dark culture; then transfer the immature embryos with callus to differentiation medium (including MS, 2,4-D, MEG, G418, etc.), at 25°C, 12h light/12h dark inter-growth culture; then, the recipient material that produced adventitious buds was transferred to the selection medium (including 1/2MS, NAA, G418, etc.), at 25°C, 12h light/12h dark growth Interculture, root the receptor material and screen positive seedlings, transfer the screened positive seedlings to cold storage, vernalize for 14 days, and then transfer to soil for cultivation (Liu Huiyun, 2017, Institute of Crop Science, Chinese Academy of Agricultural Sciences, master's degree paper). The growth process is shown in Figure 4.

(2) Identification of TaSBE I transgenic wheat plants

Use the previously reported method CTAB method (Li et al.2018) to extract the DNA of the T0 transgenic seedlings in step (1), use the screening marker gene hygromycin primer to detect whether the transgenic TaSBEI contains the hygromycin (bar) gene, and design primers For F (SEQ ID NO.4): 5'-ACCATCGTCAACCACTACATCG-3'; R (SEQ ID NO.5): 5'-GCTGCCAGAAACCACGTCATG-3', the detection results are shown in Figure 5, where Figure 5 is from left to right M: DL2000; P: pWMB172-TaSBE I plasmid; WT: Zhengmai 7698; 1-16: TaSBE I transgenic line; H: negative control. According to Fig. 5, it can be seen that except for the wild type (WT) and the negative control (H) and the transgenic line 9, all other detected plants contain the hygromycin gene. It shows that these lines carry the selection marker gene of the overexpression vector.

On this basis, the upstream forward primer F (SEQ ID NO.6): 5'-CAGTGGAGCCTCGCAGACATTG-3' was designed on the insertion target gene, and the downstream reverse primer R (SEQ ID NO.7): 5' was designed on the vector -TGCGGGACTCTAATCATAAAAA-3'Amplify the target gene of the above plants, and the results are shown in Figure 6, in which Figure 6 from left to right is M: DL2000; P: pWMB172-TaSBE I plasmid; WT: Zhengmai 7698; 1- 16: TaSBE I transgenic line; H: negative control. According to Figure 6, it can be seen that compared with the control plants, the transgenic lines 1-16 all detected the bands of the combination of the target gene and the vector, indicating that the TaSBE I gene was overexpressed in these transgenic wheat lines.

Example 3

(1) Effect of TaSBE I gene on wheat starch content and thousand-grain weight

The transgenic lines 1-3 of Example 2 were planted individually, and the thousand-grain weight and starch content were measured at the harvest stage. The results are shown in Table 1.

Table 1 Thousand-grain weight and starch content of transgenic plants

Note: TaSBE I-OE1, TaSBE I-OE2, and TaSBE I-OE3 represent the transgenic lines 1-3 of Example 2; WT represents Zhengmai 7698.

According to Table 2, it can be seen that for the three lines transfected with the TaSBE I gene, the increases in thousand-grain weight of wheat grains were 8.16%, 12.51% and 8.78%, and the increases in total starch content were 3.53%, 2.80% and 3.75%, respectively. The increases of amylopectin content were 5.14%, 4.27% and 5.27%, respectively, and the thousand-grain weight, total starch content and amylopectin content of the transgenic wheat grains were significantly higher than those of the wild-type (WT) wheat Zhengmai 7698; and the transgenic wheat The amylose content of the transgenic lines was lower than that of the wild type by 2.09%, 2.321% and 1.57%, respectively. %. It indicated that the transfer of TaSBE I gene affected the amylopectin content of wheat grain.

(2) Effect of TaSBE I gene on quality characteristics of wheat grain amylopectin

On the basis of step (1), further explore the influence of TaSBE I gene on the quality of wheat starch, and measure the gelatinization characteristics of grain starch (such as peak viscosity, slack value, trough viscosity, rebound value, gelatinization time, gelatinization temperature, etc. ) and expansion potential, the results are shown in Table 2, wherein TaSBE I-OE1, TaSBE I-OE2, and TaSBE I-OE3 represent the transgenic lines 1-3 of Example 2.

Table 2 Thousand-grain weight and starch content of transgenic plants

Note: TaSBE I-OE1, TaSBE I-OE2, and TaSBE I-OE3 represent three transgenic lines of TaSBE I; WT represents Zhengmai 7698.

According to Table 2, it can be seen that the peak viscosity, thinning value, trough viscosity, rebound value and gelatinization time of the three transgenic lines were significantly higher than those of the wild type, and the peak viscosity of the three transgenic lines increased by 5.40% respectively , 4.56%, 15.72%; the increase of slack value is 7.63%, 3.12%, 23.79%; the increase of trough viscosity is 4.0%, 4.7%, 11.9%; the increase of rebound value is 2.1%, 2.5% and 7.6%; Gelatinization time increased by 0.5%, 1.1%, and 0.7%. The expansion potential of the transgenic lines was also significantly higher than that of the wild type, with an increase of 2.28%, 1.17%, and 2.73%, respectively. But only the final viscosity of TaSBEI-OE3 was significantly higher than that of the wild type, with an increase of 9.5%. The final viscosity of TaSBE I-OE1 and TaSBE I-OE2 was higher than that of the wild type, but the difference was not significant; There was no significant difference in gelatinization temperature. Overexpression of TaSBE I gene can affect grain starch properties, improve grain starch swelling potential and gelatinization properties such as peak viscosity, thinning value, trough viscosity, rebound value and gelatinization time.

(3) Effect of TaSBE I gene on wheat amylopectin characteristics

On the basis of step (1), the influence of TaSBE I gene on wheat amylopectin characteristics was further studied, and the distribution and branching degree of amylopectin chain lengths of transgenic lines and wild type were determined. The results are shown in Table 2 and Figures 7-8. Show.

Table 3 Transgenic lines and wild-type amylopectin chain length distribution

strain ΣDP6-10 ΣDP11-24 ΣDP>25 WT 15.12 62.50 22.19 TaSBE I-OE1 15.54 63.47 22.58 TaSBE I-OE2 12.77 57.79 20.79 TaSBE I-OE3 15.40 53.11 18.80

Note: TaSBE I-OE1, TaSBE I-OE2, and TaSBE I-OE3 represent three transgenic lines of TaSBE I; WT represents Zhengmai 7698.

According to the contents recorded in Table 3 and Figures 7 to 8, it can be seen that the distribution trend of the amylopectin chain length between the 3 transgenic lines and the wild type is almost the same, and the highest peak of the chain length is at (determined according to the ion chromatogram of the standard sample) The degree of polymerization corresponding to each peak, degree of polymerization, DP) DP 11, the chain length distribution is mainly concentrated in DP 11-24. The variation range of the chain length distribution (ΣDP6-10) between TaSBE I gene lines and the wild type was 12.77-15.54, among which the smallest value of ΣDP6-10 was TaSBE I-OE2, and the largest value was TaSBE I-OE1; ΣDP11- The variation range of 24 is 53.11-62.50, among which the minimum value of ΣDP11-24 is TaSBE I-OE3, and the maximum value is TaSBE I-OE1; the variation range of ΣDP>25 is 18.80-22.58, and the minimum value of ΣDP>25 is TaSBE I-OE3, the largest was TaSBE I-OE1; the branching degree of the three wheat lines transfected with TaSBE I gene was higher than that of the wild-type plants, the increases were 21.8%, 17.5% and 33.7%, respectively, reaching a significant difference level. The TaSBE I gene of the present invention affects the chain length distribution of wheat amylopectin, and overexpression of the TaSBE I gene can improve the branching degree of grain amylopectin, increase the branch number of wheat amylopectin, and is beneficial to improve cooking related to wheat grain amylopectin quality.

The TaSBE I gene of the present invention can improve the starch content and thousand-grain weight of wheat grains, affect the chain length distribution of wheat amylopectin, improve the branching degree of grain amylopectin, increase the number of branches of wheat amylopectin, and help improve the amylopectin of wheat grains. Amylopectin-related cooking qualities.

Although the foregoing embodiment has described the present invention in detail, it is only a part of the embodiments of the present invention, rather than all embodiments, and people can also obtain other embodiments according to the present embodiment without inventive step, these embodiments All belong to the protection scope of the present invention.

sequence listing

<110> Henan Agricultural University

<120> Application of TaSBE I Gene in Promoting Wheat Starch Synthesis

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2493

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgctctgcc tcaccgcccc ctcctgctcg ccatctctcc cgccgcgccc ctcccgtccc 60

gctgctgacc ggcccggacc ggggatctcg ggcggcggca atgtgcggct gagcgcggtg 120

cccgcgccct cttcgctccg ctggtcgtgg ccgcggaagg ccaagagcaa gttctctgtt 180

cccgtgtctg cgccaagaga ctacaccatg gcaacagctg aagatggtgt tggcgacctt 240

ccgatatacg atctggatcc gaagtttgcc ggcttcaagg aacacttcag ttataggatg 300

aaaaagtacc ttgaccagaa acattcgatt gagaagcacg agggaggcct tgaagagttc 360

tctaaaggct atttgaagtt tgggatcaac acagaaaatg acgcaactgt gtaccgggaa 420

tgggcccctg cagcaatgga tgcacaactt attggtgact tcaacaactg gaatggctct 480

gggcacagga tgacaaagga taattatggt gtttggtcaa tcaggatttc ccatgtcaat 540

gggaaacctg ccatccccca taattccaag gttaaatttc gatttcaccg tggagatgga 600

ctatgggtcg atcgggttcc tgcatggatt cgttatgcaa cttttgatgc ctctaaattt 660

ggagctccat atgacggtgt tcactgggat ccaccttctg gtgaaaggta tgtgtttaag 720

catcctcggc ctcgaaagcc tgacgctcca cgtatttacg aggctcatgt ggggatgagt 780

ggtgaaaagc ctgaagtaag cacatacaga gaatttgcag acaatgtgtt accgcgcata 840

aaggcaaaca actacaacac agttcagctg atggcaatca tggaacattc atattatgct 900

tcttttgggt accatgtgac gaatttcttc gcagttagca gcagatcagg aacgccagag 960

gacctcaaat atcttgttga caaggcacat agtttagggt tacgtgttct gatggatgtt 1020

gtccatagcc atgcgagcag taataagaca gatggtctta atggctatga tgttgggcaa 1080

aacacacagg agtcctattt ccacacagga gaaaggggct atcataaact gtgggatagc 1140

cgcctgttca actatgccaa ttgggaggtc ttacgatttc ttctttctaa tctgagatat 1200

tggatggacg aattcatgtt tgatggcttc cgatttgatg gggtaacatc catgctatat 1260

aatcaccatg gtatcaatat gtcattcgct ggaagttaca aggaatattt tggtttggat 1320

actgatgtag atgcagttgt ttacctgatg cttgcgaacc atttaatgca caaactcttg 1380

ccagaagcaa ctgttgttgc agaagatgtt tcaggcatgc cagtgctttg tcggtcagtt 1440

gatgaaggtg gagtaggggtt tgactatcgc ctggctatgg ctattcctga tagatggatc 1500

gactacttga agaacaaaga tgaccttgaa tggtcaatga gtggaatagc acatactctg 1560

accaacagga gatatacgga aaagtgcatt gcatatgctg agagccatga tcagtctatt 1620

gttggcgaca agactatggc atttctcttg atggacaagg aaatgtatac tggcatgtca 1680

gacttgcagc ctgcttcgcc tacaattgat cgtggaattg cacttcaaaa gatgattcac 1740

ttcatcacca tggcccttgg aggtgatggc tacttgaatt ttatgggtaa tgagtttggc 1800

cacccagaat ggattgactt tccaagagaa ggcaacaact ggagttatga taaatgcaga 1860

cgccagtgga gcctcgcaga cattgatcac ctacgataca agtacatgaa cgcatttgat 1920

caagcaatga atgcgctcga cgacaaattt tccttcctat catcatcaaa gcagattgtc 1980

agcgacatga atgaggaaaa gaagattatt gtatttgaac gtggagatct ggtcttcgtc 2040

ttcaattttc atcccagtaa aacttatgat ggttacaaag tcggatgtga cttgcctggg 2100

aagtacaagg tagctctgga ctctgatgct ctgatgtttg gtggacatgg aagagtggcc 2160

catgacaacg atcactttac gtcacctgaa ggagtaccag gagtacctga aacaaacttc 2220

aacaaccgcc ctaactcatt caaaatcctg tctccatccc gcacttgtgt ggcttactat 2280

cgcgtcgagg agaaagcgga aaagcccaag gatgaaggag ctgcttcttg ggggaaaact 2340

gctctcgggt acatcgatgt tgaagccact ggcgtcaaag acgcagcaga tggtgaggcg 2400

acttctggtt ccgaaaaggc gtctacagga ggtgactcca gcaagaaggg aattaacttt 2460

gtctttctgt cacccgacaa agacaacaaa taa 2493

<210> 2

<211> 50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgcaggtcga ctctagagga tccccgggat gctctgcctc accgccccct 50

<210> 3

<211> 51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggggaaatt cgagctctct agaactagtt tatttgttgt ctttgtcggg t 51

<210> 4

<211> 22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

accatcgtca accactacat cg 22

<210> 5

<211> 21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gctgccagaa accacgtcat g 21

<210> 6

<211> 22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagtggagcc tcgcagacat tg 22

<210> 7

<211> 22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgcgggactc taatcataaa aa 22

Claims (1)

1. The application of TaSBE I gene in improving the quality of wheat amylopectin; The nucleotide sequence of the TaSBE I gene is shown in SEQ ID NO.1; The amylopectin quality is swelling potential, peak viscosity, thinning value, trough viscosity, rebound value and gelatinization time of starch.