CN107952069A - Recombinant vaccine and its application - Google Patents

Recombinant vaccine and its application Download PDF

Info

Publication number
CN107952069A
CN107952069A CN201711190257.8A CN201711190257A CN107952069A CN 107952069 A CN107952069 A CN 107952069A CN 201711190257 A CN201711190257 A CN 201711190257A CN 107952069 A CN107952069 A CN 107952069A
Authority
CN
China
Prior art keywords
vaccine
spd1
dna
cancer
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711190257.8A
Other languages
Chinese (zh)
Inventor
孔维
张海红
于湘晖
陆臻桢
刘晨露
徐平
耿飞
谢雨
郭倩倩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Jilin University
Original Assignee
CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Jilin University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd, Jilin University filed Critical CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Priority to CN201711190257.8A priority Critical patent/CN107952069A/en
Publication of CN107952069A publication Critical patent/CN107952069A/en
Priority to PCT/CN2018/116393 priority patent/WO2019101062A1/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4727—Mucins, e.g. human intestinal mucin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70521—CD28, CD152
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5154—Antigen presenting cells [APCs], e.g. dendritic cells or macrophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55522—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55522—Cytokines; Lymphokines; Interferons
    • A61K2039/55527—Interleukins
    • A61K2039/55533—IL-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10211—Aviadenovirus, e.g. fowl adenovirus A
    • C12N2710/10234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The present invention relates to biotech drug technical field, more particularly to recombinant vaccine and its application.The present invention provides molecular combinations, including soluble PD 1, MUC1 and Survivin.Vaccine is prepared with the molecular combinations, good immunogenicity and antitumor activity can be produced.Vaccine immunity provided by the invention can produce the specific antibody response and specificity cellular immunity response for MUC1, Survivin.Compared with DNA vaccination CpDV IL2 MS, CpDV IL2 sPD1/MS have more significant anti-tumor effect in tumor-bearing mice.Invention further provides therapeutic vaccine and the scheme for combining of chemotherapeutic agent.

Description

Recombinant vaccine and its application
Technical field
The present invention relates to biotech drug technical field, more particularly to recombinant vaccine and its application.
Background technology
Cancer or malignant tumour are to threaten the killer of human health, and the induced factor of tumour is intricate, we lack so far The weary profound understanding to its specific Forming Mechanism.It has recently been demonstrated that there is circulation between body immune system and tumour cell Interaction, i.e., immune system can identify the cancer cell of " nonego " component, and cancer cell can also escape body through a variety of ways The monitoring and attack of immune system, cause the diffusion transfer of patient's body tumour cell.The molecular mechanism bag of tumor immune escape Include：Tumour antigen expression is lowered or lost, and tumor cell secretion has the soluble cytokine of immune suppression function, and tumour is micro- Environment recruits inhibitive ability of immunity lymphocyte, and tumour cell up-regulated expression negativity costimulatory signal etc..Wherein, in tumour Under the induction of the cell factor such as local microenvironment and interferon gamma, great expression negativity costimulatory molecules in the T cell of activation, this A little immunosupress regulatory molecules will directly affect the antitumor activity of effector cell's toxic T lymphocyte (CTL), it is killed work( It can weaken and even lose.Presently found inhibition costimulatory molecules mainly have CTLA4/CD80 (CD86), PD1/PD-L1 (PD-L2), BTLA/HVEM, TIM3/GAL9 etc..
People's apoptosis albumen 1 (Programmed Death-1, PD-1) also known as CD279, it is with two ligands PD-L1 (B7H1, CD274) and PD-L2 (B7DC, CD273) belongs to immunoglobulin superfamily I type transmembrane glycoproteins together, by endochylema Area, transmembrane anchor area and extracellular site binding domain three parts are formed.The key structure of PD-1 signal immune suppression functions is mediated, is Immunity receptor tyrosine conversion motif (Immunoreceptortyrosine-based positioned at intracellular signal transduction area Switch motif, ITSM), when with coupled receptors, ITSM motifs start tyrosine phosphorylation program to recruit related phosphoric acid Enzyme, makes signal path PI3K/AKT (phosphatidylinositol3 3 kinase/serine-threonine protein kinase enzyme) dephosphorylation in downstream, from And cause interruption that cell factor synthesizes and T cell effect insensitive etc..PD-1/PD-L1 signal paths are in normal structure organ And peripheral lymphoid tissue's low expression or inducible expression, to maintaining immunity of organism tolerance, preventing the generation of autoimmunity disease from having weight Want meaning；And the high of tumor locus PD-1 molecules is expressed, then the apoptosis of activating T cell is accelerated.
2013, Scientific Magazine authorized the great scientific breakthrough of immunologic test point Blocking therapy year, and immunization therapy is also real Make it is seen that curing the hope of cancer.Immunologic test point Blocking therapy (Immune Checkpoint Blockade) is applied Inhibitor blocks the coinhibitory signals path of negativity regulatory T-cell, releases T cell and suppresses and discharge its immunocompetence again.When The inhibitor of preceding exploitation is mainly Humanized monoclonal antibodies, blocks two important immunologic test point --- cytotoxicities respectively T lymphocyte proteins 4 (CTLA4) and PD-1.2014, the report such as Herbst is a kind of effectively to block PD-1 ligands PD-L1's Monoclonal antibody medicine PMDL3280A treats the invalid bladder cancer patients of 65 chemical drug treatments, as a result has 13 in 30 PD-L1 positive patients Example (43%) produces the effect of obvious tumor suppression tumour, wherein 2 people reach state of an illness complete incidence graph；In addition, in PD-L1 negative patients In also have 11% response rate.Thus, the anti-tumor immune response advantage of checkpoint blocking drugs is embodied, is controlled for cancer immunity Treatment provides new Research Thinking.At the same time, there is also some drawbacks that clinical drug application is subject to for monoclonal antibody class inhibitor Limitation.For example, the tumor tissues immunohistochemistry detection of some patientss is displayed without T lymphocytic infiltration phenomenons, this may be caused Some patientss monoclonal antibody treatment is invalid；Also there are some patients after anti-CTLA 4 Antybody therapy is received, fatal autoimmunity disease occur Relevant adverse reaction；In addition, Humanized monoclonal antibodies cost of manufacture is higher, drug cost is expensive.These problems all illustrate Checkpoint blocking treatment need to establish more perfect indication curer screening sequence and therapeutic scheme, and the PD-1 developed at present Antibody formation blocking agent can not then guide antitumor active immunity, its blocking agent form waits further to optimize.Documents and materials are shown Show, a kind of soluble type PD-1 (sPD-1) albumen can identify and combine with ligand PD-L1, can be used as another PD-1/PD-L1 signals The form of path blocking agent is applied to antineoplastic immune.
(1) biological characteristics of solubility PD-1 molecules
Usually there are two kinds of forms for costimulation albumen：It is anchored on cell membrane or is secreted into extracellular, soluble type molecule reservation Membrane-type molecules extracellular matches somebody with somebody receptor binding domains, and distal end effector molecule is acted on by blood circulation in a manner of free, participates in adjusting Save immunity of organism.Now it has proven convenient that natural people PD-1 molecules include above two protein form, and membranous type and soluble type PD-1 (Soluble PD-1, sPD1) all by PDCD1 gene codes, wherein, encoded full length mRNA translation product is membrane-type molecules, And a kind of mRNA splicing variants for lacking exon 3 then translate directly into sPD1.The another way that sPD1 is formed, it may be possible to Membranous type PD-1 comes off generation under followed by action of proteolytic enzymes.The IgV-IgC spline structures of sPD-1, mediation and ligand PD-L1 and PD- The combination of L2, but suppress motif due to lacking intracellular, downstream immunosupress signal can not be started.The detection rheumatoid such as Wan closes There is the high expression of sPD1 molecules in the knuckle synovia and peripheral blood of the scorching patient of section, while with T such as IFN-γ, IL-4, IL-21 The horizontal rise of cell activation relevant cell factor.
The homology of people and mouse PD-1 and PD-L1 albumen is respectively up to 60% and 70%, and extracellular combination critical sites Primary sequence it is highly conserved.In vitro test is the result shows that recombined human sPD1 fusion proteins and PD-L1, PD-L2 of mouse have friendship Combination is pitched, illustrates that people source sPD-1 can also block mouse PD-1 to suppress signal path.
(2) physiological function of soluble type PD-1
Soluble type costimulatory molecules participate in adjust immunity of organism correlative study, include sCD80, sLAG3, sPD1 and SBTLA etc., these molecules have respective physiological function in virus infection, tumour and autoimmunity disease etc..SPD1 molecules are exempted from Epidemic disease adjustment effect is in particular in four aspects：1. it is the secretion (IFN- for promoting some activation cytokines on T lymphocytes γ, IL-2 etc.), while reduce suppressive factor IL-10 and TGF-β；2. specific C D4 can be promoted positive for sPD1 effects and CD8 The propagation of positive T cell, and the expression of the T cell up-regulation suppression apoptogene Bcl-xl activated, subtract t cell proliferation activity It is weak；3. influence of the flow cytometer detection sPD1 molecules to DC cells, it was observed that CD80, CD86, IL-12 and MHC-II quasi-molecule fluorescence are strong Degree is obviously improved, and shows that soluble PD-1 can promote the maturation of DC cells；4. sPD-1 can be by there is targeting DC to promote CD8+The function of T cell.The specific molecular mechanism for being related to sPD1 molecular activation immunity of organism waits to study, but it is considered that its The performance of physiological function depends on antigen-specific cellular immune response, and single sPD1 molecules are that do not possess specific immunity effect Answer.
(3) applications of the soluble type PD-1 in antineoplastic immune
Soluble PD1 molecules are as a form of PD-1 paths blocking agent, existing certain preclinical applications basis. Shin etc., with herpesvirus thymine deoxyriboside kinase (HSVtk) for target spot, constructs and carries restructuring HSVtk genes and recombinant soluble The condition replication type adenovirus carrier of sPD1-Ig gene bicistronic mRNAs.This dual-gene joint adenovirus is subjected to intratumor injection, base Because treating colorectal cancer tumor model mouse.The results show that therapeutic alliance group tumor killing effect is controlled up to 90% with single HSVtk Treat to compare and have good synergy；And single sPD1 gene therapy groups, then without any antitumor action；When deletion mouse After internal CD8 positive T cells, the synergistic antitumor effects of sPD1 disappear.
In the immunization therapy of cancer, it is different to expressing that Chen etc. has investigated model utility sPD-1-p24 Antigen Fusions nucleic acid vaccine The tumor killing effect of the malignant mesothelioma of kind antigen GAG.The tumor-bearing mice of intramuscular inoculation sPD1-p24DNA vaccines, life cycle Reach the specific humoral immunity and cellular immunity that mouse is detected after 100%, eight months, as a result IgG1/IgG2a and specificity CD8+T cell numbers, all still maintain high level, and it is long-term effect to embody sPD-1 anti-tumor immune responses.Further research hair Existing, sPD-1 can excite a large amount of amplifications of the double positive T cells of IFN-γ/TNF-α, help T cell killing tumour.In addition, sPD1-p24 The restraining factors in Initial stage of immunization (within six weeks) periphery and tumor microenvironment are considerably reduced, are in particular in marrow The suppressor T lymphocyte such as source inhibitory cells (myeloid-derived suppressor cells, MDSC) and regulatory T cells The reduction of number.
In conclusion solubility PD1 molecules it is competitive with PD-L inhibitory pathways with reference to and block PD1/PD-L1 signals to lead to Road, while there is enhancing specific immunity effect.Compared with antibody class medicine, the preparation process for recombinating sPD-1 vaccines is relatively simple List, cost are relatively low, it is believed that sPD-1 is used as PD-1 has potential clinical value by way of blocking agent.
(4) tumor gene vaccine
The present inventor's early-stage study shows, is target spot with survivin (Survivin) and mucin 1 (MUC1) Fusion vaccine has certain application value in anti-tumor immunotherapy.Survivin belongs to suppression apoptotic proteins and surpasses house Race, major function are resistant to Apoptosis and regulating cell division, and Survivin is specific expressed in embryonic tissue and cancer cell, It is preferable immunotherapy of tumors target spot；MUC1 is I type transmembrane glycoproteins, is made of core protein and polysaccharide side chain, its center The extracellular peptide fragment of heart protein includes the tandem repetitive sequence (VNTRs) that number does not wait, and expression of the MUC1 in tumour is because glycosylating not Polypeptide core VNTR areas are exposed completely, these new polypeptide epitopes provide potential immune attack target for T cell.
Inventor is based on two aspects and carries out the design of MUC1VNTRs and Survivin amalgamation and expression DNA vaccinations epitope： When vaccine safety, second, vaccine immunogenicity.According to document, total length Survivin is played anti-with dimeric forms in vivo Apoptosis function, and it is N-terminal the 6th, the 7th and the 10th amino acids residue that dimerization, which forms critical sites,.Therefore, inventor employs N The Survivin that end lacks 7 amino acid residues lacks spliced body (abbreviation S8) to design vaccine, so both improves vaccine safety Property, and ensure Survivin epitope immunogenics to the full extent；Involved another epitope is in invention MUC1VNTR tandem repetitive sequences, the tandem sequence repeats structure include 33 copy MUC1VNTRs (referred to as 33M), exempt from wherein including Epidemic disease dominant domain PDTRP sequences, the MUC1 specific antibodies for being capable of mediated high-efficient react and improve specific CTL immunity effect Should.
Early-stage study is the results show that the DNA vaccination (i.e. MS vaccines) using 33M and S8 integrative nucleic acids as target spot can effectively increase The broad spectrum activity and validity of strong vaccine immunity (referring to the application documents of Application No. 200910252427.X).In addition, MS vaccines It is implemented in the VR1012 bi-cistronic vectors CpDV by inventor's transformation, its carrier framework includes one section of CpG motif, at the same time Can absolute coding proleulzin (IL-2) albumen, they are same as immunologic adjuvant and mucin 1/survivin merges tumour antigen Step expression, its immunoenhancement result are carried out in inventor's previous research work and are verified (referring to Patent No. The patent document of ZL2009102524 27.x and ZL201110086366.1).On this basis, further probe into and introduce sPD-1 Rear vaccine-induced immunogenicity and antitumous effect humidification.
The content of the invention
In consideration of it, the technical problem to be solved in the present invention is to provide a kind of recombinant vaccine and its application, the present invention will SPD1 is further combined with tumour antigen MS, and PD-1/PD- involved in antigen presentation DC cell processes is blocked with sPD1 L negativity signal path is so that vaccine has more preferable immunogenicity and immunological effect.
The present invention provides a kind of molecular combinations, including PD-1, MUC1 and Survivin.
PD-1, MUCI and Survivin of the present invention can be that protein molecular also can be nucleic acid molecules, and the present invention is to this Do not limit.
SPD-1 albumen refers to block the soluble type PD-1 albumen of PD-1 paths, and sPD-1 nucleic acid refers to coding sPD-1 The DNA molecular of albumen.In the present invention, the sPD-1 is DNA or albumen, is people sPD-1 extracellular fragments (being denoted as sPD1), its DNA sequence Arrange from the gene that Genbank accession number is NM_005018.2.The DNA sequence dna for the sPD-1 that the present invention uses such as SEQ ID NO: Shown in 1, the amino acid sequence such as SEQ ID NO of the sPD-1:Shown in 2.
MUC1 is protein derived to be referred to from wild MUC1VNTR albumen and (or) its mutant and (or) its truncate, MUC1 nucleic acid The DNA molecular of MUC1 albumen can be encoded.In the present invention, the DNA sequence dna such as SEQ ID NO of MUC1:Shown in 3；Its amino acid sequence Row such as SEQ ID NO:Shown in 4.
Survivin it is protein derived from wild Survivin albumen and (or) its mutant and (or) its lack spliceosome, it is excellent Elect the Survivin that N-terminal lacks 7 amino acid residues as.In invention, the DNA sequence dna such as SEQ ID NO of Survivin:Shown in 5； Its amino acid sequence such as SEQ ID NO:Shown in 6.
In the present invention, PD-1, MUC1 and Survivin, three can merge and (be denoted as sPD1/MS), can also nonfused shape Formula is used in combination and (is denoted as sPD1+MS), and the present invention does not limit this.
Application of the molecular combinations of the present invention in the product for preparing anti-curing oncoma.
Experiments indicate that anti-curing oncoma can be had the function that by preparing vaccine with antigen provided by the invention.And The significant effect of sPD1/MS vaccine groups is better than MS vaccine groups (p<0.05), also it is significantly better than sPD1 vaccines (p<0.05).Also, The present invention is it is demonstrated experimentally that vaccine induces what is produced compared with the mode of sPD1+MS combined immunizations made from sPD1/MS fusions Specific cell immunoreaction is in more consistent level, shows that sPD1 and MS as antigen, can produce tumour Mutiple Targets Raw effect, and the not notable (p of the influence of fusion or nonfused mode to immune effect>0.05).
The tumour that vaccine, which is made, with present invention offer antigen to prevent is selected from melanoma, colorectal cancer, colorectal cancer, lung Cancer, breast cancer, liver cancer, kidney, cholangiocarcinoma, stomach cancer, the cancer of the esophagus, carcinoma of urinary bladder, cancer of pancreas, head and neck cancer, nasopharyngeal carcinoma, carcinoma of mouth, palace Neck cancer, oophoroma, uterine cancer, prostate cancer, carcinoma of testis, squamous cell carcinoma, lymthoma, the cancer of the brain, glioblastoma cytoma, marrow are female Cytoma, lymphosarcoma, chorioepithelioma, osteosarcoma, thyroid cancer.
The present invention is used as experimental subjects, knot using breast cancer, lung cancer, liver cancer, stomach cancer, colorectal cancer, melanoma tumor-bearing mice Fruit shows, can play the role of good suppression tumour growth, and tumor-bearing mice with vaccine made from present invention offer antigen The ability of lymphocyte specific secretion of gamma-IFN is remarkably improved (P ＜ 0.01).
The product of anti-curing oncoma of the present invention includes vaccine.
Experiment shows that vaccine made from present invention offer antigen can play the role of good anti-curing oncoma.The epidemic disease Seedling is DNA vector vaccine, vector-viral vaccine, protein vaccine and/or dendritic cell vaccine.In certain embodiments, Individually giving DNA vector vaccine, vector-viral vaccine or protein vaccine can both play the role of suppressing tumour growth.And another In some embodiments, as shown by data, first exempt from customs examination gives DNA vector vaccine, and can be notable with recombinant adenovirus vaccine booster immunization Lift immune effect.It is another there is data to suggest that, give anti-tumor drug immune while, the work that synergy cooperates with can be played With.The anti-tumor drug is chemotherapeutics, is preferably platinum-like compounds, taxol and/or gemcitabine and/or cis-platinum. In some embodiments, chemotherapeutics is oxaliplatin.Using oxaliplatin as experimental subjects, the results showed that, recombinate sPD1/MS vaccines The life cycle of joint oxaliplatin treatment group tumor-bearing mice, (life extended with single oxaliplatin treatment group tumor-bearing mice 14%) compare, embody significant life extension effect (P ＜ 0.05).
Therefore, in the product for the anti-curing oncoma that this distribution provides, it may include DNA vector vaccine, vector-viral vaccine, albumen Combination more than one or both of vaccine and/or dendritic cell vaccine.Chemotherapeutics, such as Ao Shali can also be further included Platinum.
Present invention also offers the recombinant vector of the DNA sequence dna including PD-1, MUC1 and Survivin.
Tissue-typed plasminogen activator (tissue plasminogen activator, tPA), abbreviation tPA signals Peptide, can effectively facilitate the secretion of albumen, improve the ability of its induction of antibodies generation.In order to improve fusion protein sPD1/MS In extracellular secreting, expressing ability, 5 ' terminal modified tPA signal peptide sequences of the present invention in the DNA sequence dna of PD-1.
In the present invention, DNA sequence dna such as SEQ ID NO that sPD-1 is connected with tPA signal peptide sequences:Shown in 7.
Wherein, the length of tPA signal peptides is 69bp, its sequence such as SEQ ID NO:Shown in 11.
In particular embodiments of the invention, DNA sequence dna (being denoted as MS sequences) such as SEQ that MUC1 is connected with Survivin ID NO:Shown in 8.
According to the vaccine form of required structure, the different recombinant vector of framework construction that can be different, but these restructuring carry In body, it should all include the PD-1 sequences being connected with tPA signal peptides, MUC1 sequences and Survivin sequences, the present invention is to described The order of connection of the PD-1 sequences being connected with tPA signal peptides, MUC1 sequences and Survivin sequences does not limit, it is implemented all Within protection scope of the present invention.In an embodiment of the present invention, the order of connection for merging fragment is：Held by 5 ' ends to 3 ', TPA signal peptides, PD-1 sequences, MUC1 sequences, Survivin sequences.
In order to build DNA vector vaccine, the present invention provides a kind of recombinant vector, it includes skeleton carrier, SEQ ID NO:DNA sequence dna, SEQ ID NO shown in 7:DNA sequence dna and adjuvant sequence shown in 8.
In embodiments of the present invention, skeleton carrier CpDV.CpDV carriers by Application No. 201110086366.1 hair Bright patent structure.
The adjuvant sequence is Inner adjuvant, selected from cytokine class adjuvant, includes but not limited to interleukin-22 (IL- 2), the non A-G hepatitis of immunostimulation DNA and colony stimulating factor GM-CSF.In the embodiment of the present invention, the assistant of use Agent sequence is proleulzin, its DNA sequence dna such as SEQ ID NO:Shown in 9.
In some embodiments, the insertion point of adjuvant sequence is between Xba I and BamH I restriction enzyme sites；SEQ ID NO: DNA sequence dna and SEQ ID NO shown in 7:The insertion point of DNA sequence dna shown in 8 for Bgl II and EcoR I restriction enzyme sites it Between.
In some embodiments, collection of illustrative plates such as Fig. 1-d of recombinant vector (being denoted as CpDV-IL2-sPD1/MS) provided by the invention Shown, its preparation method is that adjuvant sequence is inserted between Xba I and BamH the I restriction enzyme sites of skeleton carrier, then in Bgl SEQ ID NO are inserted between II and EcoR I restriction enzyme sites:7 and SEQ ID NO:Sequence shown in 8.
Application of the recombinant vector provided by the invention in the product for preparing anti-curing oncoma.
The product of the anti-curing oncoma is DNA vector vaccine.
Present invention also offers a kind of vaccine of anti-curing oncoma, including recombinant vector provided by the invention.
Preferably, the recombinant vector is CpDV-IL2-sPD1/MS.
The preparation method of vaccine provided by the invention is, is interleave in Xba I and BamH the I restriction enzyme sites of skeleton carrier Enter adjuvant sequence, SEQ ID NO are then inserted between Bgl II and EcoR I restriction enzyme sites:7 and SEQ ID NO:Sequence shown in 8 Row, are made recombinant vector.
Efficient anti-mucin 1 antibody and anti-survivin can be produced by being inoculated with the mouse of DNA vector vaccine provided by the invention Antibody, and both antibody titers are up to more than 10000, and the amount for producing antibody is also larger, illustrates DNA provided by the invention Carrier bacterin can start strong specific humoral immune response.Also, experiment shows, the present invention provides regulation DNA vector Vaccine can effectively suppress the growth of tumour, and the tumour includes breast cancer, lung cancer, liver cancer, stomach cancer, colorectal cancer, melanoma, And its significant effect is better than (p<0.05) the DNA vector vaccine using MS as target spot, or the DNA using sPD-1 as target spot is used alone Carrier bacterin.Due to the similitude of immunotherapy of tumors mechanism, it is believed that DNA vector vaccine provided by the invention also can be to black Plain knurl, colorectal cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, kidney, cholangiocarcinoma, stomach cancer, the cancer of the esophagus, carcinoma of urinary bladder, cancer of pancreas, Head and neck cancer, nasopharyngeal carcinoma, carcinoma of mouth, cervical carcinoma, oophoroma, uterine cancer, prostate cancer, carcinoma of testis, squamous cell carcinoma, lymthoma, The cancer of the brain, glioblastoma cytoma, medulloblastoma, lymphosarcoma, chorioepithelioma, osteosarcoma, thyroid cancer play well Inhibitory action.
In order to build recombinant protein vaccine, present invention also offers a kind of recombinant vector, including skeleton carrier, SEQ ID NO:DNA sequence dna, SEQ ID NO shown in 7:DNA sequence dna shown in 8.
Structure recombinant protein vaccine need to obtain fusion protein (sPD1/MS), and in of the invention, the expression of fusion protein is using former Nuclear expression system.In order to obtain the fusion protein of prokaryotic expression, recombinant vector middle skeleton carrier provided by the invention For pRSET B or PET serial carriers.
In some embodiments, collection of illustrative plates such as Fig. 3-b institutes of recombinant vector (being denoted as pET28a-sPD1/MS) provided by the invention Show, its preparation method is that sPD1/MS fragments are inserted between Nde I and Xho the I restriction enzyme sites of skeleton carrier.
In order to prepare fusion protein (sPD1/MS), the present invention provides a kind of expression vector, restructuring provided by the present invention Carrier transfection host cell is made.
The host cell is e. coli bl21.
Present invention also offers a kind of fusion protein, table is made in its recombinant vector transfection host cell provided by the present invention Up to after carrier, expression obtains.
The host cell is e. coli bl21.
After the expression, also purified step, it is described purifying be by the cell after culture with ultrasonic degradation after, centrifugation 30min, is precipitated after being resuspended with solubilization of inclusion bodies buffer, after dissolving, and supernatant obtains fusion protein through affinity chromatography.
Application of the fusion protein produced by the present invention in the product for preparing anti-curing oncoma.
The product of the anti-curing oncoma is recombinant protein vaccine.
Present invention also offers a kind of vaccine of anti-curing oncoma, including fusion protein provided by the invention (sPD1/MS).
Adjuvant is further included in the vaccine, the adjuvant is Al (OH)3。
AL(OH)3For common inorganic adjuvant, it can be broken up with humoral immune reaction by inducing T cell to improve vaccine Immunogenicity,
The growth of tumor-bearing mice tumour can be suppressed by being inoculated with recombinant protein vaccine provided by the invention, and tumor-bearing mice spleen drenches The ability of bar cell-specific secretion of gamma-IFN is also improved.The tumour is colorectal cancer, due to Tumorigenesis Similitude, it is believed that DNA vector vaccine provided by the invention also can be to melanoma, colorectal cancer, lung cancer, breast cancer, liver cancer, kidney Cancer, cholangiocarcinoma, stomach cancer, the cancer of the esophagus, carcinoma of urinary bladder, cancer of pancreas, head and neck cancer, nasopharyngeal carcinoma, carcinoma of mouth, cervical carcinoma, oophoroma, uterus Cancer, prostate cancer, carcinoma of testis, squamous cell carcinoma, lymthoma, the cancer of the brain, glioblastoma cytoma, medulloblastoma, lymphosarcoma, Chorioepithelioma, osteosarcoma, thyroid cancer play good inhibitory action.
In order to build vector-viral vaccine, the present invention provides a kind of recombinant vector, including skeleton carrier, SEQ ID NO:DNA sequence dna, SEQ ID NO shown in 7:DNA sequence dna shown in 8, the skeleton carrier are pSC11 or pDC316.
PSC11 is Ankara poxvirus (Modified Vaccinia Ankara, MVA) common shuttle plasmid, the load The thymidine kinase left arm and right arm (TKL, TKR) having on body can with MVA homologous recombinations, while by lacZ gene on carrier, Carry out the locus coeruleus screening of recombinant MVA (rMVA).In some embodiments, recombinant vector provided by the invention (is denoted as pSC11-sPD1/ MS for collection of illustrative plates) as shown in Fig. 4-b, the preparation method of the recombinant vector is to be inserted at the SalI restriction enzyme sites of pSC11-MS plasmids Enter sPD1 fragments, 5 ' ends of the sPD-1 fragments are connected with tPA signal fragments of peptides.The pSC11-MS plasmids are by Application No. 200910252427.X Chinese invention patent structure.
PDC316 often uses shuttle plasmid for adenovirus, and in some embodiments, recombinant vector provided by the invention (is denoted as PDC316-sPD1/MS collection of illustrative plates) is as shown in Fig. 4-d, and the preparation method of the recombinant vector is, in pDC316-MS plasmids SPD1 fragments are inserted at EcoRI restriction enzyme sites, 5 ' ends of the sPD-1 fragments are connected with tPA signal fragments of peptides.It is described PDC316-MS plasmids are built by the Chinese invention patent of Application No. 200910252427.X.
In order to build vector-viral vaccine, present invention also offers a kind of recombinant virus, it is with restructuring provided by the invention Carrier transfected virus is made.
In certain embodiments, the recombinant vector is pSC11-sPD1/MS, and the virus is poxvirus.
In this embodiment, described transfect is：Empty MVA viruses are infected to the mutant cell of the BHK-21 containing TK genes, Then shuttle plasmid pSC11-sPD1/MS cotransfections to bhk cell are made after culture with culture supernatant using lipo2000 reagents After kind poison infection bhk cell, the poxvirus of transfection pSC11-sPD1/MS is obtained through screening.
In certain embodiments, the recombinant vector is pDC316-sPD1/MS, and the virus is adenovirus.
In this embodiment, described transfect is：AD skeletons and shuttle plasmid pDC316-sPD1/MS cotransfections 293 is thin Born of the same parents, the adenovirus of transfection pDC316-sPD1/MS is obtained through screening.
Adenovirus (AD) skeleton is pBHGlox Δs E1,3Cre.
Application of the recombinant virus provided by the invention in the product for preparing anti-curing oncoma.
Present invention also offers a kind of vaccine of anti-curing oncoma, including recombinant virus provided by the invention.
The growth of tumor-bearing mice tumour can be significantly inhibited by being inoculated with recombinant viral vaccine provided by the invention, wherein, sPD1/ The mean tumour volume of MS recombinant poxvirus treatment mouse is reduced by about 25%, sPD1/MS restructuring glands than the gross tumor volume of control group The mean tumour volume of viral therapy mouse is then reduced by about 23%.The tumour is melanoma, due to the phase of tumor vaccine mechanism Like property, it is believed that vector-viral vaccine provided by the invention also can be to colorectal cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, kidney Cancer, cholangiocarcinoma, stomach cancer, the cancer of the esophagus, carcinoma of urinary bladder, cancer of pancreas, head and neck cancer, nasopharyngeal carcinoma, carcinoma of mouth, cervical carcinoma, oophoroma, uterus Cancer, prostate cancer, carcinoma of testis, squamous cell carcinoma, lymthoma, the cancer of the brain, glioblastoma cytoma, medulloblastoma, lymphosarcoma, Chorioepithelioma, osteosarcoma, thyroid cancer play good inhibitory action.
In addition, experiments indicate that, first exempt from customs examination gives DNA vector vaccine, and then carrying out reinforcement with vector-viral vaccine exempts from Epidemic disease can play the role of being obviously improved immune effect.It is embodied in, IFN-γ secretion increases, immune response enhancing.It is described CpDV-IL2-sPD1/MS is included in DNA vector vaccine, the vector-viral vaccine is poxvirus vector vaccine (pSC11- ) or adenovirus carrier vaccine (pDC316-sPD1/MS) sPD1/MS.
The present invention provides a kind of product of anti-curing oncoma, including DNA vector vaccine provided by the invention, recombinant protein epidemic disease Seedling and/or vector-viral vaccine.
In the product of anti-curing oncoma provided by the invention, a kind of vaccine can be only included, can also include two kinds of vaccines or both Vaccine combination above.
In addition, experiments indicate that, synergy can be played the role of by giving chemotherapeutics immune while.Specific table It is now the life cycle for extending tumor-bearing mice.In vaccine and chemical drug therapeutic alliance group, it was observed that restructuring sPD1/MS DNA vaccinations With combining so that mouse mean survival time (MST) extends 24% (P ＜ 0.001) compared with PBS groups, wherein recombinating sPD1/MS for oxaliplatin DNA vaccination combines the life cycle of oxaliplatin treatment group compared with single oxaliplatin treatment group (life extends 14%), body Now significant life extension effect (P ＜ 0.05).
In the product of anti-curing oncoma provided by the invention, chemotherapeutics is further included.The chemotherapeutics is selected from platinum class chemical combination Thing, taxol or gemcitabine.
In addition, research show, the CpVR-sPD1 of integrative nucleic acid vaccine CpDV-IL2-sPD1/MS and combined immunization with CpDV-IL2-MS vaccines all cause elispot number of spots showed increased (the P ＜ of T lymphocytic emiocytosis MS specificity IFN-γ 0.01).Meanwhile comparing the mode of sPD1/MS vaccines and sPD1+MS combined immunizations, it induces the specific cell of generation to exempt from Epidemic disease reaction is in more consistent level, shows the vaccine that sPD1 genes are prepared with MS tumor antigen genes, has integrative nucleic acid A variety of vaccine forms of vaccine and joint co-injection vaccine.
The product of the anti-curing oncoma of another kind provided by the invention, including using MS as the vaccine of target spot and using sPD-1 as target spot Vaccine.
The vaccine using MS as target spot is built by the Chinese invention patent of Application No. 200910252427.X.
The vaccine using sPD-1 as target spot is CpVR-sPD1, its construction method be support C pVR PstI and SPD1 fragments are inserted between BamHI restriction enzyme sites, 5 ' ends of the sPD-1 fragments are connected with tPA signal fragments of peptides.The CpVR is carried Body is built by the patent of invention of Patent No. ZL 201110086366.1.
In vaccine and chemical drug therapeutic alliance group, it was observed that restructuring MS vaccines and oxaliplatin are combined so that mouse is averaged Life cycle extends 22% (P ＜ 0.001) compared with PBS groups.
In the product of anti-curing oncoma provided by the invention, chemotherapeutics is further included.The chemotherapeutics is selected from platinum class chemical combination Thing, taxol or gemcitabine.
Present invention also offers a kind of method of anti-curing oncoma, this method is to give the production of anti-curing oncoma provided by the invention Product.
In some specific embodiments, after giving product provided by the invention, injection site is stimulated with living gene importing equipment； The voltage of the stimulation is 36V；Frequency 1Hz；Pulse 6 times；Pulsewidth 20ms.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling.Immune strategy is using DNA vector vaccine just exempt from, then carries out booster immunization using DNA vector vaccine.It is described just to exempt from Number be 1 time, the number of the booster immunization is 2 times.It is described just to exempt to be spaced between booster immunization 7 days, strengthen exempting from twice Time interval between epidemic disease is 7 days.The DNA vector vaccine is CpDV-IL2-sPD1/MS.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give recombinant protein Vaccine.Immune strategy is using recombinant protein vaccine just exempt from, then carries out booster immunization using recombinant protein vaccine.It is described The number just exempted from is 1 time, and the number of the booster immunization is 2 times.It is described just to exempt to be spaced between booster immunization 7 days, add twice Time interval between being immunized by force is 7 days.The recombinant protein vaccine is made by the VR1012-sPD1/MS fusion proteins expressed.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give viral vector Vaccine.Immune strategy is using vector-viral vaccine just exempt from, then carries out booster immunization using vector-viral vaccine.It is described The number just exempted from is 1 time, and the number of the booster immunization is 1 time.It is described just to exempt to be spaced 14 days between booster immunization.The disease Poisonous carrier vaccine is poxvirus vector vaccine or adenovirus carrier vaccine.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling and vector-viral vaccine.Immune strategy is using DNA vector vaccine just exempt from, then is added using vector-viral vaccine It is strong immune.The number just exempted from is 3 times, and the number of booster immunization is 1 time.It is described just to exempt to be spaced 2 weeks between booster immunization, The time interval exempted from the beginning of 3 times is 2 weeks.The vector-viral vaccine is adenovirus carrier vaccine.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling and vector-viral vaccine.Immune strategy is using DNA vector vaccine just exempt from, then is added using vector-viral vaccine It is strong immune.The number just exempted from is 2 times, and the number of booster immunization is 1 time.It is described just to exempt to be spaced 2 weeks between booster immunization, The time interval exempted from the beginning of 2 times is 2 weeks.The vector-viral vaccine is poxvirus vector vaccine.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling and vector-viral vaccine.Immune strategy is using DNA vector vaccine just exempt from, then is added using vector-viral vaccine It is strong immune.The number just exempted from is 2 times, and the number of booster immunization is 1 time.It is described just to exempt to be spaced 2 weeks between booster immunization, The time interval exempted from the beginning of 2 times is 2 weeks.The vector-viral vaccine is adenovirus carrier vaccine.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling and vector-viral vaccine.Immune strategy be use using vaccines of the MS as the vaccine of target spot and using sPD-1 as target spot combine into Row is just exempted from, then carries out booster immunization using vector-viral vaccine.The number just exempted from is 2 times, and the number of booster immunization is 1 It is secondary.The time interval for just exempting to exempt from the beginning of being spaced 2 weeks, 2 times between booster immunization is 2 weeks.The vector-viral vaccine is gland Vector-viral vaccine.
In some specific embodiments, the method for giving the product of anti-curing oncoma provided by the invention is：Give DNA vector epidemic disease Seedling and vector-viral vaccine.Immune strategy is using DNA vector vaccine just exempt from, then is added using vector-viral vaccine It is strong immune.It is immune to give chemotherapeutics at the same time.The number just exempted from is 2 times, and the number of booster immunization is 1 time.It is described just to exempt from The time interval exempted from the beginning of being spaced 7 days, 2 times between booster immunization is 7 days.At the beginning of 1st time for giving chemotherapeutics is the 2nd time Next day after exempting from, gives chemotherapeutics in hereafter every 5 days, is administered 4 times altogether..The vector-viral vaccine is poxvirus vector vaccine. The chemotherapeutics is oxaliplatin.
The present invention provides molecular combinations, including PD-1, MUC1 and Survivin.Vaccine is prepared with the antigen, can be had There are good immunogenicity and antitumor activity.Vaccine immunity provided by the invention can produce the spy for MUC1, Survivin Heterogenetic antibody response (see Fig. 5) and specificity cellular immunity response (see Fig. 6).Compared with DNA vaccination CpDV-IL2-MS, CpDV- IL2-sPD1/MS has more significant anti-tumor effect in tumor-bearing mice, wherein to the inhibition rate of tumor growth of melanoma about 53% (see Figure 10), to the increase in life span about 19% of the life cycle of melanoma tumor-bearing mice (see Figure 10)；It is of the invention further Provide the scheme for combining of therapeutic vaccine and chemotherapeutic agent.In a case study on implementation, vaccine provided by the invention with Inhibitory rate is administered to 74% in oxaliplatin, and tumor-bearing mice tumour growth obtains conspicuousness and suppresses (see Figure 11)；And book Invent 62 days mean survival time (MST)s of the vaccine provided and oxaliplatin administration group mouse, its life prolongation effect is difficult to understand with positive control Husky profit platinum group is compared to tool statistical significance (see Figure 11)；In addition, by vaccine provided by the invention be applied to mouse breast cancer, lung cancer, The treatment of the model such as liver cancer and stomach cancer is (see Figure 13,14,15,16, compared with negative control group, the tumor growth rate of vaccine group All substantially slow down.
Brief description of the drawings
Fig. 1 shows the construction strategy of DNA plasmid carrier and plasmid CpDV-IL2-sPD1/MS；Wherein, Fig. 1-a show recombinant DNA Plasmid CpDV-IL2-MS and plasmid CpDV-IL2-sPD1/MS；Fig. 1-b show the construction strategy of plasmid T Easy-sPD1/MS；Figure 1-c shows the construction strategy of plasmid T Easy-tPA/sPD1；Fig. 1-d show the construction strategy of support C pDV-IL2；Fig. 1-e show restructuring DNA plasmid CpDV-IL2-sPD1/MS collection of illustrative plates；
Fig. 2 shows that Western Blot engram analysis show CpDV-IL2-MS, CpDV-IL2-sPD1/MS, CpVR-sPD1 Eukaryotic protein expression；Wherein, Fig. 2-a show with anti-MUC1 antibody detection proteins expression；Fig. 2-b show with anti-Survivin Antibody detection protein expression；Fig. 2-c show with anti-PD-1 antibody detection proteins expression；
Fig. 3 shows the structure of pET28a-sPD1/MS plasmids；Wherein, Fig. 3-a show recombinant plasmid pET28a-sPD1 collection of illustrative plates；Figure 3-b shows recombinant plasmid pET28a-sPD1/MS collection of illustrative plates；
Fig. 4 shows the structure of restructuring sPD1/MS vector-viral vaccines；Wherein, Fig. 4-a show that recombinant shuttle plasmid pSC11-MS schemes Spectrum；Fig. 4-b show recombinant shuttle plasmid pSC11-sPD1/MS collection of illustrative plates；Fig. 4-c show recombinant shuttle plasmid pDC316-MS collection of illustrative plates；Figure 4-d shows recombinant shuttle plasmid pDC316-sPD1/MS collection of illustrative plates；
Fig. 5 shows the anti-mucin 1 of the immune mouse of sPD1/MS recombinant DNA vaccines induction and the humoral immune response of survivin； Fig. 5-a show that PBS is immunized in Balb/c mouse respectively and to recombinate the serum ELISA detections after MS, sPD1/MS and sPD1DNA plasmid anti- Mucin 1 antibody, Fig. 5-b show the anti-survivin antibody level of immune mouse；Fig. 5-c show the anti-solubility PD1 antibody water of immune mouse It is flat；Fig. 5-d show the serum levels of the IgG1 and IgG2a antibody of mucin 1 in immune mouse；Fig. 5-e show that immune mouse antibiosis is deposited The serum levels of the IgG1 and IgG2a antibody of element；
Fig. 6 shows that sPD1/MS recombinant DNA vaccines trigger Mice Body internal specific cellullar immunologic response；Balb/c mouse are distinguished Immune PBS and restructuring MS, sPD1/MS and sPD1DNA plasmid, take splenic lymphocytes analysis mucin 1 and survivin specificity to exempt from Epidemic disease response is horizontal；Wherein, Fig. 6-a are shown as each group and the secretion of gamma-IFN that mouse spleen lymphocyte is directed to MUC1 epitope specificities are immunized Elispot number of spots, Fig. 6-b show the Elispot number of spots for Survivin epitope specificity secretion of gamma-IFN；Figure 6-c shows that the CTL activity of the splenic lymphocytes of mouse is immunized in each group, makees effector cell E with splenic lymphocytes, and select stable expression The CT26 cells of mucin 1 and survivin protein make target cell T, by being marked after propidium iodide and the double fluorescent dyeings of CFSE Killing target cell group's percentage of note characterizes ctl response intensity；Fig. 6-d show the cooperative programs of sPD1 and MS tumor vaccines to small The Elispot number of spots of mouse splenic lymphocytes specific secretion IFN-γ；
Fig. 7 shows the Prime-Boost immunization strategies of sPD1/MS recombinant DNA vaccines；PBS, again is immunized in Balb/c mouse respectively Group sPD1/MS DNA vaccinations, recombinant adenovirus vaccine rAD-MS, and DNA vaccination/rAD-MS vaccines, are examined by Elispot methods Survey each group and mouse spleen lymphocyte is immunized for the specific immune response of mucin 1 and survivin activity；Wherein, Fig. 7-a show Elispot number of spots of the mouse spleen lymphocyte for the secretion of gamma-IFN of MUC1 epitope specificities is immunized in each group, and Fig. 7-b show For the Elispot number of spots of Survivin epitope specificity secretion of gamma-IFN；
Fig. 8 shows the Prime-Boost immunization strategies of sPD1/MS recombinant viral vaccines；Balb/c mouse respectively be immunized PBS, RMVA-sPD1/MS, and DNA vaccination/rMVA-sPD1/MS vaccines, each group mouse spleen lymphocyte pin is detected by Elispot To the specific immune response activity of mucin 1 and survivin, wherein, Fig. 8-a show that each group mouse spleen lymphocyte is directed to MUC1 The Elispot number of spots of the specific secretion IFN-γ of epitope, Fig. 8-b show secretes IFN- for Survivin epitope specificities The Elispot number of spots of γ；
Fig. 9 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in melanoma model mouse；Wherein, Fig. 9-a show C57BL/6 mouse hypodermic inoculations MSf +After B16 tumour cells, PBS, MS vaccine and sPD1/MS vaccines are given respectively, measure tumour The situation of the 17th day after being as low as inoculated with greatly；Fig. 9-b, which show, to be observed after mouse survival situation is observed to tumor inoculation the 50th day；
Figure 10 shows therapeutic effect of the sPD1/MS recombinant viral vaccines in melanoma model mouse；It is subcutaneous in C57BL/6 mouse It is inoculated with MSf +After B16 tumour cells, PBS, rMVA-sPD1/MS recombinant poxvirus vaccine and rDA-sPD1/MS restructuring are given respectively Adenovirus is medical, the 12nd day measurement record tumour growth change curve after inoculated tumour；
Figure 11 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in colorectal cancer model mice；It is subcutaneous in Balb/c mouse It is inoculated with MSf +After CT26 tumour cells, give respectively PBS, MS vaccine, sPD1/MS vaccines, oxaliplatin, MS/ oxaliplatins and SPD1/MS/ oxaliplatins；Wherein, Figure 11-a show the situation of the 25th day after measurement tumor size to inoculation；Figure 11-b show that observation is cut Whole mouse are only put to death on the day of day, tumor tissues is stripped and measures knurl weight；Figure 11-c show that mouse survival situation is observed to tumour and connect The 65th day after kind；
Figure 12 shows therapeutic effect of the sPD1/MS recombinant protein vaccines in colorectal cancer model mice；In Balb/c mouse skins Lower inoculation MSf +After CT26 tumour cells, give PBS, Al (OH) 3 adjuvant respectively, and albumen/Al (OH) 3 is treated, inoculated tumour Whole mouse are put to death within the 26th day afterwards；Wherein, Figure 12-a show stripped each group mouse tumor weight；Figure 12-b show that each group lotus knurl is small Ability of the mouse splenic lymphocytes for the specific secretion IFN-γ of MUC1 and Survivin epitopes；
Figure 13 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in breast cancer model mouse；In Balb/c mouse notch grafts Kind MSf +4T1 tumour cells, inject PBS and sPD1/MS vaccines respectively, measure mouse tumor the 11st day after inoculated tumour Volume, records tumor growth curve；
Figure 14 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in lung cancer model mouse；C57BL/6 mouse hypodermic inoculations MSf +Lewis tumour cells, inject PBS and sPD1/MS DNA vaccinations, measure and record the 8th day after inoculated tumour respectively Mice tumors grew curve；
Figure 15 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in liver cancer mice；Balb/c mouse hypodermic inoculations MSf +H22 tumour cells, inject PBS and sPD1/MS vaccines, are measured after inoculated tumour the 12nd day and record mouse respectively Tumor growth curve；
Figure 16 shows therapeutic effect of the sPD1/MS recombinant DNA vaccines in model of gastric carcinoma mouse；615 mouse hypodermic inoculation MSf + MFC tumour cells, inject PBS and sPD1/MS vaccines, are measured after inoculated tumour the 12nd day and record mouse tumor respectively Growth curve；
Figure 17 shows that the Study On Cellular Immune of vaccine is significantly improved using after living gene importing equipment device；Wherein, scheme 17-a shows immunization strategy；Figure 17-b show the level of immune rear lymphocytic emiocytosis IFN-γ；Figure 17-c show that immune rear CTL is horizontal；
Figure 18 shows that vaccine is significantly improved in terms of tumour growth is suppressed using after living gene importing equipment；Wherein, scheme 18-a shows immunization strategy；Figure 18-b show immune rear gross tumor volume；Figure 18-c show that immune rear CTL is horizontal；Figure 18-d show it is immune after ELISPOT testing results.
Embodiment
The present invention provides recombinant vaccine and its application, those skilled in the art can use for reference present disclosure, be suitably modified Technological parameter is realized.In particular, all similar substitutions and modifications be for a person skilled in the art it is aobvious and It is clear to, they are considered as being included in the present invention.The method of the present invention and application are retouched by preferred embodiment State, related personnel substantially can not depart from present invention, methods herein and application are modified in spirit and scope or Suitably change with combining, to realize and using the technology of the present invention.
Cell culture used herein, molecular genetics, nucleic acid chemistry, biochemistry, Immunology Lab operation step Suddenly it is widely used conventional steps in corresponding field.Meanwhile for a better understanding of the present invention, relational language is provided below Definition and explanation.
Antigen (antigen, Ag), is to refer to stimulate body to produce (specificity) immune response, and energy and immune response Product antibodies and sensitized lymphocyte combine in vitro, and the material of immunological effect (specific reaction) occurs.Antigen is can be The section of DNA or DNA fragmentation that immune response is induced after host animal in being handed to；Polypeptide, epitope, haptens or any combination thereof.
" polypeptide " and " protein " is used interchangeably herein, it is intended that the polymer of continuous amino acid residue.Term " core Acid ", " nucleotide " are used interchangeably, and refer to RNA, DNA, cDNA (complementary DNA) or cRNA (complementary RNA) and its derivative, example Such as include the form through modifying main chain.
" fusion " refers to two or more protein fusion expressions to form the technology of fusion protein.In general, by making The DNA fragmentation for encoding two or more albumen is linked together with meeting frame with recombinant DNA technology, and carries out protein Express to obtain fusion protein.Fusion, which uses, to be referred to the sequence of MS and sPD-1 being merged, the method that vaccine is made.
" being used in combination " or " combined immunization " refers to that using more than a kind of therapeutant is treated or be immunized to subject. " joint " gives subject without limitation the order for the treatment of.For example, the first vaccine (for example, using MS as the vaccine of target spot) can be with (for example, 5 minutes, 15 minutes, 30 points before the second vaccine (for example, using sPD-1 as the vaccine of target spot) is given to subject Clock, 45 minutes, 1 it is small when, 2 it is small when, 4 it is small when, 6 it is small when, 12 it is small when before), simultaneously or after which (for example, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 it is small when, 2 it is small when, 4 it is small when, 6 it is small when, 12 it is small when) give.
" prevention " refers to treat, prevent or improve disease or the associated patient's condition or symptom.
" carrier (vector) " refers to, a kind of nucleic acid delivery vehicle that can be inserted polynucleotide.A kind of carrier The element that can be expressed containing various control, includes but not limited to, promoter sequence, transcriptional initiation sequence, enhancer sequence, choosing Select element and reporter gene.In addition, carrier can also contain replication origin.
" host cell " refers to can be used for the cell for importing carrier, it includes but not limited to, such as Escherichia coli or withered grass bacterium Deng prokaryotic, the fungal cell of such as yeast cells or Aspergillus, such as insect cell of S2 drosophila cells or Sf9, or The zooblast of person's such as bhk cell, HEK293 cells or people's cell etc..
" adjuvant " refers to nonspecific immunity strengthening agent, and when it is delivered into body together with antigen or in advance, it can increase The immune response of strong body fight original changes type of immune response.Adjuvant has many kinds, include but not limited to aluminium adjuvant (such as Aluminium hydroxide), Freund's adjuvant (such as complete Freund's adjuvant and incomplete Freund's adjuvant), corynebacterium, lipopolysaccharides, cell Factor etc..Freund's adjuvant is most common adjuvant in current animal experiment.Aluminum hydroxide adjuvant then in clinical trial use compared with It is more.
" adjuvant sequence " refers to the sequence of Inner adjuvant, and Inner adjuvant is the purpose that can strengthen amalgamation and expression therewith The adjuvant of the immunogenicity of albumen (antigen), it typically is polypeptide fragment.
Vaccine (vaccine) refers to prevent, control generation, the prevalence of infectious disease, the epidemic disease for human body immunization campaign Seedling class preventive biological products." DNA vector vaccine " refers to, the vaccine based on DNA or RNA (such as plasmid, such as expression plasmid), It optionally also includes adjuvant." recombinant protein vaccine " is another common form of tumor vaccine, different from DNA vaccination or virus Carrier bacterin, it is to enter cell in the form of antigen protein, can directly activate Dendritic Cells；Simultaneously as protein form without Method is incorporated into host cell gene group, has higher security.Viral vector described in " vector-viral vaccine ", which has, to be replicated Ability can keep itself infectiousness as the carrier of foreign gene.
Examination material, reagent, the instrument that the present invention uses are all common commercially available product, can all be bought in market.
Using hairs of the MS as its construction method of the vaccine of target spot with reference to Application No. 200910252427.X involved in the present invention Bright patent.
With reference to embodiment, the present invention is further explained：
Embodiment 1：The structure of recombinant DNA carrier vaccine sPD1/MS
1.1tPA/sPD1 gene chemical synthesis and T Easy-tPA/sPD1 structures
According to GeneBank NM_005018.2 gene chemical synthesis people's PD-1 extracellular fragment sequences, its gene order 5 ' end is connected with 69bp tPA signal peptide sequences are (see SEQ ID NO：10) purpose for, introducing tPA signal peptides is to improve fusion protein sPD1/MS In extracellular secreting, expressing ability.Thereafter, restriction enzyme site, PCR reactants are introduced at tPA/sPD1 genes both ends using round pcr It is 50 μ l, including 0.1 μ g SEQ ID NO:TPA/sPD1DNA templates described in 1, primer SEQ ID NO:12 and SEQ ID NO:13 final concentration 20pmol, 5 μ l Ex Taq Buffer (10 ×), 4 μ l dNTP Mixture (each 2.5mM), 1.25U Ex Taq enzyme (Takara companies)；PCR reaction conditions are 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 30s, and it is anti-to carry out 35 cyclic amplifications altogether Should.Thereafter the PCR product of glue reclaim is connected on pGEM T Easy (promega companies) carrier, reaction condition is 16 DEG C 4h.10 μ l of connection product are taken, are transformed into competence Escherichia coli Top10 (Invitrogen companies), coating ampicillin resists Mild-natured plate, 37 DEG C of culture 16h.Picking monoclonal is in 5ml ammonia benzyl resistance LB culture mediums, 37 DEG C of 220rpm shake cultures 16h.At a high speed After cultivated thalline is harvested by centrifugation, plasmid extraction kit (Beijing Tiangeng biochemical technology Co., Ltd) extraction plasmid, uses BglII After BamHI double digestions, 0.8% agarose gel electrophoresis identification positive colony, obtains plasmid T Easy-tPA/sPD1 (see figure 1-b)。
The structure of 1.2CpVR-sPD1 plasmids
CpVR monocistrons are to be got in the insertion CpG motif transformations of VR1012 plasmid backbones (referring to application inventor's early period Number be 201110086366.1 patent of invention), CpVR-sPD1 independently expresses solubility PD-1 albumen, is as a kind of sPD1/ The control plasmid form of MS integrative nucleic acid vaccines.Specifically construction method is：With the double digested plasmid T of PstI and BamHI Easy-tPA/sPD1, the linear sPD1 target gene of glue reclaim are connected with each other with support C pVR, and reaction condition is 16 DEG C and stays overnight.Will 10 μ l of connection product are transformed into competence Escherichia coli Top10, are coated with kalamycin resistance tablet, 37 DEG C of culture 16h.Picking list It is cloned in 5ml cards that resistance LB culture medium shake cultures 16h.Thalline after harvest culture at a high speed, extracts plasmid using use The identification of 0.8% agarose gel electrophoresis is carried out after PstI and BamHI is double digested, screening obtains positive colony CpVR- sPD1。
The structure of 1.3CpDV-IL2-sPD1/MS plasmids
Structure based on sPD1/MS recombinant DNA vaccines is broadly divided into two steps.First, by the plasmid comprising target gene CpVR-MS (referring to patent of invention of Application No. 200910252427.X) is double digested using BglII and BamHI, passes through T4DNA connection enzyme effects, by the polyclone enzyme enzyme site of MS fusion tumor antigen gene insertion plasmid T Easy-tPA/sPD At BamHI, so as to obtain plasmid integrative nucleic acid plasmid T Easy-sPD1/MS (see Fig. 1-c).
Secondly, the bicistronic mRNA CpDV-IL2- of structure expression interleukin-22 (IL-2) gene and sPD1/MS integrative nucleic acids SPD1/MS, particular technique method are：Using round pcr amplification human interleukin-2 (IL-2) gene, (sequence refers to SEQ ID NO: 9), in 50 μ l PCR reaction systems, 0.1 μ g template plasmids CpDV-IL2-MS is added (referring to Patent No. ZL The patent of invention of 200910252427.X), the primer SEQ ID NO of final concentration 20pmol:14 and SEQ ID NO:15, other groups Divide with reaction condition as described above.PCR product passes through the double digested reactions of XbaI and BamHI, with support C pDV (referring to special Profit number is the patent of invention of ZL 201110086366.1) being connected prepares transition plasmid CpDV-IL2.SPD1/MS will be included again The T Easy-sPD1/MS of integrative nucleic acid carry out the double digested processing of BglII and EcoRI, are inserted into plasmid backbone CpDV-IL2 Corresponding polyclone enzyme enzyme site at, the DNA vector vaccine CpDV-IL2-sPD1/MS (i.e. sPD1/MS vaccines), structure is made Build strategy and see Fig. 1-d.
The western blot of 1.4 recombinant plasmid vivoexpression tumour antigens and sPD1 are identified
To transfect the 293T cell crackings supernatant of empty carrier VR1012 as negative control, by recombinant plasmid CpDV-IL2-MS (abbreviation MS), CpDV-IL2-sPD1/MS (abbreviation sPD1/MS), and each 2 μ g of CpVR-sPD1 (abbreviation sPD1) transfect 293T respectively Cell, collects cell cracking supernatant after 72h, is transferred to after SDS-PAGE is separated on nitrocellulose filter and carries out Western Blot Western blottings identify the trace appraisal of recombinant plasmid antigen MUC1, Survivin and albumen sPD1 successively.As a result As shown in Fig. 2, wherein Fig. 2-a show the MUC1 traces of MS plasmids, sPD1/MS plasmids and sPD1 plasmids, sPD1 is as control matter For grain without display band, the expection size of plasmid MS and sPD1/MS are 95KD and 120KD respectively, are MS as can be seen from Figure With the actual protein bands that graded series are presented of sPD1/MS, and main stripe size, all in more than 150KD, this is probably MUC1 eggs The pyrolysis product of white glycosylation modified product or specific proteins enzyme effect；Fig. 2-b show MS plasmids, sPD1/MS plasmids and The Survivin traces of sPD1 plasmids, since Survivin and MUC1 are fused antigens, so the western blot presented with MUC1 results are similar, its main pillar location is all in more than 150KD；Fig. 2-c show MS plasmids, sPD1/MS plasmids, sPD1 plasmids and The PD-1 traces of empty carrier VR1012, empty carrier does not show band as negative control, and sPD1/MS plasmids and sPD1 plasmids Size be respectively 150KD and 35KD, by the figure as it can be seen that the sPD1/MS albumen of amalgamation and expression is not on sPD1 albumen Glycosylation modified or hydrolysis, ensure that the structural intergrity of sPD1 so as to be attached on PD-L1 ligands.
CpDV-IL2-sPD1/MS recombinant gene vaccines of the present invention are a kind of based on tumor antigen gene vaccine Optimization form, plasmid construct are illustrated as shown in Fig. 1-a.Tumour antigen MUC1 and Survivin belong to a kind of tumor associated antigen (TAA), TAA is derived from the antigen rather than exogenous antigen of itself, this causes its Specific T cell immunity reaction triggered to limit System.In order to improve the validity of tumor gene vaccine, using tumour antigen and the solubility with blocking immunity inhibitory action The DNA vaccination design that programmed cell death -1 (PD-1) blends.The amalgamation and expression of soluble PD-1 and tumour antigen, make to be based on sPD1 Fusion protein can promote intakes of the DC to antigen by receptor mediated targeted DC cells and activate B cell and T cell.
Embodiment 2：The preparation of recombinant protein vaccine sPD1/MS
Protein vaccine is another common form of tumor vaccine, and different from DNA vaccination or vector-viral vaccine, it is with anti- Former protein form enters cell, can directly activate Dendritic Cells；Simultaneously as protein form can not be incorporated into host cell base Because of group, there is higher security.The present embodiment builds prokaryotic expression carrier pET28a-sPD1/MS, induced expression fusion protein Vaccine (sPD1/MS), specific building process are as follows：
Using methods of homologous recombination structure prokaryotic expression plasmid pET28a-sPD1/MS：By pET28a plasmids (see Fig. 3-a) After Nde I and Xho I double digestions, glue reclaim carrier sequence 5289bp fragments.In PCR amplification CpDV-IL2-sPD1/MS The sequence of sPD1/MS cistrons, the end of primer 5 ' is with to sequence that the pET28a carriers both ends scaled off are homologous and with corresponding Restriction enzyme site (Nde1 and Xho1), primer sequence SEQ ID NO.19
GATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTA
ATCCATGGCAGCCAGCTG and SEQ ID NO.20AGCGGCCTGGTGCCGCGCG
GCAGCCATATGGATGCAATGAAGAGAGGGC。
Further according to seamless Cloning Kit-Seamless Assembly Cloning Kit (article No. C5891) specifications into Purpose fragment sPD1/MS and carrier are connected to have obtained pET28a-sPD1/MS (see Fig. 3-b) by row operation.Plasmid is converted Expanded into BL21 competence, add IPTG, 37 DEG C of induced expressions, when 4-6 is small after collect thalline, to thalline carry out ultrasound Supernatant discarding after cracking；Precipitation is resuspended with solubilization of inclusion bodies Buffer, 4 DEG C of magnetic agitation dissolvings are overnight；Centrifugation, receives supernatant, Ni-NTA affinity chromatography column purifications are carried out, carry out imidazole gradient elution, finally obtain the storage final concentration 1mg/ml's of purifying SPD1/MS fusion proteins.
Embodiment 3：The structure of recombinant viral vector vaccine sPD1/MS
The acquisition of 3.1 recombinant poxvirus seedling rMVA-sPD1/MS
Tumour antigen is carried using Ankara poxvirus (Modified Vaccinia Ankara, MVA) association of improvement to be immunized Tumour is treated, its security is higher.The shuttle plasmid of MVA is pSC11, its polyclone enzyme enzyme site having may be inserted into external source Gene, by the sPD1 genes insertions plasmid pSC11-MS that structure is completed early period (referring to Patent No. ZL in this example The patent of invention of 200910252427.X), build pSC11-sPD1/MS, the thymidine kinase left arm and right arm having on carrier (TKL, TKR) can with MVA homologous recombinations, while pass through lacZ gene on carrier, carry out recombinant MVA (rMVA) locus coeruleus screening.
The specific method of pSC11-sPD1/MS shuttle plasmids is built, passes through primer SEQ ID NO first:16 and SEQ ID NO:17 carry out PCR reactions, the tPA-sPD1 genes that both ends introduce restriction enzyme site are obtained, thereafter using SalI and XhoI isocaudarners The double digested of tPA/sPD1 is carried out, with SalI single endonuclease digestions digestion pSC11-MS plasmids (Fig. 4-a), DNA gel recycling purpose Gene and carrier framework, 16 DEG C of connections are overnight.Connection product is transformed into Top10 competence, uses amicillin resistance LB medium cultures obtain the fusion pSC11-sPD1/MS plasmids of restructuring (see Fig. 4-b).
Next in order to obtain recombinant poxvirus, the empty MVA virus infection of titre 0.05pfu/cell is first contained into TK bases The mutant cell of the BHK-21 of cause, be incubated 2 it is small when after, using lipo2000 reagents by shuttle plasmid pSC11-sPD1/MS corotation Contaminate bhk cell.Infected cell at 37 DEG C, under 5%CO2 cultivate 72 it is small when after, collect cell.Ultrasonic treatment cell, 2000rpm centrifugations 10min retains cracking supernatant.Take appropriate supernatant to make kind of a poison, poxvirus is diluted to 10 successively in six orifice plates-2、10-3、10-4、10-5、10-6When infection bhk cell 2 is small.Culture medium is discarded, with (suppression is wild containing 1%BrdU in equal volume MVA is grown) and 2% low melting-point agarose and 2 × DMEM-20 culture mediums of 42 DEG C of pre-temperatures mix, 2ml culture mediums are added per hole, Solidify at room temperature, when culture 48 is small in 37 DEG C of incubators containing 5%CO2.Layer-selective culture medium is spread, component compares lower floor The more 4%X-gal of 1/120 volume of agar.Overnight incubation, selects blue single spot, multigelation three breakup releasing virus, into Row next round is screened, and step is identical, so carries out more than 6 wheels screening, last until obtaining gram containing only recombinant virus MVA-MS Grand strain.
The acquisition of 3.2 recombinant adenovirus vaccines
Adenovirus AdMaxTMAdenovirus carrier systems (Microbix companies) include shuttle vector and adenovirus carries Body.(invention referring to Patent No. 200910252427.X is special using the shuttle plasmid pDC316-MS built early period for this example Profit, Fig. 4-c), by sPD1 genes by PCR method, by primer SEQ ID NO:18 and SEQ ID NO:13 gene 5 ' and 3 ' ends introduce EcoRI restriction enzyme sites, double digested to the PCR product EcoRI of pDC316-MS and sPD1 genes, 16 DEG C of connections Overnight.Connection product is transformed into Top10 competence, and is cultivated in the LB culture mediums of 37 DEG C of amicillin resistances, by matter Grain sequencing screening obtains positive colony pDC316-sPD1/MS (see Fig. 4-d).
The followed by homologous recombination of adenovirus (AD), the adenoviral backbone in this example is pBHGlox Δs E1,3Cre. By 293 cell of AD carriers and shuttle plasmid pDC316-sPD1/MS cotransfections, using the E1 albumen in 293 cells, by 10 days Left and right produces the recombined adhenovirus plaque containing sPD1/MS integrative nucleic acids.PCR identifications, 95 DEG C of reaction condition are carried out to plaque 30s, 55 DEG C of 30s, 72 DEG C of 1min, react 30 circulations, so as to screen correct plaque largely expand and purify.
Embodiment 4：The immunogenicity of sPD1/MS tumor vaccines
The humoral activity of 4.1sPD1/MS integrative nucleic acid vaccines
ELISA method detection sPD1/MS chimeric DNA vaccines are directed to the antibody response of MUC1 and Survivin, and with MS epidemic diseases The Humoral of seedling (referring to the patent of invention of Patent No. ZL 200910252427.X) is compared.Select 4-6 week old Balb/c mouse, set sPD1/MS vaccine experiments group, MS vaccine control groups, independent sPD1 plasmid controls group and PBS cloudy by table 1 Property control group, the preparation of above-mentioned DNA plasmid dissolved with sterile PBS, and final concentration is adjusted to 1mg/ml.Specific immune programme It is：Just exempted from DNA vector vaccine within 0th week and the 2nd week, with recombinant adenovirus vaccine booster immunization, choose limb on rear side of mouse within the 4th week Each 50 μ g of intramuscular injection vaccine.Eye corner of the eyes blood sampling was carried out to mouse in two weeks after last time is immune, the serum of centrifugation is used for ELISA antibody tests.
The immunogenicity of table 1sPD1/MS integrative nucleic acids vaccine and MS nucleic acid vaccines
The results show that the mouse of inoculation sPD1/MS vaccines can produce efficient anti-mucin 1 antibody and anti-survivin resists Body, and both antibody titers are up to more than 10000.As shown in Fig. 5-a and 5-b, by 1:The mice serum of 125 dilution proportions Respectively using prokaryotic expression and to purify the MUC1 albumen, Survivin albumen and solvable sPD1 albumen of harvest special as antigen detection Property antibody response, wherein sPD1/MS vaccine groups are compared with MS vaccine groups, anti-MUC1 antibody and anti-Survivin antibody absorbance (450nm) readout has conspicuousness to improve (P ＜ 0.001), illustrates the sPD1/MS integrative nucleic acids tumor vaccine of optimization and can open Dynamic strong specific humoral immune response；And it is inoculated with CpVR-sPD1 plasmids group and PBS group ELISA antibody responses are all negative. In addition, ELISA detects that sPD1/MS vaccine groups and sPD1 plasmid group mice serums can produce certain anti-PD1 antibody responses (see Fig. 5-c), but PD1 antibody titers are relatively low can not produce substantial amounts of antibody in vivo to block PD-1 negativity signal paths, Show that sPD1 integrative nucleic acid vaccines may be by the immune system performance antitumor action of activation mouse.Meanwhile sPD1/MS Vaccine also embodies what is become apparent than MS vaccine group on inducing antigen-specific IgG1 (Th2 types) and IgG2a (Th1 types) response Advantage (see Fig. 5-d, 5-e).
4.2sPD1/MS integrative nucleic acid vaccine bebcells immunocompetence detects
In order to investigate specific immune response of the restructuring sPD1/MS DNA vaccinations to mucin 1 and survivin, application The number of spots of mouse spleen lymphocyte specific secretion IFN-γ is immunized in Elispot method measure table 1, while detects each group and be immunized Mouse lymphocyte CTL killing activities.Elispot testing results stimulate, sPD1 matter as disclosed in Fig. 6-a by MUC1 albumen Grain group splenocyte is unresponsive to albumen stimulation, shows that independent sPD1 albumen can not activate body specific cellular immunity effect；MS The IFN-γ number of spots of vaccine group splenocyte secretion has the difference of 2 multiple values compared with PBS negative control groups, and sPD1/MS vaccines Group splenocyte secretion of gamma-IFN number of spots is then substantially higher by the negative group number of spots several times of PBS, sPD1/MS vaccines and MS vaccines Group number of spots is relatively without embodiment difference.In addition, being stimulated by Survivin albumen, as a result such as Fig. 6-b are shown, individually SPD1 plasmid immunized mices are also without responsing reaction；And the splenocyte point of mouse is immunized in MS vaccine groups and sPD1/MS vaccine groups Secrete the spot of IFN-γ compared with PBS negative control groups, be presented positive reaction, two groups of sPD1/MS vaccines and MS vaccine groups it Between number of spots compare, sPD1/MS vaccines are significantly more than MS, and have the statistical significance of P values 0.0141.
It is thin to stablize the CT26 of expression fusion tumor antigen protein MS using immune mouse spleen lymphocyte as effector cell Born of the same parents (are named as MSf +CT26, wherein f abridge for full, represent the total length survivin protein for not truncating N-terminal amino acid) it is thin as target Born of the same parents, are lived according to after certain effect target ratio mixing using propidium iodide (PI)/CFSE Two Colour Fluorescence dye markers method detection CTL killings Property, the result is shown in Fig. 6-c.As seen from the figure, MS vaccine groups and sPD1/MS vaccine groups are in effect target ratio 12.5:1 and 50:When 1, all characterize Go out to be higher than the CTL lethal effects of PBS groups；Compare between MS vaccine groups and sPD1/MS vaccine groups, sPD1/MS vaccines correspond to different Imitate target than killing rate be respectively 34.76% and 35.56%, and MS vaccine killing rates are respectively 21.65% and 30.39%, are shown The vaccine form CpDV-IL2-sPD1/MS so optimized has more CTL killing activities.
To sum up, in the Evaluation of Immunogenicity of CpDV-IL2-sPD1/MS vaccines and CpDV-IL2-MS vaccines, the epidemic disease of optimization Seedling form sPD1/MS can induce more efficient specific humoral immune response and cellullar immunologic response.
Effect of the cooperative programs of 4.3sPD1 and MS tumor vaccines to mouse immune activity
The preparation method of usual polygenes vaccine includes two kinds, and a kind of is the integrative nucleic acid epidemic disease for preparing polygenes amalgamation and expression Seedling, it is another then be in a manner of co-injection by two or more gene vaccine carry out combined immunization.In order to inquire into sPD1 The diversity of vaccine form prepared by gene association MS genes, sPD1/MS recombinant DNA vaccines are compared in this part experiment, with sPD1 The mouse immune activity that joint MS vaccines are induced.Specific experiment packet is as shown in table 2：4-6 week old mouse are randomly divided into PBS Group, sPD1/MS groups and sPD1+MS groups, are provided with PBS groups mouse and injected the sterile PBS conducts of 100 μ l at the 0th, 2 and 4 week respectively Negative control；SPD1/MS groups mouse recombinated sPD1/MS integrative nucleic acid vaccines in injection in the 0th and 2 week, was recombinated with rAD-MS within the 4th week Adenovirus vaccine booster immunization；SPD1+MS groups mouse injected the CpVR-sPD1 plasmids and CpDV- mixed in advance at the 0th and 2 week IL2-MS plasmids (each 100 μ g), equally use recombined adhenovirus seedling booster immunization on the 4th week.
The cooperative programs of table 2sPD1 and MS vaccines
The ability of 6th week detection each group mouse spleen lymphocyte specific secretion IFN-γ, as a result as shown in Fig. 6-d, with PBS negative control groups are compared, the CpVR-sPD1 and CpDV- of integrative nucleic acid vaccine CpDV-IL2-sPD1/MS and combined immunization IL2-MS vaccines all cause elispot number of spots showed increased (the P ＜ of T lymphocytic emiocytosis MS specificity IFN-γ 0.01).Meanwhile comparing the mode of sPD1/MS vaccines and sPD1+MS combined immunizations, it induces the specific cell of generation to exempt from Epidemic disease reaction is in more consistent level, shows the vaccine that sPD1 genes are prepared with MS tumor antigen genes, has integrative nucleic acid A variety of vaccine forms of vaccine and joint co-injection vaccine.
Embodiment 5：The immunization strategy of sPD1/MS tumor vaccines
The immunization strategy of 5.1sPD1/MS recombinant DNA vaccines
This part experiment just exempts from the-immunization strategy of recombined adhenovirus booster immunization using DNA, investigates recombinant adenovirus vaccine The mucin 1 and the booster action of survivin specific immune response that rAD-MS induces sPD1/MS vaccines：By 4-6 week old Mouse is grouped at random by table 3, every group 6, wherein the 1st group of intramuscular injection PBS is as negative control；2nd group in the 0th week list Solely immune recombinant adenovirus vaccine rAD-MS (1 × 108Pfu/ is only)；3rd group was injected DNA vaccination respectively at the -4th, -2 and 0 week； 4th group then in the week of the -6th, -4 and -2 injection DNA vaccination, the 0th week injection recombinant adenovirus vaccine.All group mouse were in the 2nd week Draw neck is sterile after putting to death to take spleen, immune mouse is evaluated for mucin 1 and the immune response of survivin epitope using Elispot methods It is horizontal.
Table 3DNA just exempts from-recombined adhenovirus booster immunization strategy
Mouse spleen lymphocyte Elispot testing results are immunized for 2 corresponding each group of table in Fig. 7-a and Fig. 7-b.Can be with by figure Find out, by MUC1 epitopes (SEQ ID NO:Or Survivin epitopes (SEQ ID NO 21):22) each group spleen lymph stimulated Cell only has the 3rd group and the 4th group to generate positive reaction, and compared with PBS negative control groups, its specific secretion IFN-γ spot Count out and increase successively (P ＜ 0.01 successively), and individually recombined adhenovirus rAD-MS vaccine immunities group is negative findings, explanation The cellullar immunologic response that individually immune recombined adhenovirus can not be strong in inducing mouse body；Meanwhile by comparison dna vaccine group and DNA/rAD groups it turns out that, it is active (P ＜ 0.05) that DNA/rAD groups are remarkably reinforced specific immune response, illustrate to exempt from the beginning of DNA- The immunization strategy of recombined adhenovirus booster immunization can be obviously improved the immune effect of sPD1/MS vaccines.
The immunization strategy of 5.2sPD1/MS recombinant viral vaccines
This part experiment is used as investigation object using sPD1/MS recombinant poxvirus vaccines.4-6 week old C57BL/6 mouse are pressed Table 4 is grouped at random, and every group of 5 mouse, wherein negative control group mouse injected sterile PBS at the -4th, -2 and 0 week respectively, individually Immune poxvirus group mouse immune rMVA-sPD1/MS in the 0th week, every mouse injection dosage are 1 × 108Pfu, another experiment Group mouse using sPD1/MS recombinant DNA vaccines just exempt from the -4th and -2 weeks, uses sPD1/MS recombinant poxvirus vaccines within the 0th week Carry out immune strengthening.All group mouse drew neck is sterile after putting to death to take spleen in the 2nd week, and immune mouse is evaluated using Elispot methods It is horizontal for the immune response of mucin 1 and survivin epitope.
The immunization strategy of table 4sPD1/MS recombinant viral vaccines
As a result such as Fig. 8-a and 8-b are shown, compared with PBS negative controls, the individually mouse induction of immune recombinant poxvirus seedling Generate the mucin 1 of the positive and the Elispot spots (P ＜ 0.01) of survivin specific secretion IFN-γ；And use sPD1/ The mouse of the immunization strategy of sPD1/MS poxvirus seedling booster immunizations is just exempted from, recombinates to MS recombinant DNA vaccines, its Immune inducing in vivo produces Efficient specificity cellular immunity response, and compared with rMVA immune groups, produced Elispot number of spots significantly increases (P ＜ 0.01).Result above shows that the recombinant viral vaccine of amalgamation and expression sPD1/MS has the ability of activation mouse specific immunity, And be conducive to the enhancing of this activation using Prime-boost immunization strategies.
Embodiment 6：Antitumor action of the sPD1/MS recombinant DNA vaccines to melanoma model mouse
Inhibitory action of 6.1 vaccines to tumour growth
Therapeutic effect of the tumor inoculation experiment detection restructuring sPD1/MS DNA vaccinations to melanoma model mouse：By 4-6 weeks Age C57BL/6 mouse is by the packet (8/group) at random of table 5.0th day, each group right side of mice caudal part dorsal sc be inoculated with 1 × 105B16 cells (the hereinafter referred to as MS of a stable expression fusion tumour antigen 33M and total length Survivin albumenf +B16), the 1st, 8th, give vaccine injection respectively within 15 days, wherein the 1st group of injection PBS be as negative control, the 2nd, 3 group then inject respectively MS vaccines and SPD1/MS vaccines.Start within the 7th day to observe growing state of the tumour in Mice Body after attacking knurl, test and occurred with control group mice Death is observation node.
Fig. 9-a are melanoma model mouse each group tumour growth volume change situation.Compared with negative control PBS groups, MS Vaccine and sPD1/MS vaccines all slow down the growth of melanoma, and wherein sPD1/MS vaccines show notable tumor-inhibiting action (P ＜ 0.01), cut-off observes its gross tumor volume inhibiting rate of terminal up to 52.62%.And sPD1/MS vaccines are compared with MS vaccines, from inoculation Until observing deadline, tumor growth rate slows down obvious (P ＜ 0.05) to tumour within 15th day, from this, fusion sPD1 CpDV-IL2-sPD1/MS DNA vaccinations can optimize tumor-inhibiting action of the vaccine to tumor-bearing mice.
Table 5 recombinates sPD1/MS DNA vaccinations treatment melanoma tumor model mouse
The life cycle research of 6.2 melanoma tumor-bearing mices
The observation for carrying out melanoma mice life cycle is grouped by table 5, observation deadline was by the 50th day after inoculated tumour.Knot For fruit as shown in Fig. 9-b, PBS group mean survival time (MST)s are 36 days, and all dead cut-offs are then the 40th day after inoculated tumour.MS vaccine groups Mouse the average survival time 38.5 days, increase in life span 6.94%, no life extension effect compared with negative control PBS groups.And In sPD1/MS DNA vaccination 43 days mouse the average survival time service lifes of group, extend 19.44% (P values 0.0325) compared with control group mice life. Although not having statistical significance between the life cycle of sPD1/MS DNA vaccinations treatment tumor-bearing mice and MS vaccine therapy groups, from On mouse the average survival time service life and life extension trend, restructuring sPD1/MS DNA vaccinations have more advantage.
Embodiment 7：Antitumor action of the sPD1/MS recombinant viral vaccines to melanoma model mouse
In order to investigate inhibitory action of the multi-form of sPD1/MS integrative nucleic acid vaccines to tumour, using rMVA-sPD1/ MS and rAD-sPD1/MS recombinant viruses carry out anti-tumor immunotherapy to melanoma tumor-bearing mice.By the C57BL/6 of 4-6 week old Mouse is randomly divided into PBS feminine genders group, poxvirus vaccine treatment group and adenovirus vaccine treatment group, every group of each 5 mouse.Each group is small Mouse was inoculated with 5 × 10 at the 0th day4A MSf +B16 cells, carry out treatment group mouse in the 1st and 15 day after inoculation sPD1/MS weights respectively Group poxvirus vaccine or recombinant adenovirus vaccine it is immune, feminine gender group mouse is then inoculated with isometric sterile PBS as control.Attack knurl Start within the 10th day the tumour growth situation of observation each group mouse afterwards, as a result such as Figure 10 is shown, compared with PBS negative control groups, RMVA-sPD1/MS vaccine groups and the tumour growth trend of rAD-sPD1/MS vaccine group mouse, which all have, significantly slows down (P ＜ 0.05), untill after attacking knurl the 24th day, the mean tumour volume of sPD1/MS recombinant poxvirus treatment mouse compares control group Gross tumor volume be reduced by about 25%, sPD1/MS recombined adhenovirus treatment mouse mean tumour volume be then reduced by about 23%, show The recombinant viral vector vaccine form of sPD1/MS integrative nucleic acids has the function that effectively to suppress tumour growth.
Embodiment 8：Antitumor action of the sPD1/MS recombinant DNA vaccines to colorectal cancer model mice
Inhibitory action of 8.1 vaccines to tumour growth
This part experiment purpose one be investigate vaccine to the inhibitory action of colorectal cancer model mice tumor growth in vivo and Life extension effect to tumor-bearing mice, on the other hand, using chemotherapeutics oxaliplatin as positive control, by vaccine with changing The combined immunization of medicine oxaliplatin is treated to investigate the two synergy to model mice oncotherapy.By 4-6 week old Balb/ C mouse are grouped by table 3, every group 10, and the 0th day in right side of mice caudal part back subcutaneous vaccination 1 × 106A MSf +CT26 Tumour cell.Each group mouse muscle is vaccinated respectively within 1st, 8,15 day, wherein the 1st group for negative control inject PBS, the 2nd, 5 groups are given MS vaccines, and the 3rd, 6 group is given sPD1/MS vaccines, oxaliplatin (Oxaliplatin, Jiangsu Haizheng Pharmaceutical Co) in table 6 It is administered using intraperitoneal injection mode, per injection dosage 0.5mg/kg, interval is administered once 5 times totally for 5 days.Opened within the 12nd day after attacking knurl Growing state of the record tumour that begins in Mice Body, starts death as observing time node with PBS control group mouse.It is each to calculate The tumor control rate of experimental group, draws neck to put to death whole mouse, peels off tumour and weigh knurl weight in observation node.
Figure 11-a are colorectal cancer model mice tumour growth volume change curve.Learnt by figure, sPD1/MS vaccine groups with The negative groups of PBS substantially slow down compared to tumour growth, and the reduction (P ＜ 0.05) of gross tumor volume was showed since the 23rd day.Meanwhile From the point of view of each group tumor control rate (see Figure 11-b) that knurl weight calculates, the inhibitory rate 30.96% of sPD1/MS vaccines, than MS epidemic disease The tumour inhibiting rate of seedling group 17.18% has the trend of lifting but is not statistically significant.The therapeutic alliance of vaccine and chemical drug oxaliplatin, The results show sPD1/MS vaccines and oxaliplatin are combined so that tumour growth is almost stagnated, tumour inhibiting rate 74.71%, and difficult to understand husky Sharp platinum group tumour inhibiting rate 58.62%.SPD1/MS vaccines compared with single oxaliplatin positive control, suppress with chemical drug joint group Tumor growth effect is obvious (P ＜ 0.01), and in contrast, MS vaccines do not have then with the tumor suppression result of combining of chemical drug with oxaliplatin group It is statistically significant.Illustrate sPD1/MS vaccines while tumour growth is significantly inhibited, can play and assist with chemical drug oxaliplatin Same antitumor action.
Table 6sPD1/MS DNA vaccinations treat the immunization strategy of colorectal cancer model mice
The life cycle research of 8.2 colorectal cancer tumor-bearing mices
The life cycle that colorectal cancer tumor-bearing mice is carried out by the packet of table 6 is observed, and observation deadline is after inoculated tumour 65th day.As a result as shown in Figure 11-c, restructuring MS vaccine group mouse the average survival time 48.5 days, recombinates sPD1/MS vaccine group mouse Mean survival time (MST) is 52 days, extends trend without obvious life with negative control (the average survival time 50 days)；And in vaccine with changing In medicine therapeutic alliance group, it was observed that restructuring MS vaccines or restructuring restructuring sPD1/MS DNA vaccinations and oxaliplatin combine so that Mouse mean survival time (MST), extends 22% and 24% (P ＜ 0.001) compared with PBS groups respectively, wherein restructuring sPD1/MS DNA vaccination joints The life cycle of oxaliplatin treatment group compared with single oxaliplatin treatment group (life extends 14%), embodies certain life Extension acts on (P ＜ 0.05).
Embodiment 9：Tumor-inhibiting action of the sPD1/MS recombinant protein vaccines to colorectal cancer tumor-bearing mice
The vaccine of sPD1/MS recombinant nucleic acid forms can be to produce in inducing mouse body according to embodiment 4 and embodiment 5 Strong MUC1 and Survivin specific cellular immunities, then use sPD1/MS recombinant protein vaccines in the present embodiment, tie at the same time The strategy for closing aluminium adjuvant Al (OH) 3 booster immunization carries out the treatment of colorectal cancer model.Specific packet situation is shown in Table 7：Randomly 4-6 week old Balb/c mouse are divided into PBS negative control groups, 3 adjuvant groups of Al (OH) and adjuvant union and recombination sPD1/MS albumen Vaccine therapy group, every group of 5 mouse.Each group mouse was inoculated with 1 × 10 in the 0th day6A MSf +CT26 tumour cells, the 1st, 8 and 15 day Then receive vaccine therapy, wherein negative group mouse gives the sterile PBS solution of 100 μ l volumes, the injection of 3 adjuvant group mouse of Al (OH) 3 adjuvants of Al (OH) (sigma companies) of isometric 100 μ g dosage, each 100 μ g that albumen/adjuvant group mouse injection mixes in advance Adjuvant and restructuring sPD1/MS albumen.To calculate the tumor control rate of each experimental group, started with PBS control group mouse dead for sight Time node is examined, draws neck to put to death whole mouse in observation node, peels off tumour and weigh knurl weight.
Table 7sPD1/MS protein vaccines treat the immunization strategy of colorectal cancer model mice
The average knurl weight result of each group treatment tumor-bearing mice is as shown in Figure 12-a.The negative group mouse of injection PBS is averaged knurl Weight 3.45g, 3 adjuvant groups of Al (OH) are averaged knurl weight 3.19g, and independent adjuvant does not have a tumor killing effect compared with PBS groups, and sPD1/MS The mouse of fusion protein and adjuvant co-immunization is averaged knurl weight 2.62g, tumour inhibiting rate about 24% compared with negative control group, and has P The statistical significance of ＜ 0.05.Known AL (OH) 3 is common inorganic adjuvant, it can be broken up by inducing T cell and body fluid is exempted from Epidemic disease reaction can be seen that tumor-bearing mice can be suppressed by recombinating sPD1/MS albumen in this example to improve the immunogenicity of vaccine The growth of tumour, meanwhile, analysis and observation terminate each group tumor-bearing mice splenic lymphocytes specific secretion IFN-γ ability (see Figure 12-b), adjuvant also has higher Elispot number of spots (P ＜ 0.01) with protein vaccine co-immunization group, embodies sPD1/ The ability of specificity antineoplastic immunity in MS recombinant protein vaccines induction tumor-bearing mice body.
Embodiment 10：SPD1/MS recombinant DNA vaccines treat breast cancer model mouse
Therapeutic effect of the sPD1/MS integrative nucleic acids vaccine to breast cancer tumor-bearing mice is investigated in this part experiment：By 4-6 week old Balb/c mouse be randomly divided into two groups, every group 10；0th day to mouse inoculation stablize expression mucin 1 and survivin it is small Mouse mammary cells (MSf +4T1), the wherein experimental mice injection with the 8th day progress sPD1/MS DNA vaccination on day 1, the The injection for giving recombined adhenovirus rAD-MS in 15 days, organizes mouse separately as negative control, gives isometric sterile PBS injections. 11st day or so observation mice tumors grew situation of change after inoculated tumour, it is when observing to be started dead with PBS control group mouse Between node.Figure 13 is breast cancer model mice tumors grew volume change curve, by observation terminal, recombinates sPD1/MS vaccines Treatment group's mouse tumor its tumor growth rate compared with PBS groups substantially slows down, and tumor control rate about 40%, illustrates sPD1/MS Recombinant DNA vaccine is to breast cancer tool conspicuousness tumor-inhibiting action (P ＜ 0.001).
Embodiment 11：SPD1/MS recombinant DNA vaccines treat lung cancer model mouse
Therapeutic effect of the sPD1/MS integrative nucleic acids vaccine to lung cancer tumor-bearing mice is investigated in this part experiment：By 4-6 week old C57BL/6 mouse are randomly divided into the negative groups of PBS and sPD1/MS DNA vaccinations treatment group according to table 8, every group each 15；0th day Stablize the murine lung cancer cell (MS of expression mucin 1 and survivin to mouse inoculationf +Lewis), dosage of inoculation is 1 × 105A/ Only；The negative group mouse of wherein PBS were in the 1st, the 8 and 15 day 100 sterile PBS of μ l of intramuscular injection；DNA vaccination group mouse is then the 1st, 8 With the injection for carrying out sPD1/MS DNA vaccinations in 15 days.Start within the 8th day after inoculated tumour to observe mice tumors grew change, with PBS It is observing time node that control group mice, which starts death,.
Table 8sPD1/MS DNA vaccinations treat the immunization strategy of colorectal cancer model mice
Figure 14 is lung cancer model mice tumors grew volume change curve, and restructuring sPD1/MS is individually immunized in outcome measurement The mouse tumor of DNA vaccination treatment group, its tumor growth rate substantially slow down, and compared with the negative group mouse tumors of PBS, have aobvious The tumor killing effect (P ＜ 0.05) of work.To sum up show that there is sPD1/MS recombinant DNA vaccines treatment lung cancer effective antitumor treatment to make With.
Embodiment 12：SPD1/MS recombinant DNA vaccines treat liver cancer mice
This part embodiment investigates the therapeutic effect that restructuring sPD1/MS vaccines are directed to liver cancer tumor-bearing mice.By 4-6 week old Balb/c mouse carry out being randomly divided into two groups, respectively PBS negative control groups and sPD1/MS DNA vaccinations treatment group, every group each 4 Only；The steady murine hepatocarcinoma cell MS for turning mucin 1 and survivin of inoculation in 0th dayf +H22, wherein experimental mice is in the 1st, 8 and 15 Its intramuscular injection sPD1/MS DNA vaccinations, recombined adhenovirus rAD-MS booster immunizations, another group of mouse injection were injected at the 22nd day Isometric sterile PBS is as negative control.It is initially observed the growth of mouse tumor and measures tumour within the 12nd day after inoculated tumour Volume change, as a result as shown in figure 15, the liver cancer mice tumour growth of sPD1/MS recombinant DNA vaccines treatment substantially ease up (P ＜ 0.01), shows that sPD1/MS recombinant DNA vaccines treatment liver cancer has notable tumor-inhibiting action.
Embodiment 13：SPD1/MS recombinant DNA vaccines treat model of gastric carcinoma mouse
This part embodiment chooses glandular stomach cancer cell (MFC) and establishes gastric carcinoma mouse model to investigate sPD1/MS DNA vaccinations Tumor-inhibiting action.615 mouse of 4-6 week old are carried out to be divided to two groups, every group each 4 at random.Each group mouse is in steady turn of inoculation in the 0th day The mice model of forestomach cancer cell MS of mucin 1 and survivinf +MFC, wherein restructuring sPD1/MS vaccine therapies group was at the 1st, 8 and 15 day Intramuscular injection DNA vaccination, the 22nd day injection recombined adhenovirus rAD-MS booster immunization, and another group of mouse is injected in the same time Isometric sterile PBS is as negative control.Start within the 12nd day after inoculated tumour the tumor growth curve of measurement each group mouse, Figure 16 The result shows that the model of gastric carcinoma mouse of sPD1/MS recombinant DNA vaccines treatment, obtains certain suppression tumor effect (P ＜ 0.05).
Embodiment 14：Living gene importing equipment promotes the immunogenicity and antitumous effect of sPD1/MS recombinant DNA vaccines
Living gene importing equipment promotes plasmid into the efficiency of cell in injection site by the effect of electric field.By to work The research of body channel genes instrument different parameters, has obtained the parameter for being adapted to our vaccines：Voltage：36V；Frequency：1Hz；Pulse Number：6 times；Pulsewidth：20ms.This part example studies DNA vaccination Immune enhancement effect living gene importing equipment.Figure 17 After the results show uses living gene importing equipment device, the Study On Cellular Immune of vaccine is significantly improved.Through survivin and After MUC1 albumen stimulates, the horizontal conspicuousness rise of ability and CTL of lymphocytic emiocytosis IFN-γ, uses living gene importing equipment When 20ug dosage can reach and the effect of intramuscular injection 100ug (P ＜ 0.05).Imported using living gene and enhance DNA Immunogenicity.Figure 18 after living gene importing equipment, uses relatively low-dose the results show that in terms of tumour growth is suppressed DNA be the level of original intramuscular injection 100ug of can reach, and after holding 100ug dosage uses living gene importing equipment, Start after attacking knurl after 18 days, produced using 100ug group mouse tumor sizes and the intramuscular injection group of living gene importing equipment notable Sex differernce (P ＜ 0.05).It is horizontal to detect mice with tumor vivo immunization, CTL and ELISPOT results show, are led using living gene After entering instrument, also it is significantly improved compared with the CTL of intramuscular injection group and the ability of secretion of gamma-IFN even if low dose group.
It the above is only the preferred embodiment of the present invention, it is noted that come for those skilled in the art Say, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should be regarded as Protection scope of the present invention.
Sequence table
<110>Changchun BCHT Biotechnology Co.；Jilin University
<120>Recombinant vaccine and its application
<130> MP1606888
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 570
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 1
atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60
tcgcccagca tgcagatccc acaggcgccc tggccagtcg tctgggcggt gctacaactg 120
ggctggcggc caggatggtt cttagactcc ccagacaggc cctggaaccc ccccaccttc 180
tccccagccc tgctcgtggt gaccgaaggg gacaacgcca ccttcacctc cagcttctcc 240
aacacatcgg agagcttcgt gctaaactgg taccgcatga gccccagcaa ccagacggac 300
aagctggccg ccttccccga ggaccgcagc cagcccggcc aggactgccg cttccgtgtc 360
acacaactgc ccaacgggcg tgacttccac atgagcgtgg tcagggcccg gcgcaatgac 420
agcggcacct acctctgtgg ggccatctcc ctggccccca aggcgcagat caaagagagc 480
ctgcgggcag agctcagggt gacagagaga agggcagaag tgcccacagc ccaccccagc 540
ccctcaccca ggccagccgg ccagttccaa 570
<210> 2
<211> 190
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 2
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly
1 5 10 15
Ala Val Phe Val Ser Pro Ser Met Gln Ile Pro Gln Ala Pro Trp Pro
20 25 30
Val Val Trp Ala Val Leu Gln Leu Gly Trp Arg Pro Gly Trp Phe Leu
35 40 45
Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu
50 55 60
Leu Val Val Thr Glu Gly Asp Asn Ala Thr Phe Thr Ser Ser Phe Ser
65 70 75 80
Asn Thr Ser Glu Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser
85 90 95
Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro
100 105 110
Gly Gln Asp Cys Arg Phe Arg Val Thr Gln Leu Pro Asn Gly Arg Asp
115 120 125
Phe His Met Ser Val Val Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr
130 135 140
Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser
145 150 155 160
Leu Arg Ala Glu Leu Arg Val Thr Glu Arg Arg Ala Glu Val Pro Thr
165 170 175
Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly Gln Phe Gln
180 185 190
<210> 3
<211> 2175
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 3
atgcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 60
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 120
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 180
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 240
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 300
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 360
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 420
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 480
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 540
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 600
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 660
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 720
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 780
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 840
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 900
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 960
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 1020
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 1080
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 1140
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 1200
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 1260
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 1320
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 1380
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 1440
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 1500
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 1560
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 1620
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 1680
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 1740
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 1800
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 1860
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 1920
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 1980
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 2040
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 2100
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 2160
actgctcctc cagct 2175
<210> 4
<211> 725
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 4
Met His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser
1 5 10 15
Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr
20 25 30
Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val
35 40 45
Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro
50 55 60
Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro
65 70 75 80
Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro
85 90 95
Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His
100 105 110
Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala
115 120 125
Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro
130 135 140
Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser
145 150 155 160
Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val
165 170 175
Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser
180 185 190
Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr
195 200 205
Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val
210 215 220
Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro
225 230 235 240
Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro
245 250 255
Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro
260 265 270
Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His
275 280 285
Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala
290 295 300
Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro
305 310 315 320
Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser
325 330 335
Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val
340 345 350
Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser
355 360 365
Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr
370 375 380
Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val
385 390 395 400
Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro
405 410 415
Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro
420 425 430
Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro
435 440 445
Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His
450 455 460
Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala
465 470 475 480
Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro
485 490 495
Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser
500 505 510
Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val
515 520 525
Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser
530 535 540
Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr
545 550 555 560
Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val
565 570 575
Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro
580 585 590
Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro
595 600 605
Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro
610 615 620
Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His
625 630 635 640
Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala
645 650 655
Pro Pro Ala Val Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro
660 665 670
Ala Pro Gly Ser Thr Ala Pro Pro Ala Val Glu His Gly Val Thr Ser
675 680 685
Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala Val
690 695 700
Glu His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly Ser
705 710 715 720
Thr Ala Pro Pro Ala
725
<210> 5
<211> 411
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 5
atgcctgcct ggcagccctt tctcaaggac caccgcatct ctacattcaa gaactggccc 60
ttcttggagg gctgcgcctg caccccggag cggatggccg aggctggctt catccactgc 120
cccactgaga acgagccaga cttggcccag tgtttcttct gcttcaagga gctggaaggc 180
tgggagccag atgacgaccc catagaggaa cataaaaagc attcgtccgg ttgcgctttc 240
ctttctgtca agaagcagtt tgaagaatta acccttggtg aatttttgaa actggacaga 300
gaaagagcca agaacaaaat tgcaaaggaa accaacaata agaagaaaga atttgaggaa 360
actgcgaaga aagtgcgccg tgccatcgag cagctggctg ccatggatta a 411
<210> 6
<211> 135
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 6
Pro Ala Trp Gln Pro Phe Leu Lys Asp His Arg Ile Ser Thr Phe Lys
1 5 10 15
Asn Trp Pro Phe Leu Glu Gly Cys Ala Cys Thr Pro Glu Arg Met Ala
20 25 30
Glu Ala Gly Phe Ile His Cys Pro Thr Glu Asn Glu Pro Asp Leu Ala
35 40 45
Gln Cys Phe Phe Cys Phe Lys Glu Leu Glu Gly Trp Glu Pro Asp Asp
50 55 60
Asp Pro Ile Glu Glu His Lys Lys His Ser Ser Gly Cys Ala Phe Leu
65 70 75 80
Ser Val Lys Lys Gln Phe Glu Glu Leu Thr Leu Gly Glu Phe Leu Lys
85 90 95
Leu Asp Arg Glu Arg Ala Lys Asn Lys Ile Ala Lys Glu Thr Asn Asn
100 105 110
Lys Lys Lys Glu Phe Glu Glu Thr Ala Lys Lys Val Arg Arg Ala Ile
115 120 125
Glu Gln Leu Ala Ala Met Asp
130 135
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 7
ggtggtggtt caggaggagg a 21
<210> 8
<211> 3168
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 8
gatgcaatga agagagggct ctgctgtgtg ctgctgctgt gtggagcagt cttcgtttcg 60
cccagcatgc agatcccaca ggcgccctgg ccagtcgtct gggcggtgct acaactgggc 120
tggcggccag gatggttctt agactcccca gacaggccct ggaacccccc caccttctcc 180
ccagccctgc tcgtggtgac cgaaggggac aacgccacct tcacctccag cttctccaac 240
acatcggaga gcttcgtgct aaactggtac cgcatgagcc ccagcaacca gacggacaag 300
ctggccgcct tccccgagga ccgcagccag cccggccagg actgccgctt ccgtgtcaca 360
caactgccca acgggcgtga cttccacatg agcgtggtca gggcccggcg caatgacagc 420
ggcacctacc tctgtggggc catctccctg gcccccaagg cgcagatcaa agagagcctg 480
cgggcagagc tcagggtgac agagagaagg gcagaagtgc ccacagccca ccccagcccc 540
tcacccaggc cagccggcca gttccaagga tctaccatgc acggcgtcac ctctgcccca 600
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 660
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 720
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 780
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 840
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 900
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 960
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 1020
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 1080
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 1140
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 1200
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 1260
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 1320
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 1380
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 1440
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 1500
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 1560
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 1620
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 1680
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 1740
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 1800
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 1860
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 1920
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 1980
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 2040
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tgtcgagcac 2100
ggcgtcacct ctgccccaga caccaggccg gccccgggtt ccactgctcc tccagctgtc 2160
gagcacggcg tcacctctgc cccagacacc aggccggccc cgggttccac tgctcctcca 2220
gctgtcgagc acggcgtcac ctctgcccca gacaccaggc cggccccggg ttccactgct 2280
cctccagctg tcgagcacgg cgtcacctct gccccagaca ccaggccggc cccgggttcc 2340
actgctcctc cagctgtcga gcacggcgtc acctctgccc cagacaccag gccggccccg 2400
ggttccactg ctcctccagc tgtcgagcac ggcgtcacct ctgccccaga caccaggccg 2460
gccccgggtt ccactgctcc tccagctgtc gagcacggcg tcacctctgc cccagacacc 2520
aggccggccc cgggttccac tgctcctcca gctgtcgagc acggcgtcac ctctgcccca 2580
gacaccaggc cggccccggg ttccactgct cctccagctg tcgagcacgg cgtcacctct 2640
gccccagaca ccaggccggc cccgggttcc actgctcctc cagctgtcga gcacggcgtc 2700
acctctgccc cagacaccag gccggccccg ggttccactg ctcctccagc tctcgacatg 2760
cctgcctggc agccctttct caaggaccac cgcatctcta cattcaagaa ctggcccttc 2820
ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat ccactgcccc 2880
actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct ggaaggctgg 2940
gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg cgctttcctt 3000
tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact ggacagagaa 3060
agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt tgaggaaact 3120
gcgaagaaag tgcgccgtgc catcgagcag ctggctgcca tggattaa 3168
<210> 9
<211> 465
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 9
gccatgtata gaatgcagct gctgtcttgt atcgctctga gtctggctct ggtgacaaac 60
agtgctccta catccagctc caccaagaag acacagctac agctcgaaca cttactcctg 120
gacttgcaga tgatattgaa tggcattaac aactacaaga accctaagct gacaagaatg 180
ctgaccttca agttttacat gcctaagaaa gctaccgagc tgaaacatct gcagtgtctg 240
gaagaagaac tgaagcctct ggaagaagtg ctgaacttgg cccaaagtaa gaatttccac 300
ttgagaccca gagacttgat tagcaacatt aacgtgatcg tcctcgaact gaagggatct 360
gagacaacat tcatgtgtga gtacgctgac gagaccgcta ccattgtgga gtttctgaac 420
aggtggatca cattctgtca gagcatcatc tctaccctga cttga 465
<210> 10
<211> 7
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 10
Gly Gly Gly Ser Gly Gly Gly
1 5
<210> 11
<211> 69
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 11
atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60
tcgcccagc 69
<210> 12
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 12
ctgcagagat cttctagaat gg 22
<210> 13
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 13
gaattcggat ccttggaact ggc 23
<210> 14
<211> 28
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 14
tctagagcca tgtatagaat gcagctgc 28
<210> 15
<211> 29
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 15
ggatcctcaa gtcagggtag agatgatgc 29
<210> 16
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 16
tcacgagatc tgtcgacctg caggccgcca ccatggatgc aatgaagaga gggctc 56
<210> 17
<211> 56
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 17
atctaggatc cctcgagtcc tcctcctgaa ccaccacctt ggaactggcc ggctgg 56
<210> 18
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 18
gaattcagat cttctagaat gg 22
<210> 19
<211> 52
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 19
gatctcagtg gtggtggtgg tggtgctcga gttaatccat ggcagccagc tg 52
<210> 20
<211> 49
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 20
agcggcctgg tgccgcgcgg cagccatatg gatgcaatga agagagggc 49
<210> 21
<211> 9
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 21
Ala Pro Asp Thr Arg Pro Ala Pro Gly
1 5
<210> 22
<211> 9
<212> PRT
<213>Artificial sequence (Artificial sequence)
<400> 22
Ser Thr Phe Lys Asn Trp Pro Phe Leu
1 5

Claims (35)

1. a kind of molecular combinations, it is characterised in that including sPD-1, MUC1 and Survivin.
2. molecular combinations according to claim 1, it is characterised in that the DNA sequence dna of the sPD-1 such as SEQ ID NO:1 It is shown, the amino acid sequence such as SEQ ID NO of the sPD-1:Shown in 2.
3. molecular combinations according to claim 1, it is characterised in that the DNA sequence dna of the MUC1 such as SEQ ID NO:3 institutes Show；Its amino acid sequence such as SEQ ID NO:Shown in 4.
4. molecular combinations according to claim 1, it is characterised in that the DNA sequence dna of the Survivin such as SEQ ID NO:Shown in 5；Its amino acid sequence such as SEQ ID NO:Shown in 6.
5. application of Claims 1 to 4 any one of them molecular combinations in the product for preparing anti-curing oncoma.
6. application according to claim 5, it is characterised in that the tumour is selected from melanoma, colorectal cancer, large intestine Cancer, lung cancer, breast cancer, liver cancer, kidney, cholangiocarcinoma, stomach cancer, the cancer of the esophagus, carcinoma of urinary bladder, cancer of pancreas, head and neck cancer, nasopharyngeal carcinoma, oral cavity Cancer, cervical carcinoma, oophoroma, uterine cancer, prostate cancer, carcinoma of testis, squamous cell carcinoma, lymthoma, the cancer of the brain, glioblastoma cell Knurl, medulloblastoma, lymphosarcoma, chorioepithelioma, osteosarcoma, thyroid cancer.
7. application according to claim 5, it is characterised in that the product includes vaccine.
8. application according to claim 7, it is characterised in that the vaccine includes sPD-1, MUC1 and Survivin The recombinant vector of DNA sequence dna.
9. recombinant vector according to claim 8, it is characterised in that the sPD-1 is 5 ' ends of the DNA sequence dna of sPD-1 Modify tPA signal peptide sequences.
10. recombinant vector according to claim 9, it is characterised in that the PD-1 is connected with tPA signal peptide sequences DNA sequence dna such as SEQ ID NO:Shown in 7.
11. recombinant vector according to claim 9, it is characterised in that the DNA sequence dna that the MUC1 is connected with Survivin Such as SEQ ID NO:Shown in 8.
12. a kind of recombinant vector, it is characterised in that including skeleton carrier, SEQ ID NO:DNA sequence dna, SEQ ID shown in 7 NO:DNA sequence dna and adjuvant sequence shown in 8.
13. recombinant vector according to claim 12, it is characterised in that the skeleton carrier is CpDV.
14. recombinant vector according to claim 13, it is characterised in that the adjuvant sequence is proleulzin, its DNA sequence Row such as SEQ ID NO:Shown in 9.
15. application of any one of claim 12~14 recombinant vector in the product for preparing anti-curing oncoma.
16. a kind of vaccine of anti-curing oncoma, it is characterised in that including claim 12~14 any one of them recombinant vector.
17. the vaccine of anti-curing oncoma according to claim 16, it is characterised in that further include PBS solution, claim 12 The concentration of any one of~14 recombinant vectors is 0.1 mg/mL~10mg/mL.
18. the preparation method of any one of claim 16~17 vaccine is, in Xba I and BamH the I digestions of skeleton carrier Adjuvant sequence is inserted between site, SEQ ID NO are then inserted between Bgl II and EcoR I restriction enzyme sites:7 and SEQ ID NO:Sequence shown in 8, after recombinant vector is made, is dissolved in PBS solution.
19. a kind of recombinant vector, it is characterised in that including skeleton carrier, SEQ ID NO:DNA sequence dna and SEQ ID shown in 7 NO:DNA sequence dna shown in 8.
20. recombinant vector according to claim 19, it is characterised in that the skeleton carrier is PET28a.
21. a kind of expression vector, it is characterised in that by any one of the claim 19~20 recombinant vector transfection host cell It is made.
22. a kind of fusion protein, it is characterised in that as the expression vector expression described in claim 21.
23. application of the fusion protein in the product for preparing anti-curing oncoma described in claim 22.
24. a kind of vaccine of anti-curing oncoma, it is characterised in that including the fusion protein described in claim 23.
25. vaccine according to claim 24, it is characterised in that wherein further include adjuvant, the adjuvant is Al (OH)3、 CpG, MPL, QS21, AS02, AS03, Poly-IC and its derivative etc..
26. a kind of recombinant vector, it is characterised in that including skeleton carrier, SEQ ID NO:DNA sequence dna, SEQ ID shown in 7 NO:DNA sequence dna shown in 8, the carrier are pSC11 or pDC316.
A kind of 27. recombinant virus, it is characterised in that with the recombinant vector transfectional cell described in claim 28, in the cell with The virus of infection occurs homologous recombination and is made, and the virus is adenovirus or poxvirus.
28. application of the recombinant virus in the product for preparing anti-curing oncoma described in claim 27.
29. a kind of vaccine of anti-curing oncoma, it is characterised in that including the recombinant virus described in claim 27.
30. a kind of product of anti-curing oncoma, it is characterised in that including claim 16~17 any one of them vaccine, right It is required that 24~25 any one of them vaccines and/or the vaccine described in claim 29.
31. product according to claim 30, it is characterised in that wherein further include chemotherapeutics.
32. a kind of product of anti-curing oncoma, it is characterised in that merge table with sPD-1 including the vaccine and MS using MS as target spot The vaccine reached.
33. product according to claim 32, it is characterised in that wherein further include chemotherapeutics.
A kind of 34. method of anti-curing oncoma, it is characterised in that give claim 30~33 any one of them product.
35. according to the method for claim 34, it is characterised in that give claim 30~33 any one of them product Afterwards, injection site is stimulated with living gene importing equipment.
CN201711190257.8A 2017-11-24 2017-11-24 Recombinant vaccine and its application Pending CN107952069A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201711190257.8A CN107952069A (en) 2017-11-24 2017-11-24 Recombinant vaccine and its application
PCT/CN2018/116393 WO2019101062A1 (en) 2017-11-24 2018-11-20 Recombinant vaccine and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711190257.8A CN107952069A (en) 2017-11-24 2017-11-24 Recombinant vaccine and its application

Publications (1)

Publication Number Publication Date
CN107952069A true CN107952069A (en) 2018-04-24

Family

ID=61962343

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711190257.8A Pending CN107952069A (en) 2017-11-24 2017-11-24 Recombinant vaccine and its application

Country Status (2)

Country Link
CN (1) CN107952069A (en)
WO (1) WO2019101062A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111118063A (en) * 2019-12-05 2020-05-08 吉林大学 FAP α and survivin-based DNA and application thereof in preparation of tumor vaccine
CN113577259A (en) * 2021-08-26 2021-11-02 贵州医科大学 Application of composition in preparation of drugs for inhibiting or treating tumors
CN114790248A (en) * 2022-05-12 2022-07-26 广州医科大学 MUC1-PDL1-IgG1Fc tumor vaccine as well as preparation method and application thereof
CN115976094A (en) * 2022-12-15 2023-04-18 浙江大学杭州国际科创中心 Genetic engineering bacterium for improving endogenous enzyme secretion and construction method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102732543A (en) * 2011-04-07 2012-10-17 长春百克生物科技股份公司 Tumor genetically-engineered vaccine utilizing mucin-1 and survivin as target sites

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0323965D0 (en) * 2003-10-13 2003-11-19 Glaxosmithkline Biolog Sa Immunogenic compositions
JP5702371B2 (en) * 2009-05-27 2015-04-15 デイナ ファーバー キャンサー インスティチュート，インコーポレイテッド Inhibition of inflammation using antagonists of MUC1
CN104013973A (en) * 2009-12-04 2014-09-03 长春百克生物科技股份公司 Tumor DNA (Deoxyribose Nucleic Acid) vaccine and virus vector vaccine taking mucoprotein 1 and surviving as targets
CN102086453B (en) * 2009-12-04 2015-01-07 长春百克生物科技股份公司 Tumor DNA vaccine taking mucin 1 and survivin as targets and viral vector vaccine
EP4130044A1 (en) * 2013-09-13 2023-02-08 BeiGene Switzerland GmbH Anti-pd1 antibodies and their use as therapeutics and diagnostics
SG10201907841UA (en) * 2013-11-22 2019-10-30 Dnatrix Inc Adenovirus expressing immune cell stimulatory receptor agonist(s)
EP3244915A1 (en) * 2015-01-15 2017-11-22 University of Copenhagen Virus-like particle with efficient epitope display

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102732543A (en) * 2011-04-07 2012-10-17 长春百克生物科技股份公司 Tumor genetically-engineered vaccine utilizing mucin-1 and survivin as target sites

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
邱凌翀 等: ""一种靶向MUC1及PD-1的双靶点蛋白疫苗设计及其体液免疫学分析"", 《基因组学与应用生物学》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111118063A (en) * 2019-12-05 2020-05-08 吉林大学 FAP α and survivin-based DNA and application thereof in preparation of tumor vaccine
CN111118063B (en) * 2019-12-05 2023-04-18 吉林大学 FAP alpha and survivin-based DNA and application thereof in preparation of tumor vaccine
CN113577259A (en) * 2021-08-26 2021-11-02 贵州医科大学 Application of composition in preparation of drugs for inhibiting or treating tumors
CN114790248A (en) * 2022-05-12 2022-07-26 广州医科大学 MUC1-PDL1-IgG1Fc tumor vaccine as well as preparation method and application thereof
CN114790248B (en) * 2022-05-12 2023-11-28 广州医科大学 MUC1-PDL1-IgG1Fc tumor vaccine and preparation method and application thereof
CN115976094A (en) * 2022-12-15 2023-04-18 浙江大学杭州国际科创中心 Genetic engineering bacterium for improving endogenous enzyme secretion and construction method and application thereof
CN115976094B (en) * 2022-12-15 2024-02-20 浙江大学杭州国际科创中心 Genetically engineered bacterium for improving secretion of endogenous enzyme and construction method and application thereof

Also Published As

Publication number Publication date
WO2019101062A9 (en) 2019-06-27
WO2019101062A1 (en) 2019-05-31

Similar Documents

Publication Publication Date Title
JP6769865B2 (en) Cancer vaccine and treatment method using it
JP5416968B2 (en) Methods and compositions for eliciting a multivalent immune response against dominant and subdominant epitopes expressed on cancer cells and tumor stroma
AU2017205270A1 (en) Therapeutic anticancer neoepitope vaccine
CN109584966B (en) A kind of design method and cancer of pancreas general vaccines of tumour general vaccines
CN107952069A (en) Recombinant vaccine and its application
CN107519486A (en) The method that immune response is lifted in the infectious treatment with malignant disease
CN107847577A (en) The cancer vaccine of mRNA comprising coding M-like protein matter
CN108085340A (en) A kind of slow virus carrier of CAR and PD1-CD28 Chimerical receptor that is while expressing targeting CD19 and CD20
AU2020380288B2 (en) Combination therapy to treat brain cancer
CN107073070A (en) The method for treating cervical carcinoma
WO2021178661A1 (en) Compositions containing a pathogenic antigen and an immune stimulator
CN110234346A (en) The vaccine of new confrontation zika virus and the combination of the DNA antibody construct for fighting zika virus
CN1871025B (en) Preventive cancer vaccine based on brother of regulator of imprinted sites molecule (BORIS)
CN110167576A (en) The synthesis for targeting the optimization of fibroblast activation protein shares immunogenic composition
CN110267671A (en) For treating the composition and its method of cancer cell
JP2022513125A (en) Interleukin 21 protein (IL21) mutant and its application
CN107286244A (en) Anti-immunity checkpoint PD-L1 and PD-L2 tumor vaccines
CN107286245A (en) PD-L1 and PD-L2 recombinant proteins and application thereof
CN109790224A (en) Tumor-antigen peptide and its application derived from CACNA1H
KR20180059547A (en) Antitumor composition
JP2012521265A (en) Method and apparatus for delivering polynucleotide cancer vaccine to mammalian skin
CN109550044A (en) Versatility polypeptide vaccine and its application in preparation treatment/prevention of pancreatic cancer drug
JP2007505601A (en) vaccine
EP3795593A1 (en) Combination of immune-modulators with tumor specific neoantigens for use in prevention and treatment of tumors
CN109414023A (en) With the composition and method of chimeric poliovirus activated viral antigen presenting cell

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20180424

RJ01 Rejection of invention patent application after publication