CN114790248A

CN114790248A - MUC1-PDL1-IgG1Fc tumor vaccine as well as preparation method and application thereof

Info

Publication number: CN114790248A
Application number: CN202210519575.9A
Authority: CN
Inventors: 刘辉; 潘嘉怡; 曾无艺; 贾江涛; 房子轩; 施意
Original assignee: Guangzhou Medical University
Current assignee: Guangzhou Medical University
Priority date: 2022-05-12
Filing date: 2022-05-12
Publication date: 2022-07-26
Anticipated expiration: 2042-05-12
Also published as: CN114790248B

Abstract

The invention discloses a MUC1-PDL1-IgG1Fc tumor vaccine, a preparation method and an application thereof, wherein the amino acid sequence of MUC1-PDL1-IgG1Fc recombinant protein of the tumor vaccine is shown as SEQ ID NO. 1. The tumor vaccine of the invention starts a strong cancer specific immune response by utilizing the function that DC cells can phagocytose, process and present cancer antigens to T cells and other immune cells, thereby overcoming the defect that a single checkpoint inhibitor is ineffective in treatment, improving the anti-tumor immune efficacy, realizing stronger anti-tumor immune activation, providing a new effective strategy for immunotherapy of solid tumors such as other tumors highly expressing MUC1 or PD-L1 and the like, having good safety and considerable prospects, and simultaneously promoting the development of medicaments taking MUC1 as a target, which undoubtedly brings new hopes for the treatment of cancers.

Description

MUC1-PDL1-IgG1Fc tumor vaccine as well as preparation method and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to MUC1-PDL1-IgG1Fc recombinant protein, a tumor vaccine prepared from the MUC1-PDL1-IgG1Fc recombinant protein, and a preparation method and application thereof.

Background

Malignant tumors have a high incidence and mortality worldwide and constitute a considerable threat to human health. The traditional treatment methods of malignant tumors include operations, radiotherapy, chemotherapy and targeted therapy, and the several treatment methods have respective advantages and disadvantages. Surgery does not always completely remove tumor cells, and recent studies have shown that the wound healing response after surgery may lead to the growth of metastatic tumors. Radiotherapy and chemotherapy are easy to cause tumor cell tolerance and relapse, and poor prognosis is caused. While targeted therapy has the advantage of specificity. Early clinical trials in various tumor types showed that single molecule targeted therapy had higher response and survival rates than other therapies.

The therapeutic tumor vaccine is also one kind of target therapy, and its principle is different from general preventive vaccine, and the tumor vaccine is used for inoculation of malignant tumor patient, and is supplemented with proper adjuvant so as to activate patient's autoimmune reaction and kill tumor cell. Mutations in tumor cells alter the amino acid sequence of proteins, which are then translated and processed into short peptides, termed tumor neoantigens. As non-self antigens, new antigens are phagocytosed, processed and presented by DC cells, activating T cells and other immune cells, and then triggering the body's specific anti-tumor immune response, and thus tumor vaccines have been the focus of developing therapeutic cancer vaccines.

The use of tumor vaccines has been widely studied and the method of preparation involves the isolation or in vitro generation and expansion of autologous DCs, followed by in vitro manipulation and reinfusion into the patient. The only current tumor vaccine approved by the FDA, namely SiPuleucel-T (Provenge; Dendreon), is composed of autologous blood APCs loaded with recombinant fusion protein antigens composed of Prostatic Acid Phosphatase (PAP) and GM-CSF, and is used for the treatment of asymptomatic or asymptomatic castration-resistant prostate cancer, which can prolong patient survival.

The source, type and kind of tumor antigens play a key role in the anti-tumor immune efficacy of tumor vaccines. Like the Prostatic Acid Phosphatase (PAP) used by SiPuleucel-T, PAP is expressed specifically and locally in prostate cancer and is therefore considered to be a candidate molecule for the development of therapeutic vaccines for prostate cancer. With the development of tumor immunotherapy, more and more targets are introduced into tumor therapy technologies, including mucin (MUC1), epidermal growth factor receptor 2(HER2) of breast cancer, Mesothelin (MSLN), epidermal growth factor receptor type III mutant (EGFRvIII), and the like, and the discovery and introduction of these targets lay the foundation for the development of immunocytotherapy and the treatment of solid tumors.

Mucin MUC1 is a highly glycosylated transmembrane protein consisting of an intracellular C-terminal fragment, a single-pass transmembrane domain and an extracellular N-terminal domain (MUC1-N), MUC1-N is a tandem repeat sequence of a variable number of 20 amino acids (VNTR, HGVTSAPDTRPAPPA) that can be repeated 20-120 times. It is normally expressed on the apical and basolateral surfaces of most secretory glandular epithelia, but is occluded by mesenchymal cells and skin epithelium. The shift from normal to malignant phenotypes of human cancers has been associated with abnormal cell surface glycosylation. MUC1 is overexpressed in tumor cells and abnormally glycosylated, and MUC1 expressed by such tumor cells is referred to as TA-MUC1 or low glycosylated mucin-1 (UMUC 1). It is somewhat different from the antigenic site of MUC1 expressed by normal cells, in that normal cells MUC1 is modified by glycosylation, so that immunogenic epitopes in the VNTR region are covered, whereas the abnormal aglycosylation of TA-MUC1 exposes these immunogenic epitopes to the immune system. Thus, novel glycopeptide antigens are produced in tumor cells. TA-MUC1 generally leads to irreversible apoptosis, T cell suppression and poor prognosis of the cell. TA-MUC1 is highly expressed in many tumors, including 96.7% invasive lung cancer, 90% pancreatic, prostate, epithelial ovarian and platinum-resistant tumors, 77% primary lung cancer and 70% breast cancer. The widespread distribution of TA-MUC1 on tumor cells has made MUC 1a widely explored target in many diagnostic and immunotherapeutic approaches. Based on certain criteria, such as therapeutic function, immunogenicity, and cancer cell specificity, MUC1 was listed by the american national cancer institute translation research working group as the second most promising cancer research target on the list of 75 tumor-associated antigens.

MUC 1-based cancer vaccines include subunit vaccines, DNA vaccines, viral vaccines, Dendritic Cell (DC) vaccines, glycopeptide vaccines, and the like. To date, a number of researchers have investigated the role of DC vaccine against MUC1 in anti-tumor therapy, such as in pancreatic cancer, and MUC 1-targeted tumor vaccines for postoperative adjuvant therapy exert significant anti-tumor effects and show good safety and tolerability, with 33% of patients achieving relapse-free survival in four-year-old clinical trials. Another phase II clinical trial of the autologous tumor vaccine carrying MUC1 mannatide shows that 15% of patients with progressive epithelial ovarian cancer have a lasting response, and similarly, a tumor vaccine which is designed by Teramoto et al and takes MUC1 as a target successfully induces MUC1 specific anti-tumor immune response, thereby prolonging the life cycle of patients with refractory non-small cell lung cancer. Therefore, the MUC 1-based tumor vaccine has great potential for anti-tumor application.

However, although the tumor vaccine targeting MUC1 has shown considerable potential in clinical trials of some malignant tumors, because of unstable clinical effects, some patients have no response or weak effect to the tumor vaccine targeting MUC1, and therefore these vaccines have not yet entered the third stage trial, there is an urgent need to improve the immunogenicity of MUC1, improve the anti-tumor immunity efficacy of the tumor vaccine loaded with MUC1 immunogen, and achieve stronger activation of anti-tumor immunity.

Programmed death ligand 1(PD-L1, B7-H1) is highly expressed on the surface of a plurality of tumor cells, is a pair of main immune check points for inhibiting anti-tumor T cell response together with the receptor PD-1, and the binding of PD-L1 expressed on the tumor cells and the PD-1 receptor on the surface of the T cells leads to the exhaustion of effector T cells, thereby leading to the immune escape of the tumor cells and having poor prognosis. Many studies have shown that monoclonal antibodies (MAbs) specifically targeting PD-L1 or its receptor PD-1 block the inhibitory effect of the PD-1/PD-L1 pathway on T cells, thereby enhancing the cellular immune function of the body, and that many specific MAbs have produced significant clinical effects in many different types of malignant tumors. However, it has been shown that there is an anticancer mechanism of body immunity through the specific effector T cell coupling of PD-L1, and the specific T cell of PD-L1 can kill tumor cells indirectly through direct target killing or cytokine release. And after the PD-L1 specific T cells kill tumor cells, relevant tumor antigens can be released through releasing factors or the cracked tumor cells so as to directly and indirectly enhance other T cell reactions, thereby effectively enhancing the effect period of immune reactions, or directly regulating the immunogenicity of tumor vaccines, thereby effectively enhancing the strength of immune reactions.

The modes of antigen uptake by DC cells are mainly divided into three, phagocytosis, pinocytosis and receptor-mediated endocytosis. The traditional method for loading antigen by tumor vaccine is that DC cell pulsed by Tumor Associated Antigen (TAA) polypeptide is cultured in vitro, the DC cell absorbs the loaded TAA by liquid phase endocytosis or phagocytosis, and then the DC cell loaded with antigen fragment is returned to the mouse to induce antigen specific immune reaction. However, the efficacy of polypeptide pulsed DC cells in vivo is limited because the pulsed TAAs are only transiently bound to MHC molecules after endocytosis by DC. The receptor-mediated endocytosis refers to that the Fc segment of immunoglobulin is expressed on the surface of a DC cell, and FcgRs can be combined with the Fc end of protein, so that the DC cell activation is triggered, and the up-regulation of surface molecules and cytokines in the antigen presentation process is promoted. The receptor-mediated endocytosis pathway can make antigen-IgG complex (immune complex, ICs) be effectively captured by DC,Processed and presented to MHC-II, thereby potently inducing Th cells and CTL cells. Activated Th cells can produce high levels of cytokines, thereby directly controlling viral infection and tumor growth. In addition, FcgR-mediated internalization of ICs can directly present antigen to MHC-I (cross-priming) to activate CTL, and the receptor-mediated endocytosis mode is 1000-fold more efficient than pinocytosis. Therefore, many scholars developed novel vaccines by utilizing the receptor-mediated endocytosis antigen uptake mode, for example, You et al developed a DNA vaccine expressing the IgG Fc fused hepatitis B virus e antigen, which was taken up by cells after vaccination, then produced and secreted ICs, induced B cells and simultaneously taken up and processed by DC through the receptor-mediated pathway, and the result showed that the DNA vaccine strategy can widely enhance antigen-specific CD4 ⁺ Th and CD8 ⁺ CTL and B cell responses; recently, Chen et al designs a tumor vaccine loaded with IgG Fc and PD-L1 fusion peptide fragments, and found that the PDL1-IgG Fc-loaded tumor vaccine is more effective in inducing anti-PD-L1 immune response and inhibiting tumor growth than DC loaded with PD-L1 protein alone. However, single-target tumor vaccines have been tested against tumors in a number of clinical trials, and overall clinical efficacy is unsatisfactory, probably due to insufficient immunogenicity of the antigen or insufficient ability of DCs to cross-present the antigen.

Disclosure of Invention

Based on the situation, one of the purposes of the invention is to provide the MUC1-PDL1-IgG1Fc recombinant protein, and in the recombinant protein, MUC1 and PD-L1 are combined to be used as a target protein of a tumor vaccine for tumor resistance, so that the antigen immunogenicity and the anti-tumor curative effect are improved.

The specific technical scheme for realizing the aim of the invention comprises the following steps:

the MUC1-PDL1-IgG1Fc recombinant protein has an amino acid sequence shown in SEQ ID NO. 1.

A MUC1-PDL1-IgG1Fc recombinant protein, wherein the recombinant protein is encoded by a nucleotide sequence shown in SEQ ID NO. 2.

The invention also provides a preparation method of the MUC1-PDL1-IgG1Fc recombinant protein, which comprises the following steps:

(1) synthesizing a fusion gene fragment containing the gene sequences of human MUC1, Th stimulating epitope, PDL1, linker and IgG1 Fc; the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO. 2;

(2) carrying out NdeI and XhoI double enzyme digestion on the fusion gene fragment in the step (1) and the pET-21a plasmid vector, recovering a gel cutting purification kit, and connecting to obtain an expression plasmid pET-21a/MUC1-PDL1-IgG1 Fc;

(3) transferring the expression plasmid pET-21a/MUC1-PDL1-IgG1Fc into a BL21(DE3) expression strain, inducing by IPTG to obtain a target protein, and purifying and dialyzing to obtain the MUC1-PDL1-IgG1Fc recombinant protein.

The invention also provides application of the MUC1-PDL1-IgG1Fc recombinant protein in preparation of a tumor vaccine.

A tumor vaccine comprises an active component of MUC1-PDL1-IgG1Fc recombinant protein.

In some of these embodiments, the tumor vaccine has an immunogenic concentration of 1 x 10 ⁵ DC cells 3 x 10 ⁵ And (4) DC cells.

In some of these embodiments, the tumor vaccine has an immunogenic concentration of 1.5 x 10 ⁵ DC cells 2.5 x 10 ⁵ And (4) DC cells.

The invention also provides a preparation method of the tumor vaccine.

A method of preparing a tumor vaccine, the method comprising the steps of:

(1) adding MUC1-PDL1-IgG1Fc recombinant protein into a culture medium in which dendritic cells are cultured, and culturing overnight, wherein the MUC1-PDL1-IgG1Fc recombinant protein is 80-120 mu g/ml;

(2) and then pulse-treating the dendritic cells for 1-3 h by using MUC1-PDL1-IgG1Fc recombinant protein with the concentration of 45-55 mu g/ml to obtain the antigen.

In some of these embodiments, the medium in step (1) is RPMI-1640 medium containing 20ng/ml GM-CSF and 20ng/ml recombinant mouse IL-4.

The invention also provides application of the tumor vaccine in preparation of a medicament for treating solid tumors.

In some of these embodiments, the solid tumor is aggressive lung cancer, pancreatic cancer, prostate cancer, epithelial ovarian cancer, primary lung cancer, or breast cancer.

In some of these embodiments, the solid tumor is pancreatic cancer.

Compared with the prior art, the invention has the following beneficial effects:

1. in the invention, MUC1-PDL1-IgG1Fc recombinant protein is designed and successfully expressed, a tumor vaccine loaded with the recombinant protein takes a tumor-related antigen MUC1 as a target (the peptide segment of MUC1 is selected from extracellular full length, can contain more antigen sites as far as possible, can stimulate wider T cell reaction than a certain antigen site sequence), an immune checkpoint PD-L1 segment is fused (the immunogenicity of the tumor vaccine is improved, the tumor microenvironment is targeted, tumor-specific cytotoxic T cells specifically targeted to PD-L1 are activated, and effective lymphocyte CTLs reaction is induced), IgG1Fc is taken as an adjuvant (the antigen peptide is combined with receptor FcR expressed on the surface of DC through Fc, the internalization of antigen-IgG compound ICs is mediated, the high-efficiency compatibility presentation of major tissue compound MHC class II restricted antigens is promoted, and CTL is more effectively activated, thereby killing tumors), and a strong cancer-specific immune response is initiated by utilizing the function that DC cells can phagocytize, process and present cancer antigens to T cells and other immune cells, so that the defect that a single checkpoint inhibitor (MUC1 single target or PDL1 single target) is ineffective in treatment is overcome, the anti-tumor immune efficacy is improved, stronger anti-tumor immune activation is realized, a new effective strategy is provided for solid tumor immunotherapy of other tumors (96.7% of invasive lung cancer, 90% of pancreas, prostate, epithelial ovarian cancer, 77% of primary lung cancer and 70% of breast cancer) highly expressing MUC1 or PD-L1, and the like, the novel effective strategy has good safety and considerable prospects, and simultaneously, the development of medicaments using MUC1 as targets is promoted, and the novel hope is undoubtedly brought for the cancer treatment.

2. The MUC1-PDL1-IgG1Fc recombinant protein is prepared by using a pET-21a/His prokaryotic system, and compared with a eukaryotic system method, the recombinant protein is short in time consumption, low in cost and large in obtained protein amount.

Drawings

FIG. 1 is a schematic structural diagram of pET-21a/MUC1-PDL1-IgG1Fc expression plasmid constructed in example 1 of the present invention.

FIG. 2 is an SDS-PAGE pattern of MUC1-PDL1-IgG1Fc recombinant protein in example 2 of the present invention; wherein, Lane M is the pre-stained protein molecular weight marker, Lane con P is the bacterial lysis precipitate without IPTG induction, Lane IPTG S is the bacterial lysis supernatant without 1mm IPTG induction, Lane IPTG P is the insoluble protein part without 1mm IPTG induction after bacterial lysis, Lane P is the insoluble protein part without IPTG induction after bacterial lysis, and the arrow indicates that the band is the recombinant protein MUC1-PDL1-IgG1 Fc.

FIG. 3 is an SDS-PAGE pattern of a lysis solution, a flow-through solution and a purified MUC1-PDL1-IgG1Fc recombinant protein in the purification process of MUC1-PDL1-IgG1Fc recombinant protein in example 3 of the present invention; wherein, Lane M is the pre-stained protein molecular weight marker, Lane CL is the supernatant of insoluble protein solubilized by 8M urea, Lane FL is the purified protein flow through, Lane W is the eluted heteroprotein fragment, and Lane E is the purified MUC1-PDL1-IgG1Fc recombinant protein.

FIG. 4 shows the results of Westernblot analysis of the MUC1-PDL1-IgG1Fc recombinant protein of FIG. 3 after electrophoresis on SDS-PAGE gel, membrane rotation with KinseBlot L1 rapid wet-rotation apparatus, membrane cutting, incubation with His and anti-human MUC1 primary antibody respectively; wherein, Lane M is the prestained protein molecular weight marker, Lane E is the purified MUC1-PDL1-IgG1Fc recombinant protein.

FIG. 5 is an SDS-PAGE pattern of MUC1-PDL1-IgG1Fc recombinant protein after dialysis treatment in example 3 of the present invention; wherein lane M is the prestained protein molecular weight markers and lane D is the dialyzed recombinant protein.

FIG. 6 is the experimental procedure for the immunization of mice with MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine in example 4 of the present invention.

FIG. 7 shows the flow cytometry detection of the expression of DC-specific markers CD11c and CD80 in example 4 of the present invention.

FIG. 8 shows intracellular staining and flow cytometry in example 4 of the present inventionCytometer for detecting mouse CD4 ⁺ Proportion of T cells.

FIG. 9 shows the detection of mouse CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Proportion of T cells.

FIG. 10 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IL-2 production in T cells.

FIG. 11 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN- γ production in T cells.

FIG. 12 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN- γ production in T cells.

FIG. 13 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of Perforin production in T cells.

Fig. 14 is a graph of tumor growth of mice vaccinated with pancreatic cancer PANC02 in example 4 of the present invention (n-4).

Fig. 15 is a survival curve of mice bearing pancreatic cancer PANC02 tumor cells (n-4) after tumor vaccination in example 4 of the present invention.

FIG. 16 is H & E staining analysis of liver and kidney sections of immunized mice in example 4 of the present invention.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following more detailed description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

Unless otherwise indicated, the experimental methods used in the examples of the present invention are all conventional experimental methods, and the various reagent consumables used in the examples are all commercially available products.

In a first aspect of the invention, a MUC1-PDL1-IgG1Fc recombinant protein is provided, wherein a fusion fragment of the recombinant protein comprises mucin MUC1, programmed death ligand 1(PD-L1) and IgG1Fc, an amino acid sequence of the recombinant protein is shown in SEQ ID NO.1, and the recombinant protein is encoded by a nucleotide sequence shown in SEQ ID NO. 2.

Amino acid sequence (SEQ ID NO ID NO.1)

MNALSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHAKFVAAWTLKAAAGSNGSGSGDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGKLEHHHHHH

Nucleotide sequence (SEQ ID NO.2)

CATATGAACGCGCTGAGCACCGGCGTGAGCTTCTTTTTCCTGAGCTTTCACATCAGCAACCTGCAATTCAACAGCAGCCTGGAGGACCCGAGCACCGATTACTATCAGGAGCTGCAACGTGATATCAGCGAAATGTTTCTGCAGATTTACAAGCAAGGTGGCTTTCTGGGCCTGAGCAACATCAAATTCCGTCCGGGTAGCGTGGTTGTGCAGCTGACCCTGGCGTTTCGTGAGGGTACCATTAACGTGCACGACGTTGAAACCCAGTTCAACCAATACAAGACCGAGGCGGCGAGCCGTTATAACCTGACCATTAGCGACGTGAGCGTTAGCGATGTTCCGTTTCCGTTCAGCGCGCAAAGCTTTACCGTGACCGTTCCGAAAGATCTGTACGTTGTGGAATATGGCAGCAACATGACCATCGAGTGCAAGTTCCCGGTGGAAAAACAACTGGACCTGGCGGCGCTGATTGTTTACTGGGAGATGGAAGATAAGAACATCATTCAGTTCGTGCACGGCGAGGAAGACCTGAAAGTTCAGCACAGCAGCTATCGTCAACGTGCGCGTCTGCTGAAAGACCAGCTGAGCCTGGGTAACGCGGCGCTGCAGATCACCGACGTGAAACTGCAAGATGCGGGTGTTTACCGTTGCATGATCAGCTACGGTGGCGCGGATTATAAGCGTATTACCGTGAAAGTTAACGCGCCGTATAACAAGATCAACCAGCGTATTCTGGTTGTGGACCCGGTGACCAGCGAGCACGAACTGACCTGCCAAGCGGAGGGTTACCCGAAGGCGGAAGTGATTTGGACCAGCAGCGATCACCAGGTTCTGAGCGGTAAGACCACCACCACCAACAGCAAGCGTGAGGAAAAACTGTTTAACGTGACCAGCACCCTGCGTATCAACACCACCACCAACGAGATCTTCTACTGCACCTTCCGTCGTCTGGATCCGGAGGAAAACCACGCGAAGTTCGTTGCGGCGTGGACCCTGAAAGCGGCGGCGGGTCCGAACGGTAGCGGTAGCGGTGACAAAACCCATACCTGCCCGCCGTGCCCGGCGCCGGAACTGCTGGGTGGCCCGAGCGTTTTTCTGTTCCCGCCGAAGCCGAAAGATACCCTGATGATCAGCCGTACCCCGGAAGTGACCTGCGTTGTGGTTGACGTTAGCCACGAGGATCCGGAAGTGAAGTTCAACTGGTACGTGGACGGTGTGGAAGTTCACAACGCGAAGACCAAACCGCGTGAGGAACAGTACAACAGCACCTATCGTGTGGTTAGCGTGCTGACCGTTCTGCACCAAGACTGGCTGAACGGCAAAGAATATAAGTGCAAAGTGAGCAACAAGGCGCTGCCGGCGCCGATCGAAAAAACCATTAGCAAGGCGAAGGGTCAGCCGCGTGAGCCGCAAGTTTACACCCTGCCGCCGAGCCGTGAGGAAATGACCAAGAACCAAGTGAGCCTGACCTGCCTGGTTAAAGGCTTTTATCCGAGCGATATCGCGGTGGAGTGGGAAAGCAACGGTCAGCCGGAGAACAACTACAAAACCACCCCGCCGGTGCTGGACAGCGATGGCAGCTTTTTCCTGTATAGCAAGCTGACCGTTGACAAAAGCCGTTGGCAGCAGGGTAACGTGTTCAGCTGCAGCGTTATGCACGAAGCGCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCGGGTAAACTCGAG

In the second aspect of the invention, the preparation method of the MUC1-PDL1-IgG1Fc recombinant protein is provided, and comprises the steps of expression, purification and dialysis of the recombinant protein.

In a third aspect of the invention, the application of the MUC1-PDL1-IgG1Fc recombinant protein in preparing a tumor vaccine is provided. The MUC1-PDL1-IgG1Fc recombinant protein and dendritic cell DC are pulsed to immunize a mouse, so that the effect of anti-tumor immune response is exerted.

In the fourth aspect of the invention, the active component of the tumor vaccine is MUC1-PDL1-IgG1Fc recombinant protein.

In a fifth aspect of the invention, there is provided the use of a tumor vaccine as described above in the manufacture of a medicament for the treatment of a solid tumor. The solid tumor is invasive lung cancer, pancreatic cancer, prostatic cancer, epithelial ovarian cancer, platinum drug-resistant tumor, primary lung cancer or breast cancer. More preferably pancreatic cancer.

The invention is described in detail below with reference to the figures and specific examples.

Example 1 construction and characterization of pET-21a/MUC1-PDL1-IgG1Fc expression plasmid

In this example, pET-21a/MUC1-PDL1-IgG1Fc expression plasmid was constructed and identified. The method specifically comprises the following steps:

(1) designing a gene sequence containing human MUC1, a Th stimulation epitope, PDL1, a linker and IgG1Fc, and synthesizing the gene fragment by the Kinsley biotechnology, Inc. to obtain a fusion gene fragment; the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO. 2;

(2) carrying out NdeI and XhoI double enzyme digestion on the fusion gene fragment obtained in the step (1) and the pET-21a plasmid vector, recovering a gel cutting purification kit, and inserting the fusion gene fragment into the pET-21a plasmid vector;

(3) and transforming DH5a Escherichia coli by using the connecting solution of the pET-21a plasmid vector inserted with the fusion gene fragment, and selecting 10 clones for PCR identification and sequencing identification.

The expression plasmid pET-21a/MUC1-PDL1-IgG1Fc constructed in this example has the structure shown in FIG. 1, wherein PADRE in FIG. 1 is a Th stimulatory epitope.

Example 2 inducible expression of recombinant protein from pET-21a/MUC1-PDL1-IgG1Fc expression plasmid

The expression plasmid pET-21a/MUC1-PDL1-IgG1Fc with correct sequencing is extracted and dissolved in a proper amount of TE solution for later use. The plasmid was transformed into BL21(DE3) expressing strain. The specific method comprises the following steps:

(1) taking out E.coliBL21(DE3) competent cells (Shanghai virginia) frozen at-80 ℃, immediately placing on ice, and converting within 8min after thawing;

(2) taking 1uL of plasmid (the concentration is 0.48ug/uL), adding 11uL of DEPC water to dilute 12 times (the final concentration of the plasmid is 1ng/uL), taking 2.5uL of the diluted plasmid to add into 100uL of competent cells, gently mixing, incubating on ice for 30min, thermally shocking at 42 ℃ for 45S, and immediately placing on ice for 2 min;

(3) adding 700ul of nonreactive LB liquid culture medium preheated at 37 ℃, and performing shaking culture at 37 ℃ and 200rpm for 1h to express related resistance marker genes on plasmids and recover thalli; centrifuging at 5000rpm for 1 min, spreading 100-;

(4) then, a single colony was picked up with a pipette tip and inoculated into 5ml of LB liquid medium (containing 100. mu.g/ml Amp), and cultured overnight with shaking at 37 ℃ and 200 r/min. The next day, the bacterial suspension was inoculated into 800ml of LB liquid medium (containing 100. mu.g/ml Amp), and shake-cultured at 37 ℃ and 200rpm until OD600 became 0.6-0.8; 10ml of the culture solution was used as a control (not induced), IPTG was added to the remaining medium to a final concentration of 1mM, and the medium was cultured with shaking at 37 ℃ for 6 hours, and the culture solution was collected in a centrifuge tube.

(5) 5ml of each of the bacterial solutions was put in a centrifuge tube, centrifuged at 5000g to remove the supernatant, resuspended in 1ml of 20mM Tris-HCl (pH7.5) (whole strain after induction), treated in the same manner as the whole strain before induction, added with 40. mu.L of 5Xloadingbuffer (reduction), mixed well, boiled for 5 minutes, centrifuged at 12000g for 5 minutes, and subjected to SDS-PAGE using 10. mu.L of the supernatant.

The results are shown in FIG. 2. The result shows that the target protein (namely the recombinant protein MUC1-PDL1-IgG1Fc) is expressed in an inclusion body form under the conditions that pET-21a/MUC1-PDL1-IgG1Fc expression plasmid is induced by IPTG or no IPTG, the size of the target protein is about 65.33kDa, and the molecular weight of the target protein is consistent with the expected molecular weight.

Example 3 purification of MUC1-PDL1-IgG1Fc recombinant protein

First, the culture broth in step (4) of example 2 was collected by centrifugation at 5000g at 4 ℃, then resuspended in sonication buffer (PBS, 1% Triton X-100,1mM EDTA, pH7.4), the lysate was sonicated 200 times (3 seconds per sonication, 5 seconds apart) at 400W power on ice, and then centrifuged at 15000g for 30 minutes, and the supernatant was removed, and the pellet, i.e., the inclusion body protein, was retained.

Secondly, MUC1-PDL1-IgG1Fc recombinant protein (with His tag) was purified by Ni-NTA column under denaturing conditions according to kit instructions (Qiagen), and the lysate, flow-through and eluate fractions were further analyzed by SDS-PAGE, as shown in the results of FIG. 3, lane M is Marker, lane CL is a sample of the protein solution in which the inclusion bodies were solubilized with 8M urea, lane FT is a sample of the flow-through from the column after the protein was added to the purification column, lanes W1 and W3 are samples of the wash containing the microbial impurity protein, and lanes E1, 2, 4, 6, 8 are samples of the eluted target protein solution. After the purification of the Ni column, compared with the lysate CL and the flow-through FT, the content of the impurity protein in the eluent (E1, 2, 4, 6 and 8) is obviously reduced, thereby achieving the purpose of purification.

Taking a part of samples of the purified protein to carry out Westernblot analysis, and specifically comprising the following steps:

(1) protein electrophoresis (12% SDS-PAGE) was carried out in an amount of 50. mu.g per lane, and the electrophoresed protein was transferred to a nitrocellulose membrane by a KinseBlott L1 rapid wet-transfer apparatus (Pall Corporation).

(2) The membrane was blocked with 5% nonfat dry milk for 1 hour at room temperature and then washed 3 times with PBST.

(3) The membrane was washed with PBST 5 times the following day, then with horseradish peroxidase (HRP) labeled goat anti-mouse secondary antibody (Biyunyan A0216) for 1 hour at room temperature, and then washed with PBST 5 times.

(4) And analyzed by exposure to Amersham Imager 680.

As shown in FIG. 4, a protein band capable of binding to both antibodies was present around the predicted molecular weight (65.33kDa), and it was thus assumed that the target protein MUC1-PDL1-IgG1Fc was successfully expressed and purified.

And fourthly, in order to maintain physiological consistency, performing further dialysis treatment on the elution part purified in the second step by using a dialysis bag, and replacing the 8M urea solution for dissolving the protein with the PBS solution. And (4) performing ultrafiltration concentration on the dialyzed protein solution by using an ultrafiltration tube. The concentrated protein solution was quantitatively analyzed with BCA kit (Thermo; IH117217) to determine the protein concentration. And (3) carrying out SDS-Page (SDS-Page) and Coomassie brilliant blue and Westernblot analysis on the dialyzed protein, wherein a His (His-protein) primary antibody is selected as the Western blot primary antibody, as shown in figure 5, the SDS-PAGE Coomassie brilliant blue staining result and the Western blot His-primary antibody result of the dialyzed MUC1-PDL1-IgG1Fc recombinant protein both have a band with the same molecular weight, and the protein is successfully prepared.

Using the purification method of this example, about 20mg of high purity MUC1-PDL1-IgG1Fc recombinant protein was obtained from 800mL of the bacterial culture for further functional characterization.

Example 4 therapeutic Effect of MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine on pancreatic cancer

In the embodiment, DC (dendritic cell) vaccines loaded by MUC1-PDL1-IgG1Fc recombinant protein, DC (dendritic cell) vaccines loaded by PBS (used as a control) and DC (dendritic cell) vaccines loaded by PDL1-IgG1Fc recombinant protein (prepared by the same method as the MUC1-PDL1-IgG1Fc recombinant protein) are obtained by pulsing DC through MUC1-PDL1-IgG1Fc recombinant protein, and are used for immunizing mice to detect the secretion of IL-2, IFN-gamma and Perforin cells of the spleen cells of the mice, measure the growth condition of tumors and detect and analyze the damage condition of liver and kidney in the anti-tumor process.

Preparation of tumor vaccine

The method comprises the following steps:

1. leg bones of both legs of a C57BL/6 mouse were isolated, bone marrow of the mouse was flushed from the leg bones by sucking PBS using a 1ml syringe, the bone marrow cell suspension was sieved through a 70um cell sieve, and erythrocytes were lysed using ammonium chloride. After extensive washing with RPMI-1640, the bone marrow cells were resuspended in RPMI-1640 supplemented with 10% FBS, mGM-CSF (20 ng/ml; peprotech) and recombinant mouse IL-4(10 ng/ml; peprotech). Every 2 days, the supernatant was replaced with fresh RPMI-1640 medium containing 20ng/ml rmGM-CSF and 10ng/ml recombinant mouse IL-4.

2. All cultures were incubated at 37 ℃ in 5% humidified carbon dioxide. On the 7 th day of culture, purified dialyzed MUC1-PDL1-IgG1Fc recombinant protein was added to the DC cell culture medium to make the final concentration 100ug/mL, so that the DC cells were loaded with the recombinant protein, and in the control group, PBS of the same volume and PDL1-IgG1Fc protein of the same concentration were added to the DC cell culture medium. After 4 hours bacterial lipopolysaccharide was added to a concentration of 1ug/ml (LPS; Sigma) and incubation continued for 1 day to stimulate maturation of DCs.

After 8 days of culture, DC-specific markers (CD11c, CD80) were measured by flow cytometry (FACS), and as a result, as shown in FIG. 7, it was found from FIG. 7 that the maturation of CD11c and CD80 in DC cells to which PBS, PDL1-IgG1Fc and MUC1-PDL1-IgG1Fc were added was more than 60%.

Therapeutic effect of tumor vaccine on pancreatic cancer

Please refer to fig. 6, which is a flowchart of a process for immunizing mice with the tumor vaccine prepared in this example.

6-8 weeks of C57BL/6 mice were subcutaneously inoculated with exponentially growing mouse pancreatic cancer cells PANC02 (3X 10) stably expressing human MUC1-PDL1 ⁶ Cell/one), one week later, C57BL/6 mice were randomly divided into 3 groups (8 per group) of:

1) PBS-DCs control group (i.e., PBS-loaded dendritic cells)

2) PDL1-IgG1Fc-DCs control group (i.e., dendritic cells loaded with PDL1-IgG1Fc protein)

3) MUC1-PDL1-IgG1Fc-DCs group (i.e., dendritic cells loaded with MUC1-PDL1-IgG1Fc recombinant protein)

Day 0 and day 7 PBS-DCs (100. mu.g/ml, 2X 10) were injected via tail vein separately ⁵ DC cell/cell), PDL1-IgG1Fc-DCs (100. mu.g/ml, 2X 10) ⁵ DC cell/cell) and MUC1-PDL1-IgG1Fc-DCs (100. mu.g/ml, 2X 10) ⁵ DC cells/only).

Each group consisted of 8 mice, 4 of which were used to detect cellular immune responses and 4 were used to observe tumor curves and survival.

1. MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine induced mouse spleen cell IL-2 and IFN-gamma Secretion of

6 days after the second inoculation, spleens of immunized mice were separated, digested into single cell suspensions, and then plated in 24-well plates, PMA50ng/ml, Ion1ug/ml, and BFA2ug/ml were added, and T cells in the spleens of mice were detected by intracellular staining and flow cytometry after 5h of culture.

The antibodies used were from BDbiosciences and included FITC anti-murine, CD3, PE anti-murine CD4, PE anti-murine CD8a, PE-Cy7 anti-murine IL-2, APC anti-murine IFN-. gamma., APC anti-murine Perforin. The immobilized reactive dye was purchased from Thermofisiher. All data were collected on a BDFACS/Verse (BDFACS/Verse flow cytometer at the national focus laboratory for respiratory disease, medical university of guangzhou, guangdong, china) and analyzed using Flowjo software.

As shown in FIGS. 8 and 9, MUC was compared with the PBS-DCs control group and the PDL1-IgG1Fc-DCs control group1-PDL1-IgG1Fc-DCs immunized mice splenocytes CD4 ⁺ And CD8 ⁺ There was a significant increase. CD4 ⁺ IFN-gamma and IL-2 secreted by T cells and CD8 ⁺ Both IFN- γ and Perforin secreted by T cells were significantly increased in frequency (fig. 10-11 and fig. 12-13).

These results clearly indicate that MUC1-PDL1-IgG1Fc loaded tumor vaccines can promote the production of IFN-. gamma., IL-2 and Perforin and produce good CTL inducibility.

2. The MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine can obviously inhibit tumor growth

To verify the efficacy of the MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine, the following experiments were performed:

after 6 days of the second inoculation, tumor cell inoculation was established, tumor size was measured with calipers every 6 days, tumor growth was monitored, and growth curves were calculated.

Tumor volumes were calculated as follows: 0.5 × maximum diameter (shortest diameter) × (longest diameter) ²

As shown in FIGS. 14 and 15, the inoculation of MUC1-PDL1-IgG1Fc-DCs in the group delayed tumor growth more effectively and increased survival of tumor-bearing mice and prolonged survival of mice (FIG. 15) compared to the PBS-DCs control group and the PDL1-IgG1Fc-DCs control group.

These data indicate that, compared with the traditional DC targeted protein vaccine, the MUC1-PDL1-IgG1Fc recombinant protein tumor vaccine of the present invention may be a more effective therapeutic vaccine, MUC1 improves the effect of T cell targeted killing of tumors, and PDL1 and IgG1Fc help to enhance the effect of tumor vaccine.

3. Liver and kidney injury detection analysis in anti-tumor process of MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine

To further verify whether the anti-tumor effect of the MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine damaged cells of the liver and kidney tissues of mice, the liver and kidney were isolated from mice immunized with MUC1-PDL1-IgG1Fc-DCs, PDL1-IgG1Fc-DCs, and PBS-DCs, placed in isopentane, and flash-frozen with liquid nitrogen. Tissue sections were performed according to standard protocols.

Briefly, frozen tissue was cut at-20 ℃ (5 μm thick) and immediately transferred to a mini-slide box that was stored on dry ice and stored at-80 ℃. The slides were air dried, fixed with formalin and then embedded with paraffin wax. H & E staining was done at the pathology center of guangzhou medical university.

The results show that no positive markers were detected in the cytoplasm of liver and kidney by H & E staining by section analysis (as shown in fig. 16), indicating that the MUC1-PDL1-IgG1Fc recombinant protein loaded tumor vaccine of the present invention induces an effective anti-tumor CTL response, does not attack adjacent immune tissues, and does not cause damage to liver and kidney during anti-tumor process.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou university of medical science

<120> MUC1-PDL1-IgG1Fc tumor vaccine, and preparation method and application thereof

<130> 1

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 578

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Asn Ala Leu Ser Thr Gly Val Ser Phe Phe Phe Leu Ser Phe His

1 5 10 15

Ile Ser Asn Leu Gln Phe Asn Ser Ser Leu Glu Asp Pro Ser Thr Asp

20 25 30

Tyr Tyr Gln Glu Leu Gln Arg Asp Ile Ser Glu Met Phe Leu Gln Ile

35 40 45

Tyr Lys Gln Gly Gly Phe Leu Gly Leu Ser Asn Ile Lys Phe Arg Pro

50 55 60

Gly Ser Val Val Val Gln Leu Thr Leu Ala Phe Arg Glu Gly Thr Ile

65 70 75 80

Asn Val His Asp Val Glu Thr Gln Phe Asn Gln Tyr Lys Thr Glu Ala

85 90 95

Ala Ser Arg Tyr Asn Leu Thr Ile Ser Asp Val Ser Val Ser Asp Val

100 105 110

Pro Phe Pro Phe Ser Ala Gln Ser Phe Thr Val Thr Val Pro Lys Asp

115 120 125

Leu Tyr Val Val Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe

130 135 140

Pro Val Glu Lys Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu

145 150 155 160

Met Glu Asp Lys Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp Leu

165 170 175

Lys Val Gln His Ser Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp

180 185 190

Gln Leu Ser Leu Gly Asn Ala Ala Leu Gln Ile Thr Asp Val Lys Leu

195 200 205

Gln Asp Ala Gly Val Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp

210 215 220

Tyr Lys Arg Ile Thr Val Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn

225 230 235 240

Gln Arg Ile Leu Val Val Asp Pro Val Thr Ser Glu His Glu Leu Thr

245 250 255

Cys Gln Ala Glu Gly Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser

260 265 270

Asp His Gln Val Leu Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg

275 280 285

Glu Glu Lys Leu Phe Asn Val Thr Ser Thr Leu Arg Ile Asn Thr Thr

290 295 300

Thr Asn Glu Ile Phe Tyr Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu

305 310 315 320

Asn His Ala Lys Phe Val Ala Ala Trp Thr Leu Lys Ala Ala Ala Gly

325 330 335

Ser Asn Gly Ser Gly Ser Gly Asp Lys Thr His Thr Cys Pro Pro Cys

340 345 350

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

355 360 365

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

370 375 380

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

385 390 395 400

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

405 410 415

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

420 425 430

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

435 440 445

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

450 455 460

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

465 470 475 480

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

485 490 495

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

500 505 510

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

515 520 525

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

530 535 540

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

545 550 555 560

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Leu Glu His His His His

565 570 575

His His

<210> 2

<211> 1719

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

catatgaacg cgctgagcac cggcgtgagc ttctttttcc tgagctttca catcagcaac 60

ctgcaattca acagcagcct ggaggacccg agcaccgatt actatcagga gctgcaacgt 120

gatatcagcg aaatgtttct gcagatttac aagcaaggtg gctttctggg cctgagcaac 180

atcaaattcc gtccgggtag cgtggttgtg cagctgaccc tggcgtttcg tgagggtacc 240

attaacgtgc acgacgttga aacccagttc aaccaataca agaccgaggc ggcgagccgt 300

tataacctga ccattagcga cgtgagcgtt agcgatgttc cgtttccgtt cagcgcgcaa 360

agctttaccg tgaccgttcc gaaagatctg tacgttgtgg aatatggcag caacatgacc 420

atcgagtgca agttcccggt ggaaaaacaa ctggacctgg cggcgctgat tgtttactgg 480

gagatggaag ataagaacat cattcagttc gtgcacggcg aggaagacct gaaagttcag 540

cacagcagct atcgtcaacg tgcgcgtctg ctgaaagacc agctgagcct gggtaacgcg 600

gcgctgcaga tcaccgacgt gaaactgcaa gatgcgggtg tttaccgttg catgatcagc 660

tacggtggcg cggattataa gcgtattacc gtgaaagtta acgcgccgta taacaagatc 720

aaccagcgta ttctggttgt ggacccggtg accagcgagc acgaactgac ctgccaagcg 780

gagggttacc cgaaggcgga agtgatttgg accagcagcg atcaccaggt tctgagcggt 840

aagaccacca ccaccaacag caagcgtgag gaaaaactgt ttaacgtgac cagcaccctg 900

cgtatcaaca ccaccaccaa cgagatcttc tactgcacct tccgtcgtct ggatccggag 960

gaaaaccacg cgaagttcgt tgcggcgtgg accctgaaag cggcggcggg tccgaacggt 1020

agcggtagcg gtgacaaaac ccatacctgc ccgccgtgcc cggcgccgga actgctgggt 1080

ggcccgagcg tttttctgtt cccgccgaag ccgaaagata ccctgatgat cagccgtacc 1140

ccggaagtga cctgcgttgt ggttgacgtt agccacgagg atccggaagt gaagttcaac 1200

tggtacgtgg acggtgtgga agttcacaac gcgaagacca aaccgcgtga ggaacagtac 1260

aacagcacct atcgtgtggt tagcgtgctg accgttctgc accaagactg gctgaacggc 1320

aaagaatata agtgcaaagt gagcaacaag gcgctgccgg cgccgatcga aaaaaccatt 1380

agcaaggcga agggtcagcc gcgtgagccg caagtttaca ccctgccgcc gagccgtgag 1440

gaaatgacca agaaccaagt gagcctgacc tgcctggtta aaggctttta tccgagcgat 1500

atcgcggtgg agtgggaaag caacggtcag ccggagaaca actacaaaac caccccgccg 1560

gtgctggaca gcgatggcag ctttttcctg tatagcaagc tgaccgttga caaaagccgt 1620

tggcagcagg gtaacgtgtt cagctgcagc gttatgcacg aagcgctgca caaccactac 1680

acccagaaga gcctgagcct gagcccgggt aaactcgag 1719

Claims

1. The MUC1-PDL1-IgG1Fc recombinant protein is characterized in that the amino acid sequence of the recombinant protein is shown as SEQ ID NO. 1.

2. The MUC1-PDL1-IgG1Fc recombinant protein of claim 1, wherein the recombinant protein is encoded by the nucleotide sequence set forth in SEQ ID No. 2.

3. Use of the MUC1-PDL1-IgG1Fc recombinant protein of claim 1 or 2 in the preparation of a tumor vaccine.

4. The method of making the MUC1-PDL1-IgG1Fc recombinant protein of claim 1 or 2, comprising the steps of:

5. A tumor vaccine, which is DC cells loaded with MUC1-PDL1-IgG1Fc recombinant protein.

6. The tumor vaccine according to claim 5, wherein the tumor vaccine has an immunogenic concentration of 1 x 10 ⁵ DC cells 3 x 10 ⁵ And (4) DC cells.

7. The tumor vaccine of claim 6, wherein the tumor vaccine has an immunogenic concentration of 1.5 x 10 ⁵ DC cells 2.5 x 10 ⁵ And (4) DC cells.

8. A method for preparing a tumor vaccine according to any one of claims 5 to 7, comprising the steps of:

(2) and then pulse-treating the dendritic cells for 1-3 h by using MUC1-PDL1-IgG1Fc recombinant protein of 45-55 mug/ml to obtain the dendritic cell.

9. Use of a tumor vaccine according to any one of claims 5 to 7 in the manufacture of a medicament for the treatment of solid tumors.

10. The use of claim 9, wherein the solid tumor is invasive lung cancer, pancreatic cancer, prostate cancer, epithelial ovarian cancer, primary lung cancer, or breast cancer.