CN114805607B

CN114805607B - EGFRvIII-PDL1-GMCSF tumor vaccine and preparation method and application thereof

Info

Publication number: CN114805607B
Application number: CN202210521060.2A
Authority: CN
Inventors: 刘辉; 陈思毅; 曾无艺; 潘嘉怡; 房子轩; 贾江涛
Original assignee: Guangzhou Medical University
Current assignee: Guangzhou Medical University
Priority date: 2022-05-12
Filing date: 2022-05-12
Publication date: 2023-11-28
Anticipated expiration: 2042-05-12
Also published as: CN114805607A

Abstract

The invention discloses an EGFRvIII-PDL1-GMCSF tumor vaccine, a preparation method and application thereof, wherein the amino acid sequence of fusion protein in the EGFRvIII-PDL1-GMCSF tumor vaccine is shown as SEQ ID NO. 1. The fusion protein can be used as a tumor vaccine together with DC load, can improve the immunogenicity of tumor specific antigens, resist tumor immune tolerance and tumor immune escape, provides a new effective strategy for tumor immune treatment of highly expressed PD-L1, has good safety and considerable prospect, and simultaneously promotes the drug development taking EGFRvIII as a target point, and brings new hope for cancer treatment.

Description

EGFRvIII-PDL1-GMCSF tumor vaccine and preparation method and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to an EGFRvIII-PDL1-GMCSF fusion protein, a tumor vaccine prepared from the EGFRvIII-PDL1-GMCSF fusion protein, and a preparation method and application thereof.

Background

The tumor immunotherapy is a therapy for killing tumor cells and tissues by activating the immune system of a human body and depending on the immune function of the human body, and has the characteristics of good curative effect, no drug resistance, effective elimination of residual tumor cells, consolidation of curative effect, long-term effect, tumor recurrence prevention and the like. Unlike traditional methods of treatment, the direct acting target of tumor immunotherapy is not tumor tissue, but the human immune system itself. In recent years, tumor immunotherapy including immune checkpoint inhibitors, adoptive cell immunotherapy, tumor vaccine, oncolytic virus, and the like has made a major breakthrough in cancer treatment, and has thoroughly changed the oncology field.

Immunotherapeutic strategies based on immune checkpoint inhibitors and vaccine-mediated immunotherapy are reported to reverse immunosuppressive tumor environments, stimulate antigen presentation, and induce anti-tumor T cell responses. Dendritic Cells (DCs) are known to be the most potent professional antigen presenting cells in vivo, and are the key to eliciting a strong immune response to tumor antigens, but tumor DC infiltration in tumor hosts is less and the function is impaired, and DC tumor vaccines are an effective strategy for obtaining a strong immune response to tumor hosts by isolating precursor cells of DC cells in patients, culturing them in vitro, loading them with tumor antigen peptide fragments, and then infusing them back into patients, and eliciting specific anti-tumor T cell responses by DC cells.

Up to now, the use of tumor vaccines in cancer has been completed in more than 200 clinical trials, which are mainly performed in patients with melanoma, prostate cancer, glioblastoma or renal cell carcinoma, and demonstrated that tumor vaccines induce anticancer NK cells, CD8 ⁺ And CD4 ⁺ Clinical safety and efficacy of T cell responses.

DC cells present antigen to T lymphocytes primarily in the form of MHC-II antigen peptide complexes during antigen presentation. Granulocyte-macrophage colony stimulating factor (GM-CSF) is a major cytokine that affects DC proliferation, maturation and migration, and increases the expression of MHC-ii molecules on the surface of DCs, thereby increasing the recognition opportunity of antigens by T helper lymphocytes, activating B lymphocytes or cytotoxic T lymphocytes equivalent cells, enhancing immune responses, and is therefore considered an ideal adjuvant. Compared with the traditional aluminum salt adjuvant, oil adjuvant and the like which cannot induce effective cytotoxicity T cells, th1 type reaction and other defects, research shows that the tumor vaccine secreting GM-CSF can induce a large amount of DC accumulation at an inoculation position, so that tumor specific T cells are activated, and anti-tumor reaction is induced.

In the course of an anti-tumor immune response, tumor cells can inhibit T cell activation through a variety of regulatory mechanisms, attenuating the attack of cytotoxic T cells, resulting in immune escape or immune tolerance. Among these regulatory mechanisms, programmed death receptor 1 (PD-1) and programmed death ligand 1 (PD-L1) are important immunosuppressive checkpoints on T cells and tumor cells, respectively, and binding of PD-1 to PD-L1 results in inhibition of T cell immune responses.

In recent years, immunotherapy acting on the PD1/PD-L1 pathway has received attention with its remarkable clinical efficacy, long-lasting responsiveness, low toxicity efficacy and other advantages. PD-1/PD-L1 monoclonal antibodies have been developed as immune checkpoint inhibitors for cancer treatment, such as melanoma and non-small cell lung cancer, etc., to eliminate the "brake" on the immune system and restore the ability of T cells to attack tumor cells.

PD-L1 is mainly expressed on the surfaces of tumor cells and antigen presenting cells of various solid malignant tumors such as pancreatic cancer and the like, and is an ideal tumor specific target for tumor immunotherapy and vaccine development. Clinical trials have shown that repeated administration of anti-PD-1 or anti-PD-L1 antibodies produces a sustained response in a proportion of cancer patients, but a significant proportion of cancer patients do not respond to these immune checkpoint inhibitors, probably due to the lack of sufficient anti-tumor T cells in these cancer patients. Studies have shown that PDL 1-Vax-loaded DCs (see PMID: 31805690) induce anti-PD-L1 antibodies and T cell responses in immunized mice, and that PD-L1-specific CTLs are specific for PD-L1 ⁺ Has cytolytic activity.

Pancreatic cancer is one of the most immune-resistant tumor types and remains a significant challenge in clinical treatment. With continued increase in morbidity and minimal change in mortality, pancreatic cancer is expected to be the second leading cause of cancer-related death by 2030. The traditional radiotherapy, chemotherapy and other treatment methods have limited curative effects on pancreatic cancer patients, so that the use of specific molecular inhibitors becomes a development direction with great potential in pancreatic cancer treatment. Epidermal growth factor receptor (epidermal growth factor receptor, EGFR), a receptor tyrosine kinase, is commonly upregulated in cancers such as non-small cell lung cancer, metastatic colorectal cancer, glioblastoma, head and neck cancer, pancreatic cancer, and breast cancer, and is an important molecular target in cancer treatment. Epidermal growth factor receptor type III mutants (epidermal growth factor receptor variant III, EGFRvIII) are the most common mutant of EGFR, and studies have shown that: EGFRvIII can influence the occurrence and development of tumors by regulating Ras/Raf/MEK/extracellular regulatory protein kinase (extracellular regulated protein kinases, ERK) and other signal paths, and particularly plays a role similar to immune escape in the radiotherapy and chemotherapy of tumors. EGFRvIII is not expressed in normal tissues and is highly expressed on the surfaces of tumor cells, so that EGFRvIII becomes an ideal target point for anti-tumor immunotherapy.

The challenge faced by the current tumor vaccine is how to improve the immunogenicity of tumor antigens, so that the tumor immune tolerance can be reduced and the tumor immune escape can be avoided.

Disclosure of Invention

Based on the above, it is an object of the present invention to provide an EGFRvIII-PDL1-GMCSF fusion protein which can be used as a part of tumor vaccine to improve the immunogenicity of antigen and prevent tumor immune escape.

The specific technical scheme for realizing the aim of the invention comprises the following steps:

an EGFRvIII-PDL1-GMCSF fusion protein, the amino acid sequence of which is shown in SEQ ID NO. 1.

An egfrvlll-PDL 1-GMCSF fusion protein encoded by the nucleotide sequence shown in SEQ ID No. 2.

The invention also provides a preparation method of the EGFRvIII-PDL1-GMCSF fusion protein, which comprises the following steps:

(1) Synthesizing fusion gene fragments containing gene sequences of human EGFRvIII, th epitopes, PDL1 and GMCSF; the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO. 2;

(2) Performing NdeI and XhoI double digestion on the fusion gene fragment and the pET-21a plasmid vector in the step (1), recovering a gel cutting purification kit, and connecting to obtain an expression plasmid pET-21a/EGFRvIII-PDL1-GMCSF;

(3) Transferring the expression plasmid pET-21a/EGFRvIII-PDL1-GMCSF into BL21 (DE 3) expression strain, inducing with IPTG to obtain target protein, purifying and dialyzing to obtain EGFRvIII-PDL1-GMCSF fusion protein.

The invention also provides application of the EGFRvIII-PDL1-GMCSF fusion protein in preparation of tumor vaccines.

A tumor vaccine comprises an EGFRvIII-PDL1-GMCSF fusion protein as an active ingredient.

In some of these embodiments, the tumor vaccine has a fusion protein loading of 80 μg/ml to 120 μg/ml.

In some of these embodiments, the tumor vaccine has a fusion protein loading of 95 μg/ml to 105 μg/ml.

The invention also provides a preparation method of the tumor vaccine.

A method of preparing a tumor vaccine, the method comprising the steps of:

(1) Adding 80-120 mu g/ml EGFRvIII-PDL1-GMCSF fusion protein into a culture medium for culturing dendritic cells for overnight culture;

(2) And then pulse-treating the dendritic cells for 1 to 3 hours by using 45 to 55 mu g/ml EGFRvIII-PDL1-GMCSF fusion protein.

In some of these embodiments, the medium in step (1) is RPMI-1640 medium containing 20ng/ml GM-CSF and 20ng/ml recombinant mouse IL-4.

The invention also provides application of the tumor vaccine in preparing a medicine for treating solid tumors.

In some embodiments, the solid tumor is pancreatic cancer, colon cancer, melanoma, leukemia, breast cancer, lung cancer, or prostate cancer.

In some of these embodiments, the solid tumor is pancreatic cancer.

Compared with the prior art, the invention has the following beneficial effects:

1. in the invention, EGFRvIII-PDL1-GMCSF fusion protein is designed and successfully expressed, and can be used as a tumor vaccine together with DC load (EGFRvIII is used as a target point, PD-L1 fragments are fused, GM-CSF is used as an adjuvant), so that the immunogenicity of tumor specific antigen can be improved, and the GM-CSF is used for recruiting DC in tumor to activate an immune system to kill tumor, thereby resisting tumor immune tolerance and tumor immune escape.

2. The tumor vaccine taking the EGFRvIII-PDL1-GMCSF fusion protein as an active ingredient is verified in a tumor-bearing mouse that the EGFRvIII-PDL1-GMCSF fusion protein can induce effective tumor-specific Cytotoxic T Lymphocytes (CTLs) to react, obviously inhibit the growth of pancreatic cancer cells, prolong the survival time of the mouse, provide a new effective strategy for the immunotherapy of solid tumors such as tumors (colon cancer, melanoma, leukemia, breast cancer, lung cancer, prostate cancer) with high expression of PD-L1, and the like, have good safety and considerable prospect, and promote the development of medicaments taking EGFRvIII as a target point, and bring new hope to the treatment of cancers.

Drawings

FIG. 1 is a schematic diagram showing the structure of pET-21a/EGFRvIII-PDL1-GMCSF expression plasmid constructed in example 1 of the present invention.

FIG. 2 is a SDS-PAGE map of EGFRvIII-PDL1-GMCSF fusion protein in example 2 of the present invention.

FIG. 3 is a diagram showing immunoblotting (WB) of EGFRvIII-PDL1-GMCSF fusion protein according to example 2 of the present invention.

FIG. 4 is a SDS-PAGE map of lysate, permeate and eluate of the purification of EGFRvIII-PDL1-GMCSF fusion protein according to example 3 of the present invention.

FIG. 5 is a diagram showing immunoblotting (WB) analysis of the dialyzed EGFRvIII-PDL1-GMCSF fusion protein using a His tag antibody in example 3 of the present invention.

FIG. 6 is a flow chart showing immunization of mice with EGFRvIII-PDL1-GMCSF fusion protein-loaded tumor vaccine in example 4 of the present invention.

FIG. 7 shows the detection of CD4+ T cells and CD8 in mice by cell surface staining and flow cytometry in example 4 of the present invention ⁺ Proliferation of T cells.

FIG. 8 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IL-2 production in T cells.

FIG. 9 shows the detection of CD4 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN-gamma production in T cells.

FIG. 10 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IL-2 production in T cells.

FIG. 11 shows the detection of CD8 by intracellular staining and flow cytometry in example 4 of the present invention ⁺ Frequency of IFN-gamma production in T cells.

Fig. 12 is a graph of tumor growth (n=4) of Panc02 vaccinated mice in example 4 of the present invention with P <0.0001.

Fig. 13 shows survival curves (n=4) of tumor-bearing mice following tumor vaccination in example 4 of the present invention, P <0.01.

FIG. 14 is an H & E staining analysis of liver and kidney sections of immunized mice in example 4 of the present invention.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Unless otherwise indicated, the experimental methods used in the examples of the present invention were conventional experimental methods, and the various reagent consumables used in the examples were all commercially available products.

In a first aspect of the present invention, there is provided an EGFRvIII-PDL1-GMCSF fusion protein, the fusion fragment of which comprises a human epidermal growth factor receptor type III mutant (EGFRvIII), programmed death ligand 1 (PD-L1) and granulocyte-macrophage colony stimulating factor (GM-CSF), the amino acid sequence of which is shown in SEQ ID NO.1, encoded by a nucleotide sequence shown in SEQ ID NO. 2.

Amino acid sequence (SEQ ID NO.1, 453 residues,Expected MW with His-tag:50.73 kD)

MLEEKKGNYVVTDHAKFVAAWTLKAAALEEKKGNYVVTDHAKFVAAWTLKAAALEEKKGNYVVTDHGSCVRACGADSYEMEEDGVRKCKKCEGPCRKVCNGIGIGEFKDSLSINATNIKHFKNCTSISGDLHILPVAFRGDSFTHTPPLDPQEFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGPNGSGSGMWLQSLLLLGTVACSISAPARSPSPSTQPWEHVNAIQEARRLLNLSRDTAAEMNETVEVISEMFDLQEPTCLQTRLELYKQGLRGSLTKLKGPLTMMASHYKQHCPPTPETSCATQIITFESFKENLKDFLLVIPFDCWEPVQELEHHHHHH

Nucleotide sequence (SEQ ID NO. 2)

CATATGCTAGAGGAGAAGAAGGGCAACTACGTTGTGACCGATCACGCCAAGTTCGTGGCCGCCTGGACCCTGAAGGCCGCCGCCTTAGAAGAAAAAAAAGGGAACTATGTCGTGACGGACCATGCGAAATTTGTCGCGGCGTGGACATTGAAAGCGGCGGCGCTGGAGGAAAAGAAAGGTAATTATGTGGTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAAGACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATAGGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAAAACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCCTTCACACATACTCCTCCTCTGGATCCACAGGAATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGTCCGAACGGCAGCGGCAGCGGCATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACACAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAACAGCACTGCCCTCCAACCCCGGAAACTTCCTGTGCAACCCAGATTATCACCTTTGAAAGTTTCAAAGAGAACCTGAAGGACTTTCTGCTTGTCATCCCCTTTGACTGCTGGGAGCCAGTCCAGGAGCTCGAGCACCACCACCACCACCAC

In a second aspect of the present invention, there is provided a method for producing an EGFRvIII-PDL1-GMCSF fusion protein, comprising the steps of expression, purification and dialysis of the fusion protein.

In a third aspect of the invention, there is provided the use of an EGFRvIII-PDL1-GMCSF fusion protein in the preparation of a tumor vaccine. EGFRvIII-PDL1-GMCSF fusion protein and dendritic cell DC pulse and immunize mice to play the role of anti-tumor immune response.

In a fourth aspect of the invention, there is provided a tumor vaccine, the active ingredient of which is EGFRvIII-PDL1-GMCSF fusion protein.

In a fifth aspect of the invention, there is provided the use of a tumor vaccine as described above in the manufacture of a medicament for the treatment of solid tumors. The solid tumor is pancreatic cancer, colon cancer, melanoma, leukemia, breast cancer, lung cancer, or prostate cancer. More preferably pancreatic cancer.

The invention is described in detail below with reference to the drawings and the specific embodiments.

EXAMPLE 1 construction and identification of pET-21a/EGFRvIII-PDL1-GMCSF expression plasmid

The embodiment constructs and identifies pET-21a/EGFRvIII-PDL1-GMCSF expression plasmid. The method specifically comprises the following steps:

(1) Designing a gene sequence formed by fusing a human EGFRvIII sequence, a Th epitope sequence, a PD-L1 sequence and GM-CSF, and synthesizing the gene fragment by using a Jinsri biotechnology Co-Ltd; the nucleotide sequence is shown as SEQ ID NO. 2;

(2) The fusion gene fragment synthesized in the above (1) was inserted into the pET-21a plasmid vector by using NdeI and XhoI restriction sites downstream of the promoter of the pET-21a plasmid vector.

(3) And transforming DH5a escherichia coli by using a connection solution of the pET-21a plasmid vector inserted with the fusion gene fragment, and selecting 10 clones for PCR identification and sequencing identification.

The structure of the constructed expression plasmid pET-21a/EGFRvIII-PDL1-GMCSF is shown in figure 1.

EXAMPLE 2 inducible expression of fusion proteins in pET-21a/EGFRvIII-PDL1-GMCSF expression plasmid

Extracting and sequencing correct expression plasmid pET-21a/EGFRvIII-PDL1-GMCSF, and dissolving in a proper amount of TE solution for standby. The plasmid was transferred into BL21 (DE 3) expressing strain. The specific method comprises the following steps:

(1) Taking out E.coli BL21 (DE 3) competent cells frozen at-80 ℃, immediately placing on ice, and transforming after thawing;

(2) Adding 1uL plasmid into 100uL competent cells, gently mixing, incubating on ice for 30min, heat-shocking at 42 ℃ for 90S, and immediately placing on ice for 3min;

(3) Adding 500ul of LB liquid antibiotic-free medium preheated at 37 ℃, and shaking at 200rpm for 50min at 37 ℃; 100-200. Mu.l of the bacterial liquid is coated on an LB plate containing Amp (50. Mu.g/ml), and the mixture is placed in a 37 ℃ incubator for overnight culture.

(4) And inoculating single colonies into 2ml of LB liquid medium (containing 50 mu g/ml Amp), shaking and culturing at 37 ℃ for 3 hours at 200r/min to logarithmic phase, taking 200ul of culture bacterial liquid as a control (not induced), adding IPTG into the rest of culture medium to a final concentration of 1mM, shaking and culturing at 37 ℃ for 3 hours, and collecting the culture bacterial liquid in a centrifuge tube.

(5) Respectively collecting 200 μl of the bacterial solutions in centrifuge tubes, centrifuging to remove supernatant, and collecting 40 μ L H ₂ O-resuspension (whole bacteria after induction), whole bacteria sample treatment before induction, adding 10 μl of 5×loading Buffer (reduction), mixing, boiling for 5 min, centrifuging for 5mi 12000gn, 10. Mu.L of the supernatant was subjected to SDS-PAGE and immunoblotting (WB, primary Antibody was Pdcd-1L1 Anti-body (H-130) rubbifollanti-body 1:1000 (Omnimabs); secondary Antibody was Anti-rabit (800) 1:10000 (goat Anti-rabit IgG-HRP: sc-2004) (Santa Cruz).

The results are shown in fig. 2 and 3, respectively. The result shows that the pET-21a/EGFRvIII-PDL1-GMCSF expression plasmid is expressed in inclusion form under the condition of IPTG induction or no IPTG, and the size of the target protein (namely fusion protein EGFRvIII-PDL 1-GMCSF) is about 50.73kDa, which is consistent with the expected molecular weight.

EXAMPLE 3 purification of EGFRvIII-PDL1-GMCSF fusion protein

1. The culture broth from step (4) of example 2 was collected by centrifugation at 5000g at 4℃and then resuspended in sonication buffer (PBS, 1% Triton X-100,1mM EDTA, pH 7.4), the lysate sonicated 200 times at 400W power on ice (3 seconds each, 5 seconds apart) and then centrifuged at 15000g for 30 minutes before removing the supernatant, leaving the pellet, i.e., inclusion body protein.

2. Under denaturing conditions, according to the instructions of the kit (Qiagen), the EGFRvIII-PDL1-GMCSF fusion protein (carrying His tag) was purified by using a Ni-NTA column, and the lysate, the flow-through and the eluent portions were further analyzed by SDS-PAGE, and as shown in the results of FIG. 4, the impurity protein content in the eluent was significantly reduced compared with the lysate and the flow-through after purification by using a Ni column, thereby achieving the purification purpose.

3. Taking a part of samples of the purified proteins for Western blot analysis, wherein the method comprises the following specific steps of:

(1) Protein electrophoresis (12% SDS-PAGE) was performed at 50. Mu.g per lane, and the proteins after electrophoresis were transferred onto nitrocellulose membranes (Pall Corporation) using a gold Rui eBlotL1 fast wet transfer instrument.

(2) Membranes were blocked with 5% nonfat dry milk for 1 hour at room temperature and then washed 3 times with PBST.

(3) The goat anti-mouse secondary antibody (Biyun Tian A0216) was hybridized with an anti-His tag antibody (Santa Cruz) at 4℃overnight with shaking, 5 times of washing with PBST the next day, 2 hours of hybridization with Fluorescein Isothiocyanate (FITC) at room temperature, and 5 times of washing with PBST.

(4) Analysis was performed by exposure to Amersham Imager 680.

4. In order to maintain physiological consistency, the eluted fraction after purification in step two was further dialyzed with a dialysis bag, replacing the 8M urea solution of the dissolved protein with PBS solution. The dialyzed protein solution was concentrated by ultrafiltration using an ultrafiltration tube. The concentrated protein solution was quantitatively analyzed by BCA kit (Thermo; IH 117217) to detect the protein concentration. The protein after dialysis was subjected to SDS-Page and then to Coomassie Brilliant blue analysis, as shown in FIG. 5, and the SDS-PAGE result of the EGFRvIII-PDL1-GMCSF fusion protein after dialysis showed a band with a comparable molecular weight, and the protein purification was successful.

Using the purification method of this example, about 10mg of the high purity EGFRvIII-PDL1-GMCSF fusion protein was obtained from 1L of bacterial culture for further functional identification.

Example 4 therapeutic Effect of EGFRvIII-PDL1-GMCSF fusion protein-loaded tumor vaccine on pancreatic cancer

In the embodiment, firstly, DC (dendritic cell) vaccine loaded by EGFRvIII-PDL1-GMCSF fusion protein and dendritic cells loaded by PBS (as a contrast) are obtained through EGFRvIII-PDL1-GMCSF fusion protein pulse DC, and then the EGFRvIII-PDL1-GMCSF fusion protein is used for immunizing mice, detecting IL-2 and IFN-gamma secretion of spleen cells of the mice, measuring the growth condition of tumors, and detecting and analyzing the liver and kidney injury condition in the anti-tumor process.

1. Preparation of tumor vaccine

The method comprises the following steps:

1. mouse bone marrow was flushed from the extremities, passed through a nylon mesh, and red blood cells were lysed with ammonium chloride. After extensive washing with RPMI-1640, cells were cultured in RPMI-1640 supplemented with 10% FBS, mGM-CSF (20 ng/ml) and recombinant mouse IL-4 (20 ng/ml; peprotech). Non-adherent granulocytes were removed after 48 hours of incubation. Every other day, the supernatant was replaced with fresh RPMI-1640 medium containing 20ng/ml rmGM-CSF and 20ng/ml recombinant mouse IL-4. All cultures were incubated in 5% humidified carbon dioxide at 37 ℃. DC maturation was performed during the last 16 hours with the addition of bacterial lipopolysaccharide (LPS; sigma) at 100 ng/ml. After 7 days of culture, flow cytometry (FACS) determined that more than 80% of the cells expressed the characteristic DC specific markers (CD 40, CD80 and CD 86).

2. To prepare antigen pulsed DCs, 100. Mu.g/ml EGFRvIII-PDL1-GMCSF fusion protein or PBS was incubated overnight in medium supplemented with the above cytokines (RPMI-1640 medium containing 20ng/ml rmGM-CSF and 20ng/ml recombinant mouse IL-4). The next day, dendritic cells were pulsed again with 50. Mu.g/ml EGFRvIII-PDL1-GMCSF fusion protein or PBS for 2h. Washing with PBS for 3 times to obtain EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccine and PBS loaded tumor vaccine for the next experiment.

2. Therapeutic effect of tumor vaccine on pancreatic cancer

Referring to fig. 6, a flow chart of immunization of mice with the tumor vaccine prepared in this example is shown.

C57BL/6 mice were randomly divided into 2 groups (4 per group) of:

1) PBS-DCs control group (i.e., PBS-loaded dendritic cells)

2) EGFRvIII-PDL1-GMCSF-DCs group (i.e., dendritic cells loaded with EGFRvIII-PDL1-GMCSF fusion protein)

PBS-DCs were injected through the footpad on day 0 and day 7, respectively (100. Mu.g/ml, 1X 10) ⁶ DC cells/cell) and EGFRvIII-PDL1-GMCSF-DCs (100. Mu.g/ml, 1X 10) ⁶ DC cells/only).

After 3 days of the second inoculation, the body cell immune response of the mice was examined, and after 7 days of the second inoculation, the mice were subcutaneously inoculated with pancreatic cancer cells PANC02 (2.5X10) ⁵ Cells/cells), tumor curves and survival were observed.

1. Tumor vaccine loaded by EGFRvIII-PDL1-GMCSF fusion protein induces IL-2 and IFN (cytokine-like protein) cells in spleen cells of mice Gamma secretion

In order to investigate whether an EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccine could induce an effective immune response, the following experiments were performed:

after 3 days of the second inoculation, spleen of immunized mice was isolated, digested into single cell suspension, and then pulsed with 5 μg/ml fusion protein again in a U-bottom 96-well plate for 6h, cell surface staining and flow cytometry detection, and analyzed for mouse T cell proliferation. Antibodies used were from BD Biosciences, including PE-CY5 anti-murine CD4, FITC anti-murine CD8a, PE anti-murine IL-2, APC anti-murine IFN-gamma. Immobilized reactive dyes were purchased from east Bo bioscience. All data were collected on BD FACSVerse and analyzed using Flowjo software.

As expected, CD4 in spleen cells of mice injected with egfrvlll-PDL 1-GMCSF fusion protein loaded tumor vaccine compared to control ⁺ And CD8 ⁺ T cells increased significantly (as shown in figure 7).

CD4 production of IL-2 and IFN-gamma was analyzed by intracellular staining and flow cytometry detection ⁺ T cells. As shown in FIGS. 8 and 9, the frequency of IL-2 production by T cells was increased 17-fold over total CD4+ cells, and IFN-gamma production was performed at total CD4 ⁺ The cells were 15-fold increased.

In CD8 ⁺ Similar results were also observed in T cells, with IL-2 up-regulated approximately 27-fold and IFN-gamma up-regulated approximately 6.8-fold (FIGS. 10 and 11).

These results clearly demonstrate that EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccines can promote IFN-gamma and IL-2 production and may produce good CTL induction.

2The EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccine can obviously inhibit tumor growth

To verify the efficacy of EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccines, the following experiments were performed:

after 1 week of the second inoculation, an exponentially growing panc02 pancreatic cancer tumor cell line (ATCC) stably expressing PD-L1 was subcutaneously injected into mice (2.5X10) ⁵ cell/cell only). After tumor cell inoculation was established, tumor size was measured with calipers every 5 days, tumor growth was monitored, and growth curves were calculated.

Tumor volumes were calculated as follows: (longest diameter) × (shortest diameter) ² ×0.5

The tumor growth curve is shown in fig. 12, and it can be seen from fig. 12: EGFRvIII-PDL1-GMCSF-DCs were more effective in delaying tumor growth than PBS-DCs control.

The survival curves of tumor-bearing mice are shown in fig. 13, and it can be seen from fig. 13: the EGFRvIII-PDL1-GMCSF-DCs group significantly improved the survival rate of tumor-bearing mice compared to the PBS-DCs control group, with 50% of treated mice surviving for at least 80 days.

Thus, these data indicate that the egfrvlll-PDL 1-GMCSF fusion protein loaded tumor vaccine of the present invention may be a more effective tumor vaccine against pancreatic cancer than traditional non-PD-L1 DC targeting protein vaccines.

3. Liver and kidney injury detection component in anti-tumor process of EGFRvIII-PDL1-GMCSF fusion protein loaded tumor vaccine Analysis

In order to further verify whether the tumor vaccine loaded by EGFRvIII-PDL1-GMCSF fusion protein damages liver and kidney tissue cells of mice in the anti-tumor effect, mouse livers and kidneys are separated from an immune group, placed in isopentane and quickly frozen by liquid nitrogen. Tissue sections were performed according to standard protocols.

Briefly, frozen tissue was cut at-20 ℃ (5 μm thick) and then immediately transferred to a mini-slide box stored on dry ice and at-80 ℃. The slides were air dried, fixed with formalin and then embedded in paraffin. H & E staining was done at the pathology center at university of guangzhou medical science.

The results showed that the H & E staining of the section analysis did not detect positive markers in the cytoplasm of the liver and kidney (as shown in fig. 14), indicating that the egfrvlll-PDL 1-GMCSF fusion protein loaded tumor vaccine of the present invention did not cause damage to the liver and kidney during the anti-tumor process.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> university of medical science in Guangzhou

<120> EGFRvIII-PDL1-GMCSF tumor vaccine, preparation method and application thereof

<130> 1

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 453

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Leu Glu Glu Lys Lys Gly Asn Tyr Val Val Thr Asp His Ala Lys

1 5 10 15

Phe Val Ala Ala Trp Thr Leu Lys Ala Ala Ala Leu Glu Glu Lys Lys

20 25 30

Gly Asn Tyr Val Val Thr Asp His Ala Lys Phe Val Ala Ala Trp Thr

35 40 45

Leu Lys Ala Ala Ala Leu Glu Glu Lys Lys Gly Asn Tyr Val Val Thr

50 55 60

Asp His Gly Ser Cys Val Arg Ala Cys Gly Ala Asp Ser Tyr Glu Met

65 70 75 80

Glu Glu Asp Gly Val Arg Lys Cys Lys Lys Cys Glu Gly Pro Cys Arg

85 90 95

Lys Val Cys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser

100 105 110

Ile Asn Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile Ser

115 120 125

Gly Asp Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr

130 135 140

His Thr Pro Pro Leu Asp Pro Gln Glu Phe Thr Val Thr Val Pro Lys

145 150 155 160

Asp Leu Tyr Val Val Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys

165 170 175

Phe Pro Val Glu Lys Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp

180 185 190

Glu Met Glu Asp Lys Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp

195 200 205

Leu Lys Val Gln His Ser Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys

210 215 220

Asp Gln Leu Ser Leu Gly Asn Ala Ala Leu Gln Ile Thr Asp Val Lys

225 230 235 240

Leu Gln Asp Ala Gly Val Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala

245 250 255

Asp Tyr Lys Arg Ile Thr Val Lys Val Asn Ala Pro Tyr Asn Lys Ile

260 265 270

Asn Gln Arg Ile Leu Val Val Asp Pro Val Thr Ser Glu His Glu Leu

275 280 285

Thr Cys Gln Ala Glu Gly Pro Asn Gly Ser Gly Ser Gly Met Trp Leu

290 295 300

Gln Ser Leu Leu Leu Leu Gly Thr Val Ala Cys Ser Ile Ser Ala Pro

305 310 315 320

Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro Trp Glu His Val Asn Ala

325 330 335

Ile Gln Glu Ala Arg Arg Leu Leu Asn Leu Ser Arg Asp Thr Ala Ala

340 345 350

Glu Met Asn Glu Thr Val Glu Val Ile Ser Glu Met Phe Asp Leu Gln

355 360 365

Glu Pro Thr Cys Leu Gln Thr Arg Leu Glu Leu Tyr Lys Gln Gly Leu

370 375 380

Arg Gly Ser Leu Thr Lys Leu Lys Gly Pro Leu Thr Met Met Ala Ser

385 390 395 400

His Tyr Lys Gln His Cys Pro Pro Thr Pro Glu Thr Ser Cys Ala Thr

405 410 415

Gln Ile Ile Thr Phe Glu Ser Phe Lys Glu Asn Leu Lys Asp Phe Leu

420 425 430

Leu Val Ile Pro Phe Asp Cys Trp Glu Pro Val Gln Glu Leu Glu His

435 440 445

His His His His His

450

<210> 2

<211> 1362

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

catatgctag aggagaagaa gggcaactac gttgtgaccg atcacgccaa gttcgtggcc 60

gcctggaccc tgaaggccgc cgccttagaa gaaaaaaaag ggaactatgt cgtgacggac 120

catgcgaaat ttgtcgcggc gtggacattg aaagcggcgg cgctggagga aaagaaaggt 180

aattatgtgg tgacagatca cggctcgtgc gtccgagcct gtggggccga cagctatgag 240

atggaggaag acggcgtccg caagtgtaag aagtgcgaag ggccttgccg caaagtgtgt 300

aacggaatag gtattggtga atttaaagac tcactctcca taaatgctac gaatattaaa 360

cacttcaaaa actgcacctc catcagtggc gatctccaca tcctgccggt ggcatttagg 420

ggtgactcct tcacacatac tcctcctctg gatccacagg aatttactgt cacggttccc 480

aaggacctat atgtggtaga gtatggtagc aatatgacaa ttgaatgcaa attcccagta 540

gaaaaacaat tagacctggc tgcactaatt gtctattggg aaatggagga taagaacatt 600

attcaatttg tgcatggaga ggaagacctg aaggttcagc atagtagcta cagacagagg 660

gcccggctgt tgaaggacca gctctccctg ggaaatgctg cacttcagat cacagatgtg 720

aaattgcagg atgcaggggt gtaccgctgc atgatcagct atggtggtgc cgactacaag 780

cgaattactg tgaaagtcaa tgccccatac aacaaaatca accaaagaat tttggttgtg 840

gatccagtca cctctgaaca tgaactgaca tgtcaggctg agggtccgaa cggcagcggc 900

agcggcatgt ggctgcagag cctgctgctc ttgggcactg tggcctgcag catctctgca 960

cccgcccgct cgcccagccc cagcacacag ccctgggagc atgtgaatgc catccaggag 1020

gcccggcgtc tcctgaacct gagtagagac actgctgctg agatgaatga aacagtagaa 1080

gtcatctcag aaatgtttga cctccaggag ccgacctgcc tacagacccg cctggagctg 1140

tacaagcagg gcctgcgggg cagcctcacc aagctcaagg gccccttgac catgatggcc 1200

agccactaca aacagcactg ccctccaacc ccggaaactt cctgtgcaac ccagattatc 1260

acctttgaaa gtttcaaaga gaacctgaag gactttctgc ttgtcatccc ctttgactgc 1320

tgggagccag tccaggagct cgagcaccac caccaccacc ac 1362

Claims

1. An EGFRvIII-PDL1-GMCSF fusion protein is characterized in that the amino acid sequence of the fusion protein is shown as SEQ ID NO. 1.

2. The egfrvlll-PDL 1-GMCSF fusion protein of claim 1, wherein said fusion protein is encoded by a nucleotide sequence as set forth in SEQ ID No. 2.

3. The method for producing an egfrvlll-PDL 1-GMCSF fusion protein according to claim 1 or 2, characterized in that said method comprises the steps of:

(2) Performing the fusion gene fragment and pET-21a plasmid vector of the step (1)NdeI andXhoi double enzyme digestion, recovery of gel cutting purification kit, connection, and obtaining expression plasmid pET-21a/EGFRvIII-PDL1-GMCSF;

4. Use of an egfrvlll-PDL 1-GMCSF fusion protein according to claim 1 or 2 for the preparation of a tumor vaccine.

5. A tumor vaccine, which is characterized in that the active ingredient of the tumor vaccine is EGFRvIII-PDL1-GMCSF fusion protein.

6. The tumor vaccine of claim 5, wherein the fusion protein loading of the tumor vaccine is 80 μg/ml to 120 μg/ml.

7. The tumor vaccine of claim 6, wherein the fusion protein loading of the tumor vaccine is 95 μg/ml to 105 μg/ml.

8. The method for preparing the tumor vaccine according to any one of claims 5 to 7, characterized in that the method comprises the following steps:

(1) Adding 80-120 mu g/ml EGFRvIII-PDL1-GMCSF fusion protein into a culture medium for culturing dendritic cells, and culturing overnight;

(2) And then pulse-treating the dendritic cells for 1-3 hours by using 45-55 mug/ml EGFRvIII-PDL1-GMCSF fusion protein.

9. The use of the tumor vaccine of any one of claims 5-7 in the preparation of a medicament for treating pancreatic cancer.