CN113577259A - Application of composition in preparation of drugs for inhibiting or treating tumors - Google Patents

Abstract

The composition provided by the invention comprises stattic and survivin mRNA, and combined treatment of the stattic and survivin mRNA vaccines can enhance vaccine-induced anti-tumor immune response, and the composition has the advantages of simpler preparation, lower cost, higher safety, shorter treatment period, better curative effect and capability of obviously improving the survival rate of patients.

Description

Application of composition in preparation of drugs for inhibiting or treating tumors

Technical Field

The invention relates to the technical field of immunotherapy, in particular to application of a composition in preparing a medicament for inhibiting or treating tumors.

Background

Colon cancer is a common digestive tract malignant tumor occurring in colon parts, and the survival rate of 5 years after radical excision is about 50%. Postoperative recurrence and metastasis are the leading causes of their death. Therefore, how to effectively treat colon cancer is one of the problems to be solved urgently.

survivin is a new member of an apoptosis inhibiting protein family, is highly expressed in a plurality of malignant tumors such as lung cancer, colon cancer, breast cancer, pancreatic cancer, prostate cancer and the like, is not detected in normal adult tissues, has strong immunogenicity, and detects specific cellular and humoral immune responses of survivin in a colon cancer patient, and is suitable for construction of cancer vaccines.

Survivin-based Dendritic Cell (DC) vaccines, DNA vaccines and peptide vaccines are currently in preclinical and clinical research.

The DC vaccine is prepared by in vitro co-culturing the separated DCs and antigen, and then returning the DCs loaded with the antigen to a tumor-bearing mouse body, thereby inducing the mouse body to generate a specific immune response aiming at the tumor. Factors influencing DC vaccine preparation and treatment efficacy comprise DC in-vitro amplification, tumor antigen loading efficiency, antigen loading method, maturation promoting technology, antigen loaded DC reinfusion and the like, the whole vaccine preparation process is complicated, the cost is high, and an organism can be induced to generate immune tolerance.

The DNA vaccine needs to cross nuclear membrane to enter nucleus for transcription, the transcribed mRNA is transferred from nucleus to cytoplasm, and the tumor antigen is translated and expressed in cytoplasm to induce body anti-tumor immune response. DNA vaccines have the potential to integrate the host genome.

Peptide vaccines contain only one epitope and have limited immunogenicity.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide application of the composition in preparing a medicament for inhibiting or treating tumors.

The invention is realized by the following steps:

in a first aspect, the embodiments of the present invention provide the use of a composition for the manufacture of a medicament for the inhibition or treatment of a tumour, the composition comprising: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

In a second aspect, embodiments of the present invention provide the use of a composition comprising the inhibitor of apoptosis protein survivin mrna and a STAT3 inhibitor in the manufacture of a medicament for enhancing immunotherapy of a tumour.

In a third aspect, the embodiment of the invention provides an application of a STAT3 inhibitor in preparing a medicament for enhancing immunotherapy of tumors, wherein the immunotherapy is the immunotherapy using an apoptosis inhibitory protein survivin mRNA as a vaccine.

In a fourth aspect, embodiments of the present invention provide the use of a composition comprising the apoptosis inhibitor protein survivin mrna and a STAT3 inhibitor in the manufacture of a medicament for inhibiting or reducing tumor infiltration of MDSCs.

In a fifth aspect, embodiments of the present invention provide the use of a composition comprising the inhibitor of apoptosis protein survivin mrna and a STAT3 inhibitor in the manufacture of a medicament for enhancing immunity. In a sixth aspect, embodiments of the present invention provide a medicament for inhibiting or treating colon cancer, comprising: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

The invention has the following beneficial effects:

treatment is required approximately 10 times compared to nanoparticles of survivin T34 AmRNA. The invention does not need mRNA delivery system, and the naked survivin mRNA vaccine only needs 2 times of immunization.

The combined treatment of stattic and survivin mRNA vaccines can enhance the anti-tumor immune response induced by the vaccines, has the advantages of simpler preparation, lower cost, higher safety, shorter treatment period, better curative effect and capability of obviously improving the survival rate of patients.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the sequencing results of the recombinant plasmid pcDNA3.1(+) -survivin in the examples;

FIG. 2 shows the result of agarose gel electrophoresis of survivin mRNA in the examples; wherein, M: DL2000 DNA marker; 1: pre-transcriptional template DNA; survivin mRNA obtained after transcription;

figure 3 shows the results of the tumor growth inhibition experiments in the examples (× P <0.01, × P < 0.0001);

FIG. 4 shows the tumor size and tumor weight results of the mice in the examples; wherein, A is a tumor picture, and B is tumor weight;

figure 5 is survival (× P <0.01) of mice of different experimental groups in the examples;

FIG. 6 shows the results of MDSCs for detecting tumor infiltration by flow cytometry in the examples;

FIG. 7 shows the results of detecting the expression of STAT3 and p-STAT3 by Western blot in the examples; western blot detection proteins STAT3 and p-STAT 3; B. counting the expression amount of the protein STAT 3; C. counting the expression amount of the protein p-STAT 3; D. p-STAT3/STAT3 comparisons among mice tumors in each group;

FIG. 8 shows the secretion of IFN-. gamma.by splenocytes from immunized mice detected by ELISPOT in the examples; A. IFN-gamma secretion of splenocytes from each group of immunized mice; statistical plots of IFN- γ spots.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

In a first aspect, the present invention provides the use of a composition for the manufacture of a medicament for the inhibition or treatment of a tumour, said composition comprising: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

The "composition" herein refers to an agent including both of the inhibitor of apoptosis protein survivin mrna and STAT3 inhibitor, and does not limit the state in which the inhibitor of apoptosis protein survivin mrna and STAT3 inhibitor are mixed together.

When used for preparing a medicament, the apoptosis inhibitory protein survivin mRNA is used for preparing a reagent containing the apoptosis inhibitory protein survivin mRNA or an apoptosis inhibitory protein survivin mRNA vaccine.

As used herein, a "STAT 3 inhibitor" refers to a substance that is effective in inhibiting STAT3 activation and nuclear translocation, inhibiting phosphorylation of STAT 3.

As used herein, "inhibiting a tumor" in "inhibiting or treating a tumor" refers to controlling a disease condition such that the condition ceases or slowly deteriorates over a period of time, and "treating a tumor" refers to completely or partially eliminating the condition.

Preferably, the tumor is colon cancer.

The amount of Survivin mRNA and STAT3 inhibitor used can be selectively adjusted based on actual need. When the subject is a mouse, the preferred regimen for the amount is as follows: survivin mRNA was 10. mu.g/mouse and STAT3 inhibitor 67.5-75. mu.g/mouse (mice were 18-20 g/mouse by weight based on 3.75 mg/kg).

Preferably, the STAT3 inhibitor comprises stattic.

stattic is the first non-peptide STAT3 small molecule inhibitor, and can effectively inhibit STAT3 activation and nuclear translocation, and inhibit STAT3 phosphorylation (phosphorylation sites are Y705 and S727). Stattic treatment can reduce Arg-1 expression in MDSCs, reduce MDSCs-mediated immunosuppression, and inhibit differentiation into MDSCs. MDSCs-mediated T cell immunosuppression in head and neck squamous cell carcinoma patients can also be reduced by stattic therapy.

Preferably, the nucleotide sequence of the apoptosis inhibitor protein survivin mrna is shown as seq id No. 1: 5'-atgggagctccggcgctgccccagatctggcagctgtacctcaagaactaccgcatcgccaccttcaagaactggcccttcctggaggactgcgcctgcaccccagagcgaatggcggaggctggcttcatccactgccctaccgagaacgagcctgatttggcccagtgttttttctgctttaaggaattggaaggctgggaacccgatgacaacccgatagaggagcatagaaagcactcccctggctgcgccttcctcactgtcaagaagcagatggaagaactaaccgtcagtgaattcttgaaactggacagacagagagccaagaacaaaattgcaaaggagaccaacaacaagcaaaaagagtttgaagagactgcaaagactacccgtcagtcaattgagcagctggctgcctaa-3' are provided.

The embodiment of the invention also provides application of a composition in preparing a medicament for enhancing immunotherapy of tumors, wherein the composition comprises apoptosis inhibitory protein survivin mRNA and STAT3 inhibitor.

The embodiment of the invention also provides application of the STAT3 inhibitor in preparing a medicament for enhancing immunotherapy of tumors, wherein the immunotherapy refers to the immunotherapy by taking the apoptosis inhibitory protein survivin mRNA as a vaccine.

As used herein, "immunotherapy" refers to a treatment method for artificially enhancing or suppressing the immune function of the body against a low or high immune state of the body to achieve the purpose of treating diseases.

The "use of the apoptosis-inhibiting protein survivin mrna as a vaccine" herein refers to the case of using naked survivin mrna as a vaccine.

The embodiment of the invention also provides application of a composition in preparing a medicament for inhibiting or reducing MDSCs (tumor infiltration), wherein the composition comprises apoptosis inhibitory protein survivin mRNA and STAT3 inhibitor.

The term "MDSCs" as used herein refers to an acronym of Myeloid-derived suppressor cells (Myeloid-derived suppressor cells), which are a heterogeneous population of Myeloid-derived cells, and are precursors of Dendritic Cells (DCs), macrophages and/or granulocytes, and have the ability to significantly suppress immune cell responses.

The embodiment of the invention also provides application of a composition in preparing a medicine for enhancing immunity, wherein the composition comprises an apoptosis inhibitory protein survivin mRNA and a STAT3 inhibitor.

Preferably, the enhancing immunity comprises enhancing the level of IFN- γ secretion.

The vaccine for naked survivin mRNA injected in tumor of the embodiment of the invention has the advantages of simple synthesis, low price, good safety and the like. Compared with the nanoparticle of survivin T34A mRNA, the vaccine does not need an mRNA delivery system, is simpler to prepare and lower in cost, and the naked survivin mRNA vaccine is immunized only 2 times, while the survivin T34A mRNA nanoparticle needs 10 times of treatment. The combined treatment of stattic with survivin mRNA vaccine enhanced the vaccine-induced anti-tumor immune response, the combined treatment was better than the single treatment with vaccine or inhibitor stattic.

The mechanism of the combination therapy for enhancing the effect of survivin mRNA in tumors on treating the colon cancer of mice is that STAT therapy reduces the proliferation and accumulation of tumor-infiltrating MDSCs by blocking STATIC 3 signal pathways, weakens the inhibition of the tumor-infiltrating MDSCs on T cell functions, and thereby enhances the anti-tumor immune response of survivin mRNA in tumors.

In addition, an embodiment of the present invention provides a medicament for inhibiting or treating colon cancer, including: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

Preferably, the STAT3 inhibitor comprises stattic.

The nucleotide sequence of the apoptosis inhibitory protein survivin mRNA is shown as SEQ ID No. 1.

Example 1

1 materials and methods

1.1 main material.

Mouse CT26 colon cancer cell line was purchased from the cell resource center of shanghai academy of sciences of the chinese academy of sciences; MEGAscript^TMT7 kit and MEGAclear^TMKit, poly (A) tail kit purchased from Ambion, USA; ARCA caps were purchased from NEB, usa; modified nucleotides were purchased from TriLink Bio Tech, usa. The survivin forward primer is 5' -TGAAAGCTTGCCACCATGGGAGCTCCGGCG-3', reverse primer is 5' -TGAGATATCTTAGGCAGCCAGCTGCTC-3'; the transcription template was 5'-TAGAGAACCCACTGCTTACTGGCT-3' for the forward primer and 5'-TAGAAGGCACAGTCGAGGCT-3' for the reverse primer. HindIII and EcoRV sites (underlined) were added to the 5' end of the primers, respectively, and the size of the PCR product was about 500 bp. The primers were synthesized by Shanghai Bioengineering Co.

1.2 extracting total RNA and obtaining survivin full-length gene by RT-PCR.

And (3) washing the cultured colon cancer CT26 cells by PBS, adding 1mL of TRIzol, standing on ice for 30min, extracting total RNA from the cells, and carrying out RT-PCR by taking the RNA as a template to obtain cDNA. Then taking the reverse transcription product as a template, adding upstream and downstream primers of survivin gene, and carrying out PCR amplification, wherein the reaction system (50 mu L) comprises 5 mu L of 10 XPCR buffer, 4 mu L of 2.5mmol/L dNTP and 1 mu L and 25mmol/L MgCI of 10 mu mol/L primer respectively₂3 mu L, 5U/. mu.L high fidelity enzyme 0.5 mu L, ddH₂O34.5. mu. L, cDNA template 1. mu.L. The amplification conditions are pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles, and final extension at 72 ℃ for 10 min. After the PCR product was electrophoresed on 10g/L agarose gel, the desired fragment was recovered.

1.3 vector construction.

The plasmid pcDNA3.1(+) and the recovered survivin PCR product were digested with Hind III and EcoR V, respectively, and then the digested fragments were recovered. The target gene and the vector were mixed at a molar ratio of 3: 1, ligated overnight in a 16 ℃ thermostat water bath, and then transformed into E.coli DH5 alpha. Screening ampicillin plates, picking single growing colony, shaking bacteria, extracting plasmid, double enzyme digestion with Hind III and Sma I, and 10g/L agarose gel electrophoresis detection.

1.4 sequencing identification of the recombinant plasmid pcDNA3.1(+) -survivin.

The recombinant plasmid pcDNA3.1(+) -survivin which is correctly identified by double enzyme digestion is sent to the company of Biotechnology engineering (Shanghai) GmbH for sequencing. And comparing the sequencing result with a survivin gene sequence of a mouse in GenBank for analysis.

The sequencing results show that the cloned gene sequence is completely consistent with the survivin gene sequence of mice in a GenBank database after comparison, which indicates that the recombinant plasmid for coding survivin gene is successfully constructed (figure 1).

1.5 preparation of in vitro transcription templates

PCR amplification is carried out by using the pcDNA3.1(+) -survivin plasmid successfully constructed as a template and using high fidelity Taq enzyme, and a PCR product comprises a T7 promoter and a complete survivin gene sequence. After 10g/L agarose gel electrophoresis of the PCR product, the target piece is recoveredAnd (4) section. With Nano Drop ^TM2000 the A260/A280 ratio of the recovered product was determined and stored at-20 ℃ until use.

1.6 in vitro transcription Synthesis of modified survivin mRNA.

Taking the PCR product as an in vitro transcription template, and adding 5' -methylcytidine instead of cytidine and pseudouridine instead of uridine; capping of the RNA5 'end with 3' -O-Me-m7G (5') ppp (5') G RNA Cap Structure Analog, followed by T7 in vitro transcription kit, Poly (A) tailing kit and MEGAclear^TMThe purification kit completes in vitro transcription of survivin RNA, addition of a Poly (A) tail, and purification of mRNA. Nano Drop^TM2000A 260/A280 ratio of survivin mRNA transcribed in vitro was determined, the concentration calculated and examined by agarose gel electrophoresis.

The results show that a260/a280 ═ 1.93, and the concentration of survivin mRNA transcribed in vitro was calculated to be 1168.4 ng/. mu.l. The survivin mRNA was subjected to agarose gel electrophoresis detection, and as can be seen from FIG. 2, the size of the transcribed template DNA before transcription was about 600bp, and the size of the single-stranded mRNA after transcription, tailing, purification was about 300bp, which was in line with expectations.

1.7 immunization effect study of survivin mRNA vaccine in combination with STATIC 3 inhibitor stattic on mouse colon cancer model.

50 healthy 6-8 week-old SPF-grade BALB/c female mice were randomly divided into 5 groups, which were respectively labeled as PBS control group (PBS group for short), survivin mRNA vaccine immunization group (survivin mRNA group for short), stat therapy group (stat group for short, DMSO dilution), DMSO control group (DMSO group for short), survivin mRNA vaccine combination stat therapy group (combination group for short), and 10 mice per group. On day 0, mice were inoculated with CT26 cells and were injected subcutaneously to form tumors at a dose of 5X 10⁵One/only.

PBS (pH 7.2-7.4, concentration 0.01M, 50 μ L/mouse) or survivin mRNA vaccine (10 μ g/mouse) was immunized once each within the tumor on day 6 and day 13 in PBS, survivin mRNA, and combination groups. DMSO, stattic, and combination groups were injected with DMSO (20. mu.L/body) or stattic (3.75mg/kg, 20. mu.L/body) daily from day 6 until day 25, respectively, at the end of the tumor suppression experiment. The size of the tumor was measured every 2-3 days, and the tumor volume (length × width × height)/2.

As can be seen from fig. 3, survivin mRNA vaccine group showed significantly slower tumor growth than PBS control group (P <0.01), and the tumor suppression effect of the combination group was stronger than survivin mRNA group (P < 0.0001). After treatment, the mean tumor volume size was lower than that of the stat group at each time point in the combined group, but the difference was not statistically significant.

After the tumor inhibition experiment, the tumor is stripped after the anesthesia. Tumor tissues were photographed in groups of large to small volumes, as shown in fig. 4a, the tumor volume was significantly larger in the PBS group than in the other experimental groups, and significantly smaller in the stattic and combination groups than in the DMSO and survivin mRNA groups. The tumor tissues of each group were weighed by an electronic scale, and counted up as shown in B in FIG. 4, and the average tumor size was PBS group, DMSO group, survivin mRNA group, stat group and combination group in this order from large to small. The survivin mRNA group has obvious tumor inhibition effect compared with the PBS group, and the difference has statistical significance (P is less than 0.01). The tumor inhibition effect of the combined group is obviously stronger than that of survivin mRNA group (P < 0.05). The combined group had a lower average tumor weight than the stattic group, but the differences were not statistically significant.

For survival experiments, healthy 6-8 week old BALB/c female mice of SPF grade were randomly divided into 5 groups of 5 mice each, which were labeled PBS, survivin mRNA, stattic, DMSO, and combination, respectively, as above. Inoculation of CT26 cells and subsequent experimental treatment were performed as above, and mice were observed for survival and mental status by day 90. Survival line plots were made using GraphPad Prism software and analyzed for statistical survival.

Mouse survival was recorded as shown in fig. 5, survivin mRNA group began to die after PBS group, followed by DMSO group and stattic group, and finally the highest survival combination group. On day 63, all mice in the PBS group died (5/5), and 3 mice in the survivin mRNA group died (3/5). On day 72, survivin mRNA group mice all died. The survival time and survival rate of the combined group are better than those of the stattic group. The first mouse died on day 75 in the combination group with a survival rate of 80% (4/5), while the first mouse died on day 56 in the stattic group with a survival rate of 60% (3/5). survival rate of the stattic group and the combined group is remarkably different from that of the PBS group (P <0.01), and survival rate of the combined group is obviously higher than that of the survivin mRNA group (P < 0.01).

1.8 flow cytometry was used to detect MDSCs cell infiltration in tumor tissues of combination-treated mice.

The tumor tissues of each group of mice are placed into a six-hole plate, each hole is added with 1640 culture medium (containing 1% fetal calf serum), then the sterile ophthalmic scissors are used for shearing as much as possible, 200 mu L/hole of each hyaluronidase and collagenase and 100 mu L/hole of DNAse I are added, and the initial preparation concentrations of the three enzymes for digestion are all 10 mg/mL. Shaking the six-well plate, mixing the culture medium uniformly, and putting the six-well plate into a carbon dioxide cell incubator at 37 ℃ for digestion for 40 min. After digestion, the disposable cell sieve (70 mesh, 0.22 μm) was placed in a 50mL centrifuge tube, the tissue was ground with a disposable syringe black gel inner core, and the resulting cell suspension was centrifuged at 2000rpm for 3min in a 4 ℃ centrifuge. Discarding the supernatant after the centrifugation is finished, and according to the precipitation volume, performing centrifugation according to the following steps of 1: adding 1 Xerythrocyte lysate in a proportion of 200, quickly mixing, standing at room temperature for 15min, then adding an equivalent amount of PBS buffer solution, quickly mixing, stopping reaction, and centrifuging at 2000rpm for 3min by using a 4 ℃ centrifuge. And (3) after the red blood cells are completely lysed, obtaining the lymphocytes, then adding PBS buffer solution to wash the cells, centrifuging by a centrifuge at 4 ℃, and centrifuging for 3min at 2000 rpm. After washing the cells twice, adding PBS to resuspend the cells, counting the cells, calculating the dilution volume, and packaging into 1.5mL EP tubes to ensure that each sample is 1 × 10⁶And (4) cells. Flow sample preparation was performed as follows, all the way through the preparation protected from light and operated on ice, closed: 2 μ L of Fc blocker was added to each sample, mixed well, and incubated on ice for 5 min. Antibody incubation: flow antibodies with fluorescent labels, Anti-CD11b-FITC, Ly-6G/Ly-6C-PE were added for detection of MDSCs cells. Incubate for 40min in the dark on ice, wash twice with PBS, add 200-.

The number of MDSCs in tumor tissue of each mouse group is shown in FIG. 6, comparing MDSCs cytostasis in tumor tissue of survivin mRNA group in PBS group. Compared with the PBS group, the stattic group has no significant difference (P >0.05), and the MDSCs in the combined group are obviously reduced (P < 0.05). MDSCs were significantly reduced in the stattic group (P <0.05) and the combination group (P <0.01) compared to the survivin mRNA group. MDSCs in the combination group were slightly less than in the stattic group, but the differences were not significant.

1.9 mouse tumor tissue protein extraction and Western blot detection of STAT3 and p-STAT3 expression.

Each group of mouse tumor tissue was weighed at 30mg, placed in a grinder, added with 1mL of protein lysate, 10. mu.L of LPMSF, 10. mu.L of phosphatase inhibitor, 10. mu.L of protease inhibitor, and ground on ice. Sucking the tissue suspension into a 1.5mL EP tube, centrifuging at 4 deg.C with a centrifuge speed of 12000g for 30min, sucking the supernatant into a new 1.5mL EP tube, and storing at-80 deg.C. And (3) after the BCA protein is quantified, calculating to obtain the protein concentration, and detecting the expression conditions of STAT3 and p-STAT3 in each experimental group by using Western blot.

The experimental results are shown in fig. 7, and STAT3 expression differences among groups are not statistically significant. The p-STAT3 protein expression quantity of survivin mRNA group is increased compared with that of PBS group. Compared with the PBS group and the survivin mRNA group, the p-STAT3 protein expression of the stattic group and the combined group is obviously reduced. However, the p-STAT3 protein expression between the stattic group and the combination group was not significantly different.

1.10 ELISPOT test to detect IFN-gamma secretion in the splenocytes of mice treated in combination.

15 healthy BALB/c female mice of SPF grade of 6-8 weeks old are randomly divided into 5 groups, which are respectively marked as a PBS control group (PBS group for short), a survivin mRNA vaccine immunization group (survivin mRNA group for short), a stattic treatment group (stattic group for short), a DMSO control group (DMSO group for short) and a survivin mRNA vaccine combined stattic treatment group (combination group for short), and 3 mice are inoculated with CT26 cells and injected subcutaneously to form tumors. Intratumoral immunizations were performed twice on day 0, day 6 and day 13 on the day of injection, in total, with PBS (pH 7.2-7.4, concentration 0.01M, 50 μ L/tube) or survivin mRNA vaccine (10 μ g/tube). DMSO, stattic, combination groups were injected with DMSO (20. mu.L/body) or stattic (3.75mg/kg, 20. mu.L/body), respectively, daily from day 6 onwards. One week after the end of the second immunization, mice were sacrificed by anesthesia, and spleens of each group of mice were taken out in a super clean bench, respectively, and ground into single cell suspensions. Lysing erythrocytes with 1 × erythrocyte lysate to obtain lymphocytes, and counting the cells of each mouse to 2 × 10⁶Adding survivin polypeptide with the final concentration of 5 mug/microliter into the cell suspension, quickly mixing, adding ELISPOT testIn a 96 well plate of the cartridge. Incubation at 37 ℃ for 18 hours in an incubator, followed by removal of the cell suspension, ddH₂O washing twice, adding 100 mu L IFN-gamma antibody detection solution into each hole, and incubating for 2 hours at room temperature. The antibody was discarded, and wash buffer was added for washing, 200. mu.L per well, 3 times. Add 200. mu.L of alkaline phosphatase to each well (100-fold dilution of the stock solution) and incubate for 1 hour at room temperature. The liquid was discarded, and wash buffer was added for washing, 200. mu.L per well, 3 times. PBS was added and washed, 200. mu.L/well, 2 times. Then, 100. mu.L of a developing solution (mother solution diluted 100 times) was added to each well, and generation of spots was gradually observed with the naked eye. Addition of ddH₂The reaction was stopped, the well plate was air dried at room temperature and after drying each set of spots was counted under a microscope.

The experimental results are shown in FIG. 8, the number of IFN-gamma secretion spots of mice immunized with survivin mRNA group (P <0.05) and stattic group (P <0.05) is greater than that of PBS control group, and the number of combined spots is significantly greater than that of survivin mRNA group (P <0.05) and that of stattic group (P < 0.05).

The results show that the tumor inhibition effect and the survival rate of the mice in the combined group are superior to those in the survivin mRNA group and the stattic group. For mouse splenocyte IFN-gamma secretion, the combination treatment group is also obviously higher than the survivin mRNA and stattic single treatment group. After the STATIC 3 inhibitor and survivin mRNA vaccine are combined to treat the colon cancer of the mice, tumor infiltration MDSCs and a tumor promotion signal molecule p-STAT3 are obviously reduced, which shows that the inhibitor and the STATIC inhibition signal molecule STAT3 can effectively inhibit the proliferation and accumulation of the MDSCs, thereby enhancing the immunotherapy effect.

The GraphPad Prism software was used for data analysis and mapping. All data are expressed as mean ± sd, and comparisons between groups are performed using the t-test. Statistical analysis of tumor growth inhibition curves was performed using the Two-way ANOVA method and statistical analysis of survival curves was performed using the log-rank method. P <0.05 the difference was considered statistically significant.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Guizhou medical university

Application of composition in preparation of drugs for inhibiting or treating tumors

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 423

<212> DNA/RNA

<213> Artificial sequence

<400> 1

atgggagctc cggcgctgcc ccagatctgg cagctgtacc tcaagaacta ccgcatcgcc 60

accttcaaga actggccctt cctggaggac tgcgcctgca ccccagagcg aatggcggag 120

gctggcttca tccactgccc taccgagaac gagcctgatt tggcccagtg ttttttctgc 180

tttaaggaat tggaaggctg ggaacccgat gacaacccga tagaggagca tagaaagcac 240

tcccctggct gcgccttcct cactgtcaag aagcagatgg aagaactaac cgtcagtgaa 300

ttcttgaaac tggacagaca gagagccaag aacaaaattg caaaggagac caacaacaag 360

caaaaagagt ttgaagagac tgcaaagact acccgtcagt caattgagca gctggctgcc 420

taa 423

Claims (10)

1. Use of a composition for the manufacture of a medicament for the inhibition or treatment of a tumour, said composition comprising: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

2. Use of a composition according to claim 1 for the preparation of a medicament for the inhibition or treatment of a tumour, wherein the tumour is colon cancer.

3. Use of a composition according to claim 1 in the preparation of a medicament for the inhibition or treatment of a tumour, wherein the STAT3 inhibitor comprises: stattic.

4. The use of the composition according to claim 1 for the preparation of a medicament for the inhibition or treatment of tumors, wherein the nucleotide sequence of said apoptosis-inhibiting protein survivin mrna is set forth in SEQ ID No. 1.

5. Use of a composition comprising the inhibitor of apoptosis protein survivin mrna and a STAT3 inhibitor in the manufacture of a medicament for enhancing immunotherapy of a tumor.

Use of a STAT3 inhibitor for the preparation of a medicament for enhancing immunotherapy of tumors, wherein said immunotherapy is an immunotherapy with the inhibitor of apoptosis protein survivin mrna as a vaccine.

7. Use of a composition comprising the apoptosis inhibitory protein survivin mrna and a STAT3 inhibitor in the manufacture of a medicament for inhibiting or reducing tumor infiltration of MDSCs.

8. Use of a composition for the manufacture of a medicament for enhancing immunity, wherein the composition comprises an inhibitor of apoptosis protein survivin mrna and a STAT3 inhibitor;

preferably, the enhancing immunity comprises enhancing the level of IFN- γ secretion.

9. A medicament for inhibiting or treating colon cancer, comprising: inhibitor of apoptosis-inhibiting protein survivin mrna and STAT 3.

10. The medicament of claim 9, wherein the STAT3 inhibitor comprises stattic;

the nucleotide sequence of the apoptosis inhibitory protein survivin mRNA is shown in SEQ ID No. 1.

Images