CN114790248B

CN114790248B - MUC1-PDL1-IgG1Fc tumor vaccine and preparation method and application thereof

Info

Publication number: CN114790248B
Application number: CN202210519575.9A
Authority: CN
Inventors: 刘辉; 潘嘉怡; 曾无艺; 贾江涛; 房子轩; 施意
Original assignee: Guangzhou Medical University
Current assignee: Guangzhou Medical University
Priority date: 2022-05-12
Filing date: 2022-05-12
Publication date: 2023-11-28
Anticipated expiration: 2042-05-12
Also published as: CN114790248A

Abstract

The invention discloses a MUC1-PDL1-IgG1Fc tumor vaccine, a preparation method and application thereof, wherein the amino acid sequence of the MUC1-PDL1-IgG1Fc recombinant protein of the tumor vaccine is shown as SEQ ID NO. 1. The tumor vaccine provided by the invention utilizes the functions of phagocytizing, processing and presenting cancer antigens to T cells and other immune cells by using DC cells, and starts a strong cancer specific immune response, so that the defect that treatment by a single checkpoint inhibitor is ineffective is overcome, the anti-tumor immune efficacy is improved, stronger anti-tumor immune activation is realized, a new effective strategy is provided for the immune treatment of solid tumors such as tumors with high expression of MUC1 or PD-L1, and the like, the novel effective strategy has good safety and considerable prospect, and meanwhile, the drug development taking MUC1 as a target point is promoted, and the novel hope is definitely brought to the treatment of cancers.

Description

MUC1-PDL1-IgG1Fc tumor vaccine and preparation method and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to a MUC1-PDL1-IgG1Fc recombinant protein, a tumor vaccine prepared from the MUC1-PDL1-IgG1Fc recombinant protein, and a preparation method and application thereof.

Background

Malignant tumors have high morbidity and mortality worldwide and pose a considerable threat to human health. The traditional treatment methods of malignant tumors include surgery, radiotherapy, chemotherapy and targeted therapy, and the treatment methods have advantages and disadvantages. Surgery does not always completely remove tumor cells, recent studies have shown that the post-operative wound healing response may lead to the growth of metastatic tumors. The chemoradiotherapy easily causes tumor cell tolerance and recurrence, resulting in bad prognosis. While targeted therapies have specific advantages. Early clinical trials in multiple tumor types showed that single molecule targeted therapies had higher response and survival rates than other therapies.

Therapeutic tumor vaccines are also one type of targeted therapy, the principle of which is different from that of conventional prophylactic vaccines, which are used to vaccinate patients with malignant tumors, with the aid of appropriate adjuvants to activate the autoimmune response of the patient and kill tumor cells. Mutations in tumor cells alter the amino acid sequence of proteins, which are then translated and processed into short peptides, known as tumor neoantigens. As non-self antigens, neoantigens are phagocytosed, processed and presented by DC cells, activate T cells and other immune cells, and subsequently trigger specific anti-tumor immune responses in the body, so tumor vaccines have been the focus of developing therapeutic cancer vaccines.

The use of tumor vaccines has been widely studied and methods of preparation thereof include isolation or in vitro generation and amplification of autologous DCs, followed by in vitro manipulation and reinfusion into patients. There is only one tumor vaccine approved by the FDA, i.e., siPuleucel-T (Provenge; dendreon), which consists of autologous blood APCs loaded with recombinant fusion protein antigens consisting of prostatectomy phosphatase (PAP) and GM-CSF, and is useful for treating asymptomatic or asymptomatic castration-resistant prostate cancer, which can extend the survival of patients.

The source, type and kind of tumor antigens play a critical role in the anti-tumor immune efficacy of tumor vaccines. Such as the prostatectomy phosphatase (PAP) used by SiPuleucel-T, the expression of PAP in prostate cancer is specific and limiting and is therefore considered a candidate for the development of therapeutic vaccines for prostate cancer. Along with the development of tumor immunotherapy, more and more targets are introduced into tumor treatment technologies, including mucin (MUC 1), epidermal growth factor receptor 2 (HER 2) of breast cancer, mesothelin (MSLN), epidermal growth factor receptor type III mutant (EGFRvIII) and the like, and the discovery and introduction experiments of the targets lay a foundation for the development of immune cell therapies and the treatment of solid tumors.

Mucin MUC1 is a highly glycosylated transmembrane protein consisting of an intracellular C-terminal fragment, a single pass transmembrane domain and an extracellular N-terminal domain (MUC 1-N), MUC1-N being a tandem repeat sequence (VNTR, HGVTSAPDTRPAPGSTAPPA) consisting of a variable number of 20 amino acids, which can be repeated 20-120 times. Normally it is expressed on the apical and basolateral surfaces of most secretory glandular epithelium, but is blocked by mesenchymal cells and skin epithelium. The transition of human cancers from normal to malignant phenotypes has been studied to be associated with abnormal cell surface glycosylation. MUC1 is overexpressed in tumor cells and undergoes aberrant glycosylation, and MUC1 expressed by such tumor cells is referred to as TA-MUC1 or hypoglycosylated mucin-1 (UMUC 1). It is somewhat different from the antigenic site of MUC1 expressed by normal cells, which MUC1 is glycosylation modified, so that the immunogenic epitopes of the VNTR region are covered, whereas the aberrant low glycosylation of TA-MUC1 exposes these immunogenic epitopes to the immune system. Thus, new glycopeptide antigens are produced in tumor cells. TA-MUC1 generally results in irreversible apoptosis, T cell inhibition, and poor prognosis. TA-MUC1 is highly expressed in many tumors, including 96.7% invasive lung cancer, 90% pancreatic, prostate, epithelial ovarian and platinum resistant tumors, 77% primary lung cancer, 70% breast cancer, and the like. The broad distribution of TA-MUC1 on tumor cells makes MUC 1a widely sought target for many diagnostic and immunotherapeutic approaches. MUC1 was ranked by the United states national cancer institute translational research team as the second most promising cancer research target in the 75 tumor-associated antigen list based on certain criteria, such as therapeutic function, immunogenicity, and cancer cell specificity.

MUC 1-based cancer vaccines include subunit vaccines, DNA vaccines, viral vaccines, dendritic Cell (DC) vaccines, glycopeptide vaccines, and the like. Many scholars have studied the role of DC vaccine against MUC1 in antitumor, as in pancreatic cancer, MUC 1-targeted tumor vaccine for postoperative adjuvant treatment exerts remarkable antitumor effect and shows good safety and tolerability, and 33% of patients achieve recurrence-free survival in four years of clinical trials. Another phase II clinical trial of an autologous tumor vaccine loaded with MUC1 mannatide shows that 15% of patients with progressive epithelial ovarian cancer obtain a durable response, and similar to the MUC 1-targeted tumor vaccine designed by Teramoto et al, MUC 1-specific anti-tumor immune responses are successfully induced, thereby prolonging the survival time of patients with refractory non-small cell lung cancer. Thus, the MUC 1-based tumor vaccine has great potential for anti-tumor application.

However, although MUC 1-targeted tumor vaccines show considerable potential in clinical trials of some malignant tumors, due to the unstable clinical effects, some patients do not respond to MUC 1-targeted tumor vaccines or have weak effects, and thus these vaccines still do not enter the third-stage trial, so that there is an urgent need to improve the immunogenicity of MUC1, improve the antitumor immunity efficacy of MUC 1-immunogen-loaded tumor vaccines, and realize stronger activation of antitumor immunity.

Programmed death ligand 1 (PD-L1, B7-H1) is highly expressed on the surfaces of a plurality of tumor cells, and the programmed death ligand 1 and the receptor PD-1 thereof are a pair of main immune checkpoints for inhibiting anti-tumor T cell reaction, and the PD-L1 expressed on the tumor cells is combined with the PD-1 receptor on the surfaces of the T cells to lead to the depletion of effector T cells, thereby leading to the immune escape of the tumor cells and poor prognosis. Many studies have shown that monoclonal antibodies (MAbs) that specifically target PD-L1 or its receptor PD-1 block the inhibition of the PD-1/PD-L1 pathway on T cells, thereby enhancing cellular immune function in the body, and that many specific monoclonal antibodies have produced significant clinical effects in many different types of malignant tumors. However, researches show that the organism immunity has an anticancer mechanism, namely, the anticancer mechanism is realized by coupling effect of PD-L1 specific effector T cells, and the PD-L1 specific T cells can indirectly kill tumor cells by directly targeting killing or releasing cytokines. And after the PD-L1 specific T cells kill tumor cells, related tumor antigens can be released by the released factors or the cracked tumor cells so as to directly and indirectly enhance other T cell responses, thereby effectively enhancing the effect period of immune responses or directly regulating the immunogenicity of tumor vaccines, and further effectively enhancing the intensity of immune responses.

The way in which DC cells ingest antigens is largely divided into three types, phagocytosis, endocytosis and receptor-mediated endocytosis. The traditional method for loading antigen by tumor vaccine is to use DC cells pulsed by Tumor Associated Antigen (TAA) polypeptide when DC is cultured in vitro, the DC cells ingest the loaded TAA through liquid phase endocytosis or phagocytosis, and then the DC cells loaded with antigen fragments are returned into mice to induce antigen specific immune response. However, the effect of polypeptide pulsed DC cells in vivo is limited, since pulsed TAAs bind to MHC molecules only briefly after being pinocyted by the DC. And receptor-mediated endocytosis refers to the expression of FcgRs of immunoglobulin Fc segment on the surface of DC cells, and FcgRs can be combined with the Fc end of protein, so as to trigger activation of DC cells and promote up-regulation of surface molecules and cytokines in the antigen presentation process. This receptor-mediated endocytic pathway allows antigen-IgG complexes (immune complexes, ICs) to be efficiently captured, processed and presented to MHC-II by DCs, thereby strongly inducing Th cells and CTL cells. Activated Th cells can produce high levels of cytokines, directly controlling viral infection and tumor growth. Furthermore, fcgR mediated internalization can directly present antigen to MHC-I (cross priming), thereby activating CTLs, a receptor-mediated endocytosis that is 1000-10000 times more efficient than pinocytosis. Therefore, many scholars developed a new vaccine using this receptor-mediated endocytosis antigen uptake method, for example You et al developed a DNA vaccine expressing hepatitis B virus e antigen fused with IgG Fc, which was taken up by cells after vaccination, and then generated and secreted ICs, induced B cells while being taken up and processed by DC via receptor-mediated pathway, and as a result showed that this DNA vaccine strategy could widely enhance antigen-specific CD4 ⁺ Th and CD8 ⁺ A response of CTL and B cells; in recent years Chen et al designed a loadTumor vaccines of fusion peptide fragments of IgG Fc and PD-L1, and as a result, PDL1-IgG Fc-loaded tumor vaccines were found to be more effective in inducing an anti-PD-L1 immune response and inhibiting tumor growth than PD-L1 protein-loaded DC alone. However, single-target tumor vaccines have been tested for anti-tumor activity in a number of clinical trials, and overall clinical efficacy may be unsatisfactory due to insufficient immunogenicity of the antigen or insufficient capacity of DC cross-presentation of the antigen.

Disclosure of Invention

Based on the above, one of the purposes of the invention is to provide a MUC1-PDL1-IgG1Fc recombinant protein, wherein MUC1 and PD-L1 in the recombinant protein are combined to be used as target proteins for tumor vaccine anti-tumor, so that the antigen immunogenicity and the anti-tumor curative effect are improved.

The specific technical scheme for realizing the aim of the invention comprises the following steps:

a MUC1-PDL1-IgG1Fc recombinant protein has an amino acid sequence shown in SEQ ID NO. 1.

A MUC1-PDL1-IgG1Fc recombinant protein encoded by the nucleotide sequence shown in SEQ ID No. 2.

The invention also provides a preparation method of the MUC1-PDL1-IgG1Fc recombinant protein, which comprises the following steps:

(1) Synthesizing a fusion gene fragment containing the gene sequences of human MUC1, th stimulating epitope, PDL1, linker and IgG1 Fc; the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO. 2;

(2) Performing NdeI and XhoI double digestion on the fusion gene fragment and the pET-21a plasmid vector in the step (1), recovering a gel cutting purification kit, and connecting to obtain an expression plasmid pET-21a/MUC1-PDL1-IgG1 Fc;

(3) Transferring the expression plasmid pET-21a/MUC1-PDL1-IgG1Fc into BL21 (DE 3) expression strain, inducing with IPTG to obtain target protein, purifying, and dialyzing to obtain MUC1-PDL1-IgG1Fc recombinant protein.

The invention also provides application of the MUC1-PDL1-IgG1Fc recombinant protein in preparing tumor vaccine.

A tumor vaccine comprises an active ingredient of MUC1-PDL1-IgG1Fc recombinant protein.

In some of these embodiments, the tumor vaccine has an immune concentration of 1 x 10 ⁵ Individual DC cells 3 x 10 ⁵ And (3) DC cells.

In some of these embodiments, the tumor vaccine has an immune concentration of 1.5 x 10 ⁵ Individual DC cells 2.5 x 10 ⁵ And (3) DC cells.

The invention also provides a preparation method of the tumor vaccine.

A method of preparing a tumor vaccine, the method comprising the steps of:

(1) Adding 80-120 mu g/ml MUC1-PDL1-IgG1Fc recombinant protein into a culture medium for culturing dendritic cells, and culturing overnight;

(2) And then pulse-treating the dendritic cells with 45-55 mug/ml MUC1-PDL1-IgG1Fc recombinant protein for 1-3 h.

In some of these embodiments, the medium in step (1) is RPMI-1640 medium containing 20ng/ml GM-CSF and 20ng/ml recombinant mouse IL-4.

The invention also provides application of the tumor vaccine in preparing a medicine for treating solid tumors.

In some of these embodiments, the solid tumor is invasive lung cancer, pancreatic cancer, prostate cancer, epithelial ovarian cancer, primary lung cancer, or breast cancer.

In some of these embodiments, the solid tumor is pancreatic cancer.

Compared with the prior art, the invention has the following beneficial effects:

1. in the invention, a MUC1-PDL1-IgG1Fc recombinant protein is designed and successfully expressed, a tumor vaccine loaded with the recombinant protein takes a tumor-related antigen MUC1 as a target (the peptide segment of MUC1 is selected to be extracellular full length, more antigen sites can be included as far as possible, and a wider T cell reaction can be stimulated than that of only a certain antigen site sequence), an immune checkpoint PD-L1 fragment is fused (the immunogenicity of the tumor vaccine is improved, a tumor microenvironment is targeted, tumor-specific cytotoxic T cells of the PD-L1 are specifically targeted, an effective lymphocyte CTLs reaction is induced), igG1Fc is used as an adjuvant (the antigen peptide is combined with receptor FcR expressed on the DC surface through Fc to mediate internalization of antigen-IgG complex ICs, and promote efficient presentation of major histocompatibility complex MHC class II restriction antigens, more effectively activates Th and CTL to kill tumor), utilizes the function of DC cells to phagocytose, process and present cancer antigen to T cells and other immune cells, starts a strong cancer specific immune response, overcomes the defect of ineffective treatment of single check point inhibitor (MUC 1 single target or PDL1 single target), improves the anti-tumor immune efficacy, realizes stronger anti-tumor immune activation, provides a new effective strategy for the immune treatment of solid tumors such as other tumors (96.7% invasive lung cancer, 90% pancreas, prostate, epithelial ovarian cancer, 77% primary lung cancer and 70% breast cancer) which highly express MUC1 or PD-L1, has good safety and considerable prospect, and simultaneously promotes the drug development taking MUC1 as a target, these clearly bring new promise for cancer treatment.

2. The MUC1-PDL1-IgG1Fc recombinant protein is prepared by using a pET-21a/His prokaryotic system, and has the advantages of short time consumption, low cost and large protein quantity compared with a eukaryotic system method.

Drawings

FIG. 1 is a schematic diagram showing the structure of pET-21a/MUC1-PDL1-IgG1Fc expression plasmid constructed in example 1 of the present invention.

FIG. 2 is a SDS-PAGE pattern of MUC1-PDL1-IgG1Fc recombinant protein of example 2 of the present invention; wherein lane M is a pre-stained protein molecular weight marker, lane con P is a bacterial lysis pellet without IPTG induction, lane IPTG S is a bacterial lysis supernatant after 1mm IPTG induction, lane IPTG P is an insoluble protein fraction after 1mm IPTG induction free bacterial lysis, lane P is an insoluble protein fraction after IPTG induction bacterial lysis, and the arrow indicates the band as recombinant protein MUC1-PDL1-IgG1 Fc.

FIG. 3 is a SDS-PAGE pattern of a lysate, a permeate, and a purified MUC1-PDL1-IgG1Fc recombinant protein of example 3 of the present invention during purification of the MUC1-PDL1-IgG1Fc recombinant protein; wherein, lane M is a pre-dyed protein molecular weight marker, lane CL is a supernatant of 8M urea dissolved insoluble protein, lane FL is a purified protein flow-through, lane W is an eluted hetero protein fragment, and lane E is a purified MUC1-PDL1-IgG1Fc recombinant protein.

FIG. 4 shows the result of Westernblot analysis of MUC1-PDL1-IgG1Fc recombinant protein of FIG. 3 after electrophoresis on SDS-PAGE gel, membrane transfer using a gold-Style Blot L1 rapid wet transfer instrument, membrane cutting, incubation with His and anti-human MUC1 primary antibodies, respectively; wherein, lane M is a pre-stained protein molecular weight marker, and lane E is a purified MUC1-PDL1-IgG1Fc recombinant protein.

FIG. 5 is a SDS-PAGE pattern of MUC1-PDL1-IgG1Fc recombinant protein after dialysis treatment in example 3 of the present invention; wherein lane M is a pre-stained protein molecular weight marker and lane D is a dialyzed recombinant protein.

FIG. 6 is a flow chart of an experiment for immunizing mice with a MUC1-PDL1-IgG1Fc recombinant protein-loaded tumor vaccine in example 4 of the present invention.

FIG. 7 shows the detection of the expression of the DC specific markers CD11c and CD80 by flow cytometry in example 4 of the present invention.

FIG. 8 shows the detection of mouse CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ T cell ratio.

FIG. 9 shows the detection of mouse CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ T cell ratio.

FIG. 10 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IL-2 production in T cells.

FIG. 11 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN-gamma production in T cells.

FIG. 12 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN-gamma production in T cells.

FIG. 13 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Perforin production in T cellsFrequency.

Fig. 14 is a graph of tumor growth (n=4) of mice vaccinated with pancreatic cancer PANC02 in example 4 of the present invention.

Fig. 15 is a survival curve (n=4) of mice bearing pancreatic cancer PANC02 tumor cells after tumor vaccination in example 4 of the present invention.

FIG. 16 is an H & E staining analysis of liver and kidney sections of immunized mice in example 4 of the present invention.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Unless otherwise indicated, the experimental methods used in the examples of the present invention were conventional experimental methods, and the various reagent consumables used in the examples were all commercially available products.

In a first aspect of the present invention, there is provided a MUC1-PDL1-IgG1Fc recombinant protein, the fusion fragment of which comprises mucin MUC1, programmed death ligand 1 (PD-L1) and IgG1Fc, the amino acid sequence of which is shown in SEQ ID NO.1, encoded by the nucleotide sequence shown in SEQ ID NO. 2.

Amino acid sequence (SEQ ID NO.1)

MNALSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHAKFVAAWTLKAAAGSNGSGSGDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGKLEHHHHHH

Nucleotide sequence (SEQ ID NO. 2)

CATATGAACGCGCTGAGCACCGGCGTGAGCTTCTTTTTCCTGAGCTTTCACATCAGCAACCTGCAATTCAACAGCAGCCTGGAGGACCCGAGCACCGATTACTATCAGGAGCTGCAACGTGATATCAGCGAAATGTTTCTGCAGATTTACAAGCAAGGTGGCTTTCTGGGCCTGAGCAACATCAAATTCCGTCCGGGTAGCGTGGTTGTGCAGCTGACCCTGGCGTTTCGTGAGGGTACCATTAACGTGCACGACGTTGAAACCCAGTTCAACCAATACAAGACCGAGGCGGCGAGCCGTTATAACCTGACCATTAGCGACGTGAGCGTTAGCGATGTTCCGTTTCCGTTCAGCGCGCAAAGCTTTACCGTGACCGTTCCGAAAGATCTGTACGTTGTGGAATATGGCAGCAACATGACCATCGAGTGCAAGTTCCCGGTGGAAAAACAACTGGACCTGGCGGCGCTGATTGTTTACTGGGAGATGGAAGATAAGAACATCATTCAGTTCGTGCACGGCGAGGAAGACCTGAAAGTTCAGCACAGCAGCTATCGTCAACGTGCGCGTCTGCTGAAAGACCAGCTGAGCCTGGGTAACGCGGCGCTGCAGATCACCGACGTGAAACTGCAAGATGCGGGTGTTTACCGTTGCATGATCAGCTACGGTGGCGCGGATTATAAGCGTATTACCGTGAAAGTTAACGCGCCGTATAACAAGATCAACCAGCGTATTCTGGTTGTGGACCCGGTGACCAGCGAGCACGAACTGACCTGCCAAGCGGAGGGTTACCCGAAGGCGGAAGTGATTTGGACCAGCAGCGATCACCAGGTTCTGAGCGGTAAGACCACCACCACCAACAGCAAGCGTGAGGAAAAACTGTTTAACGTGACCAGCACCCTGCGTATCAACACCACCACCAACGAGATCTTCTACTGCACCTTCCGTCGTCTGGATCCGGAGGAAAACCACGCGAAGTTCGTTGCGGCGTGGACCCTGAAAGCGGCGGCGGGTCCGAACGGTAGCGGTAGCGGTGACAAAACCCATACCTGCCCGCCGTGCCCGGCGCCGGAACTGCTGGGTGGCCCGAGCGTTTTTCTGTTCCCGCCGAAGCCGAAAGATACCCTGATGATCAGCCGTACCCCGGAAGTGACCTGCGTTGTGGTTGACGTTAGCCACGAGGATCCGGAAGTGAAGTTCAACTGGTACGTGGACGGTGTGGAAGTTCACAACGCGAAGACCAAACCGCGTGAGGAACAGTACAACAGCACCTATCGTGTGGTTAGCGTGCTGACCGTTCTGCACCAAGACTGGCTGAACGGCAAAGAATATAAGTGCAAAGTGAGCAACAAGGCGCTGCCGGCGCCGATCGAAAAAACCATTAGCAAGGCGAAGGGTCAGCCGCGTGAGCCGCAAGTTTACACCCTGCCGCCGAGCCGTGAGGAAATGACCAAGAACCAAGTGAGCCTGACCTGCCTGGTTAAAGGCTTTTATCCGAGCGATATCGCGGTGGAGTGGGAAAGCAACGGTCAGCCGGAGAACAACTACAAAACCACCCCGCCGGTGCTGGACAGCGATGGCAGCTTTTTCCTGTATAGCAAGCTGACCGTTGACAAAAGCCGTTGGCAGCAGGGTAACGTGTTCAGCTGCAGCGTTATGCACGAAGCGCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCGGGTAAACTCGAG

In a second aspect of the present invention, there is provided a method for producing a MUC1-PDL1-IgG1Fc recombinant protein, comprising the steps of expression, purification and dialysis of the recombinant protein.

In a third aspect of the invention, there is provided the use of a MUC1-PDL1-IgG1Fc recombinant protein in the preparation of a tumor vaccine. MUC1-PDL1-IgG1Fc recombinant protein and dendritic cell DC pulse and immunize mice to play the role of anti-tumor immune response.

In a fourth aspect of the present invention, there is provided a tumor vaccine, wherein the active ingredient of the tumor vaccine is MUC1-PDL1-IgG1Fc recombinant protein.

In a fifth aspect of the invention, there is provided the use of a tumor vaccine as described above in the manufacture of a medicament for the treatment of solid tumors. The solid tumor is invasive lung cancer, pancreatic cancer, prostate cancer, epithelial ovarian cancer, platinum drug resistant tumor, primary lung cancer or breast cancer. More preferably pancreatic cancer.

The invention is described in detail below with reference to the drawings and the specific embodiments.

EXAMPLE 1 construction and characterization of pET-21a/MUC1-PDL1-IgG1Fc expression plasmid

This example constructed pET-21a/MUC1-PDL1-IgG1Fc expression plasmid and identified. The method specifically comprises the following steps:

(1) Designing a gene sequence containing human MUC1, th stimulating epitope, PDL1, linker and IgG1Fc, and synthesizing the gene fragment by Kirsrui biotechnology Co., ltd to obtain a fusion gene fragment; the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO. 2;

(2) Performing NdeI and XhoI double digestion on the fusion gene fragment obtained in the step (1) and the pET-21a plasmid vector, recovering a gel cutting purification kit, and inserting the fusion gene fragment into the pET-21a plasmid vector;

(3) And transforming DH5a escherichia coli by using a connection solution of the pET-21a plasmid vector inserted with the fusion gene fragment, and selecting 10 clones for PCR identification and sequencing identification.

The structure of the expression plasmid pET-21a/MUC1-PDL1-IgG1Fc constructed in this example is shown in FIG. 1, wherein PADRE in FIG. 1 is a Th-stimulating epitope.

EXAMPLE 2 inducible expression of recombinant proteins in pET-21a/MUC1-PDL1-IgG1Fc expression plasmid

Extracting and sequencing correct expression plasmid pET-21a/MUC1-PDL1-IgG1Fc, and dissolving in a proper amount of TE solution for later use. The plasmid was transferred into BL21 (DE 3) expressing strain. The specific method comprises the following steps:

(1) E.coli BL21 (DE 3) competent cells frozen at-80℃were removed, immediately placed on ice and transformed within 8min after thawing;

(2) Diluting 1uL plasmid (concentration is 0.48 ug/uL) with 11uL DEPC water for 12 times (final concentration of plasmid is 1 ng/uL), adding 2.5uL diluted plasmid into 100uL competent cells, gently mixing, incubating on ice for 30min, heat-shock for 45S at 42 ℃, and immediately placing on ice for 2min;

(3) Adding 700ul of non-antibiotic LB liquid culture medium preheated at 37 ℃ and carrying out shaking culture at 200rpm for 1h at 37 ℃ to enable the related resistance marker genes on the plasmids to be expressed and enable thalli to be revived; centrifuging at 5000rpm for 1 min, coating 100-200 μl of bacterial liquid on LB plate containing Amp (100 μg/ml), air drying at 37deg.C for 30min, and culturing for 12-16 hr;

(4) Single colonies were picked at the tip of the gun and inoculated into 5ml of LB liquid medium (containing 100. Mu.g/ml Amp) and cultured overnight at 37℃with shaking at 200 r/min. The next day, inoculating the bacterial liquid into 800ml LB liquid culture medium (containing 100 mu g/ml Amp), and shake culturing at 37 ℃ and 200rpm until OD600 = 0.6-0.8; 10ml of the culture broth was used as a control (not induced), IPTG was added to the remaining medium to a final concentration of 1mM, and the culture broth was collected in a centrifuge tube after shaking culture at 37℃for 6 hours.

(5) 5ml of each bacterial liquid was centrifuged in a centrifuge tube at 5000g to remove the supernatant, 1ml of 20mM Tris HCl (whole bacteria after induction) at pH7.5 was resuspended, and the whole bacteria sample before induction was treated in the same manner, and 40. Mu.L of 5XLoadingBuffer (reduction) was added, and the mixture was stirred, boiled for 5 minutes, centrifuged at 12000g for 5 minutes, and 10. Mu.L of the supernatant was subjected to SDS-PAGE.

The results are shown in FIG. 2, respectively. The results show that the pET-21a/MUC1-PDL1-IgG1Fc expression plasmid is expressed in inclusion form with the size of about 65.33kDa under the condition of IPTG induction or no IPTG, and the target protein (i.e. the recombinant protein MUC1-PDL1-IgG1 Fc) is consistent with the expected molecular weight.

EXAMPLE 3 purification of MUC1-PDL1-IgG1Fc recombinant protein

1. The culture broth from step (4) of example 2 was collected by centrifugation at 5000g at 4℃and then resuspended in sonication buffer (PBS, 1% Triton X-100,1mM EDTA, pH 7.4), the lysate sonicated 200 times at 400W power on ice (3 seconds each, 5 seconds apart) and then centrifuged at 15000g for 30 minutes before removing the supernatant, leaving the pellet, i.e., inclusion body protein.

2. MUC1-PDL1-IgG1Fc recombinant protein (carrying His tag) was purified by Ni-NTA column under denaturing conditions according to the instructions of the kit (Qiagen), the lysate, the flow-through and the eluate fraction were further analyzed by SDS-PAGE, as shown in the results of FIG. 3, lane M was Marker, lane CL was a protein solution sample of inclusion bodies dissolved with 8M urea, lane FT was a flow-through sample of proteins flowing out from the column after being fed to the purification column, lanes W1 and W3 were wash solution samples containing the bacterial hybrid proteins, and lanes E1, 2, 4, 6, 8 were eluted protein solution samples of interest. After purification by the Ni column, compared with the lysate CL and the flow-through liquid FT, the content of the impurity proteins in the eluent (E1, 2, 4, 6 and 8) is obviously reduced, thus achieving the purpose of purification.

3. Taking a part of samples of the purified protein for Westernblot analysis, and specifically comprising the following steps of:

(1) Protein electrophoresis (12% SDS-PAGE) was performed at 50. Mu.g per lane, and the proteins after electrophoresis were transferred onto nitrocellulose membranes (Pall Corporation) using a gold Rui eBlotL1 fast wet transfer instrument.

(2) Membranes were blocked with 5% nonfat dry milk for 1 hour at room temperature and then washed 3 times with PBST.

(3) The goat anti-mouse secondary antibody (Biyundian A0216) is hybridized with the primary anti-His antibody and the primary anti-human MUC1 antibody at 4 ℃ for 1 hour at room temperature after washing the membrane 5 times with PBST the next day and then washing the membrane 5 times with PBST.

(4) Analysis was performed by exposure to Amersham Imager 680.

As a result, as shown in FIG. 4, there was a protein band capable of binding to both antibodies around the predicted molecular weight (65.33 kDa), and thus it was considered that the target protein MUC1-PDL1-IgG1Fc had been successfully expressed and purified.

4. In order to maintain physiological consistency, the eluted fraction after purification in step two was further dialyzed with a dialysis bag, replacing the 8M urea solution of the dissolved protein with PBS solution. The dialyzed protein solution was concentrated by ultrafiltration using an ultrafiltration tube. The concentrated protein solution was quantitatively analyzed by BCA kit (Thermo; IH 117217) to detect the protein concentration. After SDS-Page, coomassie brilliant blue and Westernblot analysis are carried out on the dialyzed protein, his primary antibody is selected as the Western blot primary antibody, as shown in figure 5, the SDS-PAGE Coomassie brilliant blue staining result and the Western blot His primary antibody result of the dialyzed MUC1-PDL1-IgG1Fc recombinant protein are both provided with a band with equivalent molecular weight, and the protein is successfully prepared.

Using the purification method of this example, about 20mg of high purity MUC1-PDL1-IgG1Fc recombinant protein was obtained from 800mL of bacterial culture for further functional identification.

EXAMPLE 4 therapeutic Effect of MUC1-PDL1-IgG1Fc recombinant protein-loaded tumor vaccine on pancreatic cancer

In the embodiment, firstly, DC (dendritic cell) vaccine loaded by MUC1-PDL1-IgG1Fc recombinant protein, DC (dendritic cell) vaccine loaded by PBS (as a control) and DC (dendritic cell) vaccine loaded by PDL1-IgG1Fc recombinant protein (the preparation method is the same as that of MUC1-PDL1-IgG1Fc recombinant protein) are obtained through MUC1-PDL1-IgG1Fc recombinant protein pulse DC, and then the DC (dendritic cell) vaccine is used for immunizing mice, detecting secretion of mouse spleen cells IL-2, IFN-gamma and performin, measuring growth conditions of tumors, and detecting and analyzing liver and kidney injury conditions in an anti-tumor process.

1. Preparation of tumor vaccine

The method comprises the following steps:

1. the leg bones of both legs of the C57BL/6 mice were separated, bone marrow of the mice was flushed out of the leg bones with PBS by sucking with a 1ml syringe, the bone marrow cell suspension was passed through a 70um cell sieve, and erythrocytes were lysed with ammonium chloride. After extensive washing with RPMI-1640, bone marrow cells were resuspended in RPMI-1640 supplemented with 10% FBS, mGM-CSF (20 ng/ml; peprotech) and recombinant mouse IL-4 (10 ng/ml; peprotech). The supernatant was replaced every 2 days with fresh RPMI-1640 medium containing 20ng/ml rmGM-CSF and 10ng/ml recombinant mouse IL-4.

2. All cultures were incubated in 5% humidified carbon dioxide at 37 ℃. On the 7 th day of culture, purified and dialyzed MUC1-PDL1-IgG1Fc recombinant protein is added into a DC cell culture medium to make the final concentration of the recombinant protein be 100ug/mL, so that the DC cells load the recombinant protein, and the control group is to add the same volume of PBS and the same concentration of PDL1-IgG1Fc protein into the DC cell culture medium. Bacterial lipopolysaccharide was added to a concentration of 1ug/ml (LPS; sigma) after 4 hours and incubation was continued for 1 day, stimulating DC maturation.

After 8 days of incubation, the DC specific markers (CD 11c, CD 80) were measured by flow cytometry (FACS), and as shown in FIG. 7, the maturation degree of CD11c, CD80 in DC cells added with PBS, PDL1-IgG1Fc and MUC1-PDL1-IgG1Fc was more than 60%, as can be seen from FIG. 7.

2. Therapeutic effect of tumor vaccine on pancreatic cancer

Referring to fig. 6, a flow chart of immunization of mice with the tumor vaccine prepared in this example is shown.

Subcutaneously vaccinating 6-8 weeks C57BL/6 mice with PANC02 (3×10) which stably expresses exponentially growing mouse pancreatic cancer cells of human MUC1-PDL1 ⁶ Cells/mouse), after one week, C57BL/6 mice were randomly divided into 3 groups (8 per group), each:

1) PBS-DCs control group (i.e., PBS-loaded dendritic cells)

2) PDL1-IgG1Fc-DCs control (i.e., PDL1-IgG1Fc protein-loaded dendritic cells)

3) MUC1-PDL1-IgG1Fc-DCs (i.e., dendritic cells loaded with MUC1-PDL1-IgG1Fc recombinant protein)

PBS-DCs were injected via tail vein on day 0 and day 7, respectively (100. Mu.g/ml, 2X 10) ⁵ DC cells/cell), PDL1-IgG1Fc-DCs (100. Mu.g/ml, 2X 10) ⁵ DC cells/only) andMUC1-PDL1-IgG1Fc-DCs(100μg/ml，2×10 ⁵ DC cells/only).

Each group of 8 mice, 4 of which were used to detect cellular immune responses in the body and 4 of which were used to observe tumor curves and survival.

1. Tumor vaccine loaded by MUC1-PDL1-IgG1Fc recombinant protein induces mouse spleen cell IL-2 and IFN-gamma Secretion of

After 6 days of the second inoculation, the spleen of the immunized mice was isolated, digested into single cell suspension, plated in 24-well plates, then PMA50ng/ml, ion1ug/ml and BFA2ug/ml were added, and after 5 hours of culture, T cells in the spleen of the mice were detected using intracellular staining and flow cytometry.

Antibodies used were from BDbiosciences, including FITC anti-mouse, CD3, PE anti-mouse CD4, PE anti-mouse CD8a, PE-Cy7 anti-mouse IL-2, APC anti-mouse IFN-gamma, APC anti-mouse Perforin. Immobilized reactive dyes are purchased from Thermofisher. All data were collected on a BDFACS/Verse (BDFACS/Verse flow cytometer at the national focus laboratory of respiratory disease, guangzhou medical science, guangdong, china) and analyzed using Flowjo software.

The results are shown in FIGS. 8 and 9, and CD4 in spleen cells of mice immunized with MUC1-PDL1-IgG1Fc-DCs are compared with PBS-DCs control and PDL1-IgG1Fc-DCs control ⁺ And CD8 ⁺ There is a significant increase. CD4 ⁺ IFN-gamma and IL-2 secreted by T cells and CD8 ⁺ The frequency of IFN-gamma and Perforin secreted by T cells was significantly increased (FIGS. 10-11 and 12-13).

These results clearly demonstrate that MUC1-PDL1-IgG1Fc loaded tumor vaccines promote IFN-gamma, IL-2 and performin production and produce good CTL inducibility.

2. The MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine can obviously inhibit tumor growth

To verify the efficacy of MUC1-PDL1-IgG1Fc recombinant protein-loaded tumor vaccines, the following experiments were performed:

after 6 days of the second inoculation, tumor cell inoculation was established, tumor size was measured with calipers every 6 days, tumor growth was monitored, and growth curves were calculated.

Tumor volumes were calculated as follows: 0.5 x (longest diameter) x (shortest diameter) ²

As shown in fig. 14 and 15, the MUC1-PDL1-IgG1Fc-DCs vaccinated group was more effective in delaying tumor growth (fig. 14) and improving survival of tumor-bearing mice and prolonging survival of mice (fig. 15) compared to the PBS-DCs control group and PDL1-IgG1Fc-DCs control group.

These data indicate that the MUC1-PDL1-IgG1Fc recombinant protein tumor vaccine of the present invention may be a more effective therapeutic vaccine compared to conventional DC-targeting protein vaccines, MUC1 enhances the effect of T cell targeted killing of tumors, and PDL1 and IgG1Fc assist enhances the effect of tumor vaccine.

3. Liver and kidney injury detection analysis in anti-tumor process of MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine

To further verify whether the antitumor effect of MUC1-PDL1-IgG1Fc recombinant protein-loaded tumor vaccine could damage liver and kidney tissue cells of mice, livers and kidneys were isolated from mice immunized with MUC1-PDL1-IgG1Fc-DCs, PDL1-IgG1Fc-DCs and PBS-DCs, placed in isopentane, and flash frozen with liquid nitrogen. Tissue sections were performed according to standard protocols.

Briefly, frozen tissue was cut at-20 ℃ (5 μm thick) and then immediately transferred to a mini-slide box stored on dry ice and at-80 ℃. The slides were air dried, fixed with formalin and then embedded in paraffin. H & E staining was done at the pathology center at university of guangzhou medical science.

The results show that the H & E staining of the section analysis does not detect positive markers in cytoplasm of liver and kidney (as shown in FIG. 16), which indicates that the MUC1-PDL1-IgG1Fc recombinant protein-loaded tumor vaccine of the invention induces effective anti-tumor CTL reaction, does not attack adjacent immune tissues, and does not damage liver and kidney in the anti-tumor process.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> university of medical science in Guangzhou

<120> MUC1-PDL1-IgG1Fc tumor vaccine, and preparation method and application thereof

<130> 1

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 578

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Asn Ala Leu Ser Thr Gly Val Ser Phe Phe Phe Leu Ser Phe His

1 5 10 15

Ile Ser Asn Leu Gln Phe Asn Ser Ser Leu Glu Asp Pro Ser Thr Asp

20 25 30

Tyr Tyr Gln Glu Leu Gln Arg Asp Ile Ser Glu Met Phe Leu Gln Ile

35 40 45

Tyr Lys Gln Gly Gly Phe Leu Gly Leu Ser Asn Ile Lys Phe Arg Pro

50 55 60

Gly Ser Val Val Val Gln Leu Thr Leu Ala Phe Arg Glu Gly Thr Ile

65 70 75 80

Asn Val His Asp Val Glu Thr Gln Phe Asn Gln Tyr Lys Thr Glu Ala

85 90 95

Ala Ser Arg Tyr Asn Leu Thr Ile Ser Asp Val Ser Val Ser Asp Val

100 105 110

Pro Phe Pro Phe Ser Ala Gln Ser Phe Thr Val Thr Val Pro Lys Asp

115 120 125

Leu Tyr Val Val Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe

130 135 140

Pro Val Glu Lys Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu

145 150 155 160

Met Glu Asp Lys Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp Leu

165 170 175

Lys Val Gln His Ser Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp

180 185 190

Gln Leu Ser Leu Gly Asn Ala Ala Leu Gln Ile Thr Asp Val Lys Leu

195 200 205

Gln Asp Ala Gly Val Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp

210 215 220

Tyr Lys Arg Ile Thr Val Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn

225 230 235 240

Gln Arg Ile Leu Val Val Asp Pro Val Thr Ser Glu His Glu Leu Thr

245 250 255

Cys Gln Ala Glu Gly Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser

260 265 270

Asp His Gln Val Leu Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg

275 280 285

Glu Glu Lys Leu Phe Asn Val Thr Ser Thr Leu Arg Ile Asn Thr Thr

290 295 300

Thr Asn Glu Ile Phe Tyr Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu

305 310 315 320

Asn His Ala Lys Phe Val Ala Ala Trp Thr Leu Lys Ala Ala Ala Gly

325 330 335

Ser Asn Gly Ser Gly Ser Gly Asp Lys Thr His Thr Cys Pro Pro Cys

340 345 350

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

355 360 365

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

370 375 380

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

385 390 395 400

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

405 410 415

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

420 425 430

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

435 440 445

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

450 455 460

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

465 470 475 480

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

485 490 495

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

500 505 510

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

515 520 525

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

530 535 540

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

545 550 555 560

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Leu Glu His His His His

565 570 575

His His

<210> 2

<211> 1719

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

catatgaacg cgctgagcac cggcgtgagc ttctttttcc tgagctttca catcagcaac 60

ctgcaattca acagcagcct ggaggacccg agcaccgatt actatcagga gctgcaacgt 120

gatatcagcg aaatgtttct gcagatttac aagcaaggtg gctttctggg cctgagcaac 180

atcaaattcc gtccgggtag cgtggttgtg cagctgaccc tggcgtttcg tgagggtacc 240

attaacgtgc acgacgttga aacccagttc aaccaataca agaccgaggc ggcgagccgt 300

tataacctga ccattagcga cgtgagcgtt agcgatgttc cgtttccgtt cagcgcgcaa 360

agctttaccg tgaccgttcc gaaagatctg tacgttgtgg aatatggcag caacatgacc 420

atcgagtgca agttcccggt ggaaaaacaa ctggacctgg cggcgctgat tgtttactgg 480

gagatggaag ataagaacat cattcagttc gtgcacggcg aggaagacct gaaagttcag 540

cacagcagct atcgtcaacg tgcgcgtctg ctgaaagacc agctgagcct gggtaacgcg 600

gcgctgcaga tcaccgacgt gaaactgcaa gatgcgggtg tttaccgttg catgatcagc 660

tacggtggcg cggattataa gcgtattacc gtgaaagtta acgcgccgta taacaagatc 720

aaccagcgta ttctggttgt ggacccggtg accagcgagc acgaactgac ctgccaagcg 780

gagggttacc cgaaggcgga agtgatttgg accagcagcg atcaccaggt tctgagcggt 840

aagaccacca ccaccaacag caagcgtgag gaaaaactgt ttaacgtgac cagcaccctg 900

cgtatcaaca ccaccaccaa cgagatcttc tactgcacct tccgtcgtct ggatccggag 960

gaaaaccacg cgaagttcgt tgcggcgtgg accctgaaag cggcggcggg tccgaacggt 1020

agcggtagcg gtgacaaaac ccatacctgc ccgccgtgcc cggcgccgga actgctgggt 1080

ggcccgagcg tttttctgtt cccgccgaag ccgaaagata ccctgatgat cagccgtacc 1140

ccggaagtga cctgcgttgt ggttgacgtt agccacgagg atccggaagt gaagttcaac 1200

tggtacgtgg acggtgtgga agttcacaac gcgaagacca aaccgcgtga ggaacagtac 1260

aacagcacct atcgtgtggt tagcgtgctg accgttctgc accaagactg gctgaacggc 1320

aaagaatata agtgcaaagt gagcaacaag gcgctgccgg cgccgatcga aaaaaccatt 1380

agcaaggcga agggtcagcc gcgtgagccg caagtttaca ccctgccgcc gagccgtgag 1440

gaaatgacca agaaccaagt gagcctgacc tgcctggtta aaggctttta tccgagcgat 1500

atcgcggtgg agtgggaaag caacggtcag ccggagaaca actacaaaac caccccgccg 1560

gtgctggaca gcgatggcag ctttttcctg tatagcaagc tgaccgttga caaaagccgt 1620

tggcagcagg gtaacgtgtt cagctgcagc gttatgcacg aagcgctgca caaccactac 1680

acccagaaga gcctgagcct gagcccgggt aaactcgag 1719

Claims

1. The MUC1-PDL1-IgG1Fc recombinant protein is characterized in that the amino acid sequence of the recombinant protein is shown as SEQ ID NO. 1.

2. The MUC1-PDL1-IgG1Fc recombinant protein of claim 1, wherein said recombinant protein is encoded by a nucleotide sequence as set forth in SEQ ID No. 2.

3. Use of a MUC1-PDL1-IgG1Fc recombinant protein according to claim 1 or 2 for the preparation of a pancreatic cancer vaccine.

4. The method for preparing a MUC1-PDL1-IgG1Fc recombinant protein according to claim 1 or 2, comprising the steps of:

5. A tumor vaccine, wherein the tumor vaccine is a DC cell loaded with MUC1-PDL1-IgG1Fc recombinant protein, and the tumor is pancreatic cancer.

6. The tumor vaccine of claim 5, wherein the tumor vaccine has an immune concentration of 1 x 10 ⁵ Individual DC cells 3 x 10 ⁵ And (3) DC cells.

7. The tumor vaccine of claim 6, wherein the tumor vaccine has an immune concentration of 1.5 x 10 ⁵ Individual DC cells 2.5 x 10 ⁵ And (3) DC cells.

8. A method of preparing a tumour vaccine according to any of claims 5 to 7, characterised in that the method comprises the steps of:

(1) Adding 80-120 mug/ml MUC1 into the culture medium for culturing dendritic cells

-PDL1-IgG1Fc recombinant protein overnight;

(2) And then pulse-treating the dendritic cells with the MUC1-PDL1-IgG1Fc recombinant protein of 45-55 mug/ml for 1-3 h.

9. Use of a tumor vaccine according to any one of claims 5 to 7 in the manufacture of a medicament for the treatment of pancreatic cancer.