CN110072876B - Polypeptide and application thereof - Google Patents

Abstract

The invention provides a polypeptide. The invention also provides nucleic acids encoding the polypeptides, nucleic acid constructs, expression vectors, host cells comprising the nucleic acids, and antigen presenting cells and immune effector cells thereof that present the polypeptides on the cell surface. The invention also provides pharmaceutical compositions, vaccines, antibodies, and methods of treatment, diagnostic methods and diagnostic devices comprising the polypeptides. The invention also provides application of the polypeptide in preparing vaccines, tumor diagnosis kits or pharmaceutical compositions, and application of the polypeptide and nucleic acid as examination targets in tumor diagnosis.

Description

Polypeptide and application thereof

PRIORITY INFORMATION

None.

Technical Field

The invention relates to the field of biomedicine, in particular to a polypeptide and application thereof, more particularly to the polypeptide and application thereof in preparation of a kit, a medicament and a vaccine, the application of the polypeptide in preventing or treating a disease related to CDC37L1 gene mutation in a subject, nucleic acid, a nucleic acid construct, an expression vector, a host cell, a pharmaceutical composition, an antigen presenting cell, an immune effector cell, a vaccine and an antibody, and a treatment method, a diagnosis method and a diagnosis system.

Background

Cancer, a disease in which cell proliferation is deregulated due to intracellular gene mutations. The medicine has become a great threat to human health at present and is one of the main causes of human death. The World Health Organization (WHO) has stated in published global cancer report 2014 that cancer patients and death cases are rapidly increasing worldwide in 2012, while nearly half of new cancer cases occur in asia, most of which are in china, and the new cancer cases in china are the first. The data of the annual report of Chinese tumor registration in 2012 shows that about 350 ten thousand new cancer cases and about 250 ten thousand people die each year in China. Therefore, the search for highly effective and specific cancer therapies is of great clinical value.

The traditional tumor treatment methods mainly comprise operations, radiotherapy and chemotherapy, but the methods have great limitations, for example, due to the proximal invasion or distal metastasis of cancer cells, the recurrence rate of tumor metastasis after surgical resection is high, and the radiotherapy and chemotherapy cause serious damage to the normal cells of the body, especially the hematopoietic system and the immune system, so that the long-term curative effect of patients with tumor metastasis is difficult to achieve. With the deep research on the molecular mechanism of tumor and the further development of biotechnology, targeted drug therapy and immunotherapy play an increasingly important role in the comprehensive treatment of tumor. Targeted therapies mainly include monoclonal antibodies (sometimes classified as passive immunotherapy) and small molecule targeted drugs, while immunotherapy mainly includes cytokine therapy, immune checkpoint inhibitors, adoptive cell reinfusion, tumor vaccines, and the like. The immunotherapy enhances the anti-tumor immunity of a tumor microenvironment by regulating the immune system of an organism, thereby controlling and killing tumor cells, has the advantages of high effective rate, strong specificity and good tolerance, and has wide prospect in tumor treatment.

The tumor immunotherapy vaccine mainly comprises a tumor cell vaccine, a dendritic cell (DC cell) vaccine, a protein & polypeptide vaccine, a nucleic acid vaccine and a genetic engineering vaccine. The main mechanism by which these vaccines can kill tumors is by eliciting an immune response in a patient against a tumor-specific antigen, including antigen-antibody responses and Cytotoxic T Lymphocyte (CTL) -specific killing, among others, which CTL-specific killing plays a major role in tumor immune responses. The tumor specific polypeptide is a tumor specific antigen, mainly causes CTL specific killing, and comprises tumor mutant polypeptide and tumor specific high expression polypeptide. The polypeptide of tumor mutation is a specific target of tumor immunotherapy because the polypeptide exists only in tumor tissues of patients, and has the characteristics of good safety, small side effect and the like. The immunotherapy of the targeted tumor mutation polypeptide takes methods such as polypeptide specificity DC-CTL and Tumor Infiltration Lymphocyte (TIL) adoptive reinfusion as representatives, and has good therapeutic effect.

Tumor-specific polypeptides are recognized by CTL or TIL cells and require the antigen presenting function of human leukocyte antigen HLA. Human leukocyte antigens are mainly divided into two subtypes I and II, HLA type I is mainly divided into three subtypes A, B and C, each subtype can be divided intobase:Sub>A plurality of subtypes according to different sequences, HLA-A0201 is one of HLA-A subtypes, accounts for 13% of Chinese population, and hasbase:Sub>A high proportion. The binding capacity of different polypeptides to HLA-A0201 subtype is different. In tumor patients with a particular HLA subtype, the HLA subtype determines that only a portion of the mutant polypeptide has the ability to bind to its HLA and is presented to CTL or TIL cells by its HLA.

However, tumor immunotherapy remains to be further studied and developed.

Disclosure of Invention

The present invention is based on the discovery by the inventors of the following facts and problems:

the protein encoded by the wild-type CDC37L1 gene is a phosphorylase in cytoplasm, forms a complex with HSP90 protein, and plays a role in protein folding mediated by HSP90 protein. Through a large number of screening experiments, the inventor finds that the mutation of the CDC37L1 gene causes the mutation of the amino acid at the 203-position coded by the gene from histidine (His, H) to tyrosine (Tyr, Y). The mutated CDC37L1 gene can be specifically expressed at high level in tumor tissues, and the mutant polypeptide coded by the mutated gene has the tumor tissue specificity. Furthermore, the inventors have experimentally verified that the mutant polypeptide sequence has high affinity with HLA-A0201.

Based on the above findings, in a first aspect of the present invention, the present invention provides an isolated polypeptide. According to an embodiment of the invention, the polypeptide is selected from: (1) a polypeptide having the sequence of SEQ ID NO: 1; or (2) a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity compared to (1); or (3) a polypeptide having substitution, deletion and/or addition of one or more amino acids as compared with (1). Optionally, the substitution, deletion and/or addition of at least one or more amino acids is as set forth in SEQ ID NO:1, and/or substitution of amino acid at position 2 and/or 9 of the amino acid sequence described in 1. Optionally, the substitution, deletion and/or addition of at least one or more amino acids is M at the 2 nd amino acid and/or V at the 9 th amino acid of the amino acid sequence shown in SEQ ID NO. 1. Optionally, the polypeptide has an amino acid sequence shown as SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4. Wherein the polypeptide of (2) or the polypeptide of (3) has the same function as the polypeptide of (1).

YLILWCFYL(SEQ ID NO:1)。

YLILWCFYV(SEQ ID NO:2)。

YMILWCFYL(SEQ ID NO:3)。

YMILWCFYV(SEQ ID NO:4)。

According to an embodiment of the present invention, said polypeptide has high affinity for HLA-a0201, and has the ability to activate specific T cell immunity.

In a second aspect of the present invention, the present invention provides the use of a reagent for detecting the above-mentioned polypeptide in the preparation of a kit for diagnosing a tumor, optionally, the tumor is from a tumor patient of HLA-a0201 subtype, the tumor expresses the polypeptide, optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, the tumor is breast cancer. Based on the experimental research of the inventor, the polypeptide is specifically and highly expressed in tumor tissues, and the inventor verifies and proposes through further experiments that a kit prepared by using a reagent for detecting the polypeptide can be effectively used for diagnosing tumors; meanwhile, the inventor surprisingly finds that the polypeptide has high affinity with HLA-A0201, and further can be presented to CTL or TIL cells by presenting cells expressing HLA-A0201 to activate specific T cell immunity, and when the tumor is expressed by the polypeptide in tumor patients with HLA-A0201 subtype, the diagnostic safety and effectiveness of the kit are remarkably improved; meanwhile, the inventor finds that the polypeptide is highly expressed by the tissue specificity of breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, and further the diagnostic effectiveness and sensitivity of the kit can be further improved when the tumor is the tumor, particularly the breast cancer.

In a third aspect of the present invention, the present invention provides the use of the above-mentioned polypeptide in the preparation of a medicament for preventing or treating a tumor, optionally, said tumor is from a patient with a HLA-a0201 subtype tumor, said tumor expresses said polypeptide, optionally, said tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, said tumor is breast cancer. As described above, the inventors found that the polypeptide is specifically and highly expressed in tumor tissues, and further, the inventors verified and suggested that the drug prepared from the polypeptide can be effectively used for preventing or treating tumors; in the tumor patients with HLA-A0201 subtype, when the tumor expresses the polypeptide, the safety and effectiveness of treatment or prevention are obviously improved; when the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, especially breast cancer, the effectiveness and sensitivity of treatment or prevention thereof can be further improved.

In a fourth aspect of the invention, an isolated nucleic acid is provided. According to an embodiment of the invention, the nucleic acid is a nucleic acid encoding the above-mentioned polypeptide or a complementary sequence thereof. The nucleic acid can specifically code the polypeptide, and the polypeptide has high affinity with HLA-A0201 and the capability of activating specific T cell immunity, and furthermore, the polypeptide expressed by the nucleic acid provided by the embodiment of the invention under appropriate conditions can be used for preventing or treating tumors, and particularly, the safety and effectiveness of treatment or prevention of patients with HLA-A0201 subtype tumors expressing the polypeptide are higher.

In a fifth aspect of the invention, a nucleic acid construct is presented. According to an embodiment of the invention, the nucleic acid construct comprises a coding sequence, which is a nucleic acid as described above, and optionally a control sequence, which is operably linked to the coding sequence. Wherein the control sequence is one or more control sequences that direct the expression of the polypeptide in a host. The nucleic acid construct provided by the embodiment of the invention can be connected with an expression vector under a suitable condition, and then the polypeptide can be efficiently expressed in a suitable host cell, so that the nucleic acid construct can be effectively used for specific treatment or prevention of tumors, particularly for patients with HLA-A0201 subtype tumors expressing the polypeptide.

In a sixth aspect of the invention, an expression vector is provided. According to an embodiment of the invention, the vector comprises the nucleic acid construct described above. The expression vector disclosed by the embodiment of the invention can efficiently express the polypeptide in an expression host under a proper condition, and the expression vector can be effectively used for specific treatment or prevention of tumors, particularly for patients with HLA-A0201 subtype tumors expressing the polypeptide.

In a seventh aspect of the invention, a host cell is provided. According to an embodiment of the invention, said cell carries a nucleic acid construct or an expression vector as described above, optionally obtained by transfection or transformation of said nucleic acid construct or expression vector. According to the embodiment of the present invention, the host cell can efficiently express the polypeptide under appropriate conditions, and the host cell can be effectively used for the specific treatment or prevention of tumors, particularly for patients with tumors of HLA-A0201 subtype expressing the polypeptide.

In an eighth aspect of the invention, a pharmaceutical composition is provided. According to an embodiment of the invention, the pharmaceutical composition comprises: a polypeptide as described above; and a pharmaceutically acceptable adjuvant. The inventors have found through a great deal of experiments that a pharmaceutical composition comprising the aforementioned polypeptide and a pharmaceutically acceptable adjuvant can significantly stimulate the proliferation and secretion of CTLs or TILs, can significantly kill tumor cells presenting the above polypeptide antigen, and has a significant efficacy in treating or preventing tumors, particularly tumors that specifically highly express the above polypeptide antigen.

In the ninth aspect of the present invention, the present invention provides the use of the aforementioned polypeptide in the preparation of a vaccine for preventing or treating tumors, optionally, the tumors are from tumor patients of HLA-a0201 subtype, the tumors express the polypeptide, optionally, the tumors are breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumors, preferably, the tumors are breast cancer, as described above, the inventors found that the aforementioned polypeptide is specifically highly expressed in tumor tissues, and further, the inventors verified and proposed by further experiments that the vaccine prepared by the aforementioned polypeptide can be effectively used for preventing or treating tumors, and has higher safety and smaller side effects; when the tumor expresses the polypeptide, the safety and the effectiveness of the treatment or prevention of the tumor patients with the HLA-A0201 subtype are obviously improved; when the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, especially breast cancer, the effectiveness and sensitivity of the treatment or prevention thereof can be further improved.

In a tenth aspect of the present invention, the present invention provides an antigen presenting cell. According to an embodiment of the present invention, the antigen presenting cell may present the aforementioned polypeptide. According to the embodiment of the invention, the antigen presenting cell presenting the polypeptide can effectively cause the patient to have an immune response against the tumor specific antigen-the polypeptide, and further activate the CTL specific killing function, and in the HLA-A0201 subtype patient, the antigen presenting cell provided by the embodiment of the invention has the advantages of remarkable treatment effect on the tumor expressing the polypeptide, and high safety.

In an eleventh aspect of the invention, an immune effector cell is presented. According to an embodiment of the invention, the immune effector cell may recognize the aforementioned polypeptide or recognize an antigen presenting cell that presents the aforementioned polypeptide on the cell surface. According to an embodiment of the present invention, the immune effector cells can specifically kill tumor cells expressing the above polypeptides in patients with HLA-a0201 subtype.

In a twelfth aspect of the invention, a vaccine is presented. According to an embodiment of the invention, the vaccine comprises a nucleic acid as described above, or a nucleic acid construct as described above, or an expression vector as described above, or a host cell as described above, or an antigen presenting cell as described above, or an immune effector cell as described above. As described above, the nucleic acid or nucleic acid construct or expression vector of the embodiment of the present invention expresses the aforementioned polypeptide under appropriate conditions, and the nucleic acid or nucleic acid construct or expression vector of the embodiment of the present invention can be used for treating or preventing tumors expressing the aforementioned polypeptide, and the antigen presenting cell of the embodiment of the present invention has a significant efficacy of treating tumors expressing the aforementioned polypeptide in HLA-A0201 subtype patients, and the immune effector cell of the embodiment of the present invention has a significant effect of specifically killing target cells expressing the aforementioned polypeptide. In patients with HLA-A0201 subtype, the vaccine provided by the embodiment of the invention has remarkable effect of treating or preventing tumors expressing the polypeptide, and has higher safety and less side effect.

In a thirteenth aspect of the invention, an antibody is provided. According to an embodiment of the invention, the antibody specifically recognizes the polypeptide as described above. The antibody provided by the embodiment of the invention can be specifically bound with the polypeptide, and further can be used for specifically identifying tumor cells with high specificity expression of the polypeptide.

In a fourteenth aspect of the invention, a method of treatment is set forth. According to an embodiment of the invention, the method of treatment comprises: administering to the patient a therapeutically effective amount of the polypeptide as described above, the nucleic acid construct as described above, the expression vector as described above, the host cell as described above, the pharmaceutical composition as described above, the antigen presenting cell as described above, the immune effector cell as described above, the vaccine as described above or the antibody as described above. As described above, the therapeutic method of the present invention, which comprises administering an effective amount of any of the aforementioned polypeptides or the like, is effective for treating or preventing a tumor expressing the polypeptide in a patient with HLA-A0201 subtype.

In a fifteenth aspect of the invention, the invention proposes the use of a polypeptide as described above for the prevention or treatment of a disease associated with a mutation in the CDC37L1 gene in a subject. The polypeptide of the embodiment of the invention is used for preventing or treating the diseases related to the CDC37L1 gene mutation in the subjects, and has remarkable effect.

In a sixteenth aspect of the invention, a diagnostic method is presented. According to an embodiment of the invention, the diagnostic method comprises: detecting whether a biological sample derived from the patient carries a polypeptide as described above; determining whether said patient has a tumor, optionally said tumor is from a tumor patient of HLA-a0201 subtype, said tumor expresses said polypeptide, optionally said tumor is a breast, lung, liver, stomach, esophagus, colorectal, pancreatic, melanoma, skin, prostate, cervical, leukemia or brain tumor, preferably said tumor is breast cancer, based on whether said biological sample carries said polypeptide. The inventors have found that the polypeptide is specifically and highly expressed in tumor tissue, whereas the polypeptide is absent in normal tissue. The diagnosis method provided by the embodiment of the invention can effectively diagnose the tumor patients with high specificity and high expression of the polypeptide. The inventor finds that the polypeptide is specifically and highly expressed in breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, and particularly in breast cancer, and further the diagnosis accuracy of the tumor by the method provided by the embodiment of the invention is further improved. Meanwhile, the inventor finds that HLA-A0201 has a high proportion in Chinese people, HLA-A0201 has strong affinity with the polypeptide, and the polypeptide is combined with HLA-A0201 on the cell surface to further stimulate a series of immune reactions. Therefore, the diagnosis method proposed in the examples of the present invention has a higher probability of diagnosing patients with tumors expressing the polypeptide among patients of HLA-A0201 subtype.

In a seventeenth aspect of the invention, a diagnostic system is presented. According to an embodiment of the invention, the diagnostic system comprises: a polypeptide detection device for detecting whether a biological sample derived from a patient carries a polypeptide as described above; a diagnosis result determination device connected to the polypeptide detection device for determining whether the patient has a tumor based on whether the biological sample carries the polypeptide, optionally the tumor is from a tumor patient of HLA-A0201 subtype, the tumor expresses the polypeptide, optionally the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably the tumor is breast cancer. The inventors have found that the polypeptide is specifically and highly expressed in tumor tissues, whereas the polypeptide is absent in normal tissues. The diagnosis system provided by the embodiment of the invention can be used for effectively determining the tumor patients with high specificity and high expression of the polypeptide. The inventor finds that the polypeptide is specifically and highly expressed in breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, and particularly in breast cancer, and the diagnosis accuracy of the diagnosis system provided by the embodiment of the invention on the tumor is further improved. Meanwhile, the inventor finds that the HLA-A0201 has a high proportion in Chinese population, the HLA-A0201 has strong affinity with the polypeptide, and the polypeptide can stimulate a series of immune reactions by binding with the HLA-A0201 on the cell surface. Thus, the diagnostic system proposed in the examples of the present invention has a higher probability of diagnosing patients with tumors expressing the polypeptide among patients of HLA-A0201 subtype.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a schematic block diagram of a diagnostic system according to an embodiment of the present invention;

FIG. 2 is a graph showing the results of flow cytometry on the affinity of T2 cells carrying polypeptides for HLA-A0201 according to an embodiment of the present invention;

FIG. 3 is a graphical representation of polypeptide-activated CD8 validation by ELISPOTs methods according to embodiments of the invention ⁺ Graphs of the results of T cell immune responses;

FIG. 4 is an activated CD8 according to an embodiment of the present invention ⁺ Results plot of specific killing of target cells loaded with polypeptide by T cells; wherein, T cell refers to T cell, T2 refers to T2 cell.

FIG. 5 is a graph showing the results of polypeptide immunotherapy according to an embodiment of the present invention,

wherein A shows the effect of inhibiting tumor growth after adjuvant, wild YLLWCFHL (SEQ ID NO: 5) polypeptide group, YLLWCFYL (SEQ ID NO: 1) polypeptide or its deformable polypeptide (SEQ ID NO:2-4 any sequence) group and adjuvant treatment,

b shows a graph of the results of mouse survival after adjuvant, adjuvant + wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide group, YLLWCFYL (SEQ ID NO: 1) polypeptide or its transformable polypeptide (SEQ ID NO:2-4 any sequence shown) groups + adjuvant treatment;

FIG. 6 is a graph showing the results of polypeptide immunotherapy according to an embodiment of the present invention,

wherein A shows the effect of inhibiting tumor growth after DC-loaded wild-type (YLLWCFHL (SEQ ID NO: 5)) polypeptide, DC-loaded YLLWCFYL (SEQ ID NO: 1) mutant polypeptide or deformable polypeptide (SEQ ID NO: 2-4) thereof is treated,

b is a graph showing the results of mouse survival following treatment with a DC-loaded wild-type (YLILWCHL (SEQ ID NO: 5) polypeptide, a DC-loaded YLILWCYL (SEQ ID NO: 1) mutant polypeptide, or a variant thereof (represented by any one of SEQ ID NO:2 to 4);

FIG. 7 shows a graph of the results of polypeptide immunotherapy,

wherein, A shows the effect picture of tumor growth inhibition for immunotherapy after transfection of DC with lentiviral vector carrying a nucleic acid sequence encoding wild-type YLILWCHL (SEQ ID NO: 5) or mutant polypeptide YLILWCYL (SEQ ID NO: 1), or a nucleic acid sequence encoding mutant polypeptide of alternative form SEQ ID NO:2-4,

b shows the results of mouse survival for immunotherapy after transfection of DCs with lentiviral vectors carrying a nucleic acid sequence encoding wild-type YLLWCFHL (SEQ ID NO: 5) or a mutant polypeptide YLLWCFYL (SEQ ID NO: 1), or a nucleic acid sequence encoding a mutant polypeptide of the alternative form of the polypeptides SEQ ID NO: 2-4; and

FIG. 8 is a graph showing the results of polypeptide immunotherapy,

wherein, A shows the effect of inhibiting tumor growth after DC-loaded wild type (YLLWCFHL (SEQ ID NO: 5)) polypeptide + CTL, DC-loaded mutant polypeptide YLLWCFYL (SEQ ID NO: 1) or its deformable form (shown by any sequence of SEQ ID NO: 2-4) + CTL treatment,

b shows a graph of the results of mouse survival after treatment with DC-loaded wild-type (YLLWCFHL (SEQ ID NO: 5)) polypeptide + CTL, DC-loaded mutant polypeptide YLLWCFYL (SEQ ID NO: 1) or its modified form (shown in any one of SEQ ID NO: 2-4) + CTL.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the accompanying drawings are illustrative only for the purpose of explaining the present invention, and are not to be construed as limiting the present invention.

It should be noted that the terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Further, in the description of the present invention, "a plurality" means two or more unless otherwise specified.

Polypeptides

In a first aspect of the invention, the invention features an isolated polypeptide. According to an embodiment of the invention, the polypeptide is selected from: (1) has the sequence of SEQ ID NO: 1; or (2) a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity compared to (1); or (3) a polypeptide having substitution, deletion and/or addition of one or more amino acids as compared with (1). The polypeptide provided by the embodiment of the invention is derived from tumor mutant polypeptide, does not exist in a human body without the mutation, only exists in the tumor tissue of a patient with the mutation, and normal tissue does not contain the mutation. Since it is found only in the tumor tissue of the patient, but not in the normal tissue, its specificity is higher, and the specificity of the immune response elicited is also higher. CTL generated by stimulating an organism by using the polypeptide provided by the embodiment of the invention only has a killing effect on tumor cells and tissues and does not affect normal tissues, so that the precise targeted therapy on tumors is realized. The polypeptide provided by the embodiment of the invention is used for tumor immunotherapy, and has the characteristics of good treatment effect, good safety, small side effect and the like.

Specifically, according to an embodiment of the present invention, the substitution, deletion and/or addition of at least one or more amino acids is as shown in SEQ ID NO:1, and/or substitution of amino acid at position 2 and/or 9 of the amino acid sequence described in 1. The inventors found that the sequence of SEQ ID NO:1 does not alter the specificity between the amino acid sequence and T cells, does not alter the immunogenicity of the polypeptide.

More specifically, according to an embodiment of the present invention, the substitution, deletion and/or addition of at least one or more amino acids is a substitution of amino acid at position 2 to M and/or a substitution of amino acid at position 9 to V of the amino acid sequence shown in SEQ ID No. 1. For example, the above polypeptide has an amino acid sequence shown by SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4. According to the examples of the present invention, YLLWCFYL (SEQ ID NO: 1), YLLWCFYV (SEQ ID NO: 2), YMILWCFYL (SEQ ID NO: 3), YMILWCFYV (SEQ ID NO: 4), all have high affinity with HLA-A0201, and all have the ability to activate specific T cell immunity. The inventors have found that the alternative forms of the polypeptide YLILWCCFYV (SEQ ID NO: 2), YMILWCFYL (SEQ ID NO: 3), and YMILWCFYV (SEQ ID NO: 4) alter position 2 and/or position 9 of the polypeptide YLILWCFYYL (SEQ ID NO: 1) wherein the amino acid substitution at position 2 is M, and/or the amino acid substitution at position 9 is V, which enhances the binding of the polypeptide to HLA-A0201 without altering its specificity for T cells and without altering the immunogenicity of the polypeptide. Therefore, the polypeptides of SEQ ID NO. 2-4 and the polypeptide of SEQ ID NO. 1 both have the ability to activate specific T cell immunity.

Use of

In the aspect of application, the invention provides the application of a reagent for detecting the polypeptide in the preparation of a kit, the application of the polypeptide in the preparation of a medicament and the application of the polypeptide in the preparation of a vaccine, wherein the kit, the medicament or the vaccine are used for diagnosing, preventing or treating tumors. Optionally, said tumor is from a tumor patient of HLA-a0201 subtype, said tumor expresses said polypeptide or said tumor expresses both HLA-a0201 and said polypeptide. Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, the tumor is breast cancer. Based on the experimental research of the inventor, the polypeptide is specifically and highly expressed in tumor tissues, and the inventor verifies and proposes that a kit prepared by a reagent for detecting the polypeptide or a medicament or vaccine prepared by the polypeptide can be effectively used for diagnosing tumors, so that the safety is higher and the side effect is smaller; meanwhile, the inventor surprisingly finds that the polypeptide has high affinity with HLA-A0201, and further can be presented to CTL or TIL cells by presenting cells expressing HLA-A0201 to activate specific T cell immunity, and when the tumor expresses the polypeptide, the safety and the effectiveness of diagnosis or treatment of the kit, the medicine or the vaccine are remarkably improved in tumor patients with HLA-A0201 subtype; meanwhile, the inventor finds that the polypeptide is highly expressed by tissue specificity of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, and further the effectiveness of diagnosis and treatment of the kit, the medicine or the vaccine can be further improved when the tumor is the above tumor, particularly the breast cancer.

In another aspect, the present invention provides the use of the above-described polypeptide for preventing or treating a disease associated with a mutation in the CDC37L1 gene in a subject. Through a large number of screening experiments, the inventor finds that the mutation of the CDC37L1 gene causes the mutation of the coded 453 site amino acid from histidine (His, H) to tyrosine (Tyr, Y). The polypeptide of the embodiment of the invention has the same antigenic property as the polypeptide coded by the CDC37L1 mutant gene, the specific immune response caused by the polypeptide has obvious specific recognition and killing effects of effector cells on CDC37L1 mutant cells, and the polypeptide of the embodiment of the invention can be used for preventing or treating diseases related to CDC37L1 gene mutation. And the inventor finds that the polypeptide has obvious effect on preventing or treating CDC37L1 gene mutation related diseases through experiments.

Therapeutic compositions

In one aspect, the invention features an isolated nucleic acid. According to an embodiment of the invention, the nucleic acid is a nucleic acid encoding the above-mentioned polypeptide or a complementary sequence thereof. The nucleic acid can specifically code the polypeptide, and the polypeptide has high affinity with HLA-A0201 and the capability of activating specific T cell immunity, and furthermore, the polypeptide expressed by the nucleic acid provided by the embodiment of the invention under appropriate conditions can be used for preventing or treating tumors, and particularly, the safety and effectiveness of treatment or prevention of patients with HLA-A0201 subtype tumors expressing the polypeptide are higher.

It is to be noted that, for nucleic acids mentioned in the present specification and claims, a person skilled in the art will understand that any one or two of the complementary double strands are actually included. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. In addition, the gene sequence in the present application includes a DNA form or an RNA form, and one is disclosed, which means that the other is also disclosed.

Accordingly, in another aspect, the invention features a nucleic acid construct. According to an embodiment of the invention, the nucleic acid construct comprises a coding sequence, which is a nucleic acid as described above, and optionally a control sequence, which is operably linked to the coding sequence. Wherein the control sequence is one or more control sequences capable of directing the expression of the polypeptide in a host. According to embodiments of the invention, the control sequences include, but are not limited to, the U6, H1, CMV, EF-1, LTR or RSV promoters. The nucleic acid construct provided by the embodiment of the invention can be connected with an expression vector under appropriate conditions, and then the polypeptide can be efficiently expressed in appropriate host cells, so that the nucleic acid construct can be effectively used for the specific treatment or prevention of tumors, particularly for patients with HLA-A0201 subtype tumors expressing the polypeptide.

Accordingly, in another aspect, the present invention provides an expression vector. According to an embodiment of the invention, the vector comprises the nucleic acid construct described above. The type of the expression vector is not particularly limited as long as it can achieve high expression of the nucleic acid construct in the recipient cell as described above, and the expression vector includes, but is not limited to, a retrovirus vector, a lentivirus vector, and/or an adeno-associated virus vector. The expression vector provided by the embodiment of the invention can efficiently express the polypeptide in an expression host under a suitable condition, and the expression vector can be effectively used for specific treatment or prevention of tumors, particularly for patients with HLA-A0201 subtype tumors expressing the polypeptide.

Accordingly, in another aspect, the invention features a host cell. According to an embodiment of the invention, the cell carries the nucleic acid construct or expression vector described above, optionally obtained by transfection or transformation of said nucleic acid construct or expression vector. Transformation or transfection may be carried out by electroporation, viral transfection or transformation of competent cells. The manner in which the transfection or transformation is carried out is determined by the nature of the host cell and the nature of the nucleic acid construct or expression vector to be transformed, provided that efficient expression of the aforementioned polypeptides in the host cell is achieved without major effects on the good cell state of the host cell. According to the embodiment of the present invention, the host cell can efficiently express the polypeptide under appropriate conditions, and the host cell can be effectively used for the specific treatment or prevention of tumors, particularly for patients with tumors of HLA-A0201 subtype expressing the polypeptide.

In the present specification, the term "suitable conditions" refers to conditions suitable for the expression of the polypeptide described in the present application. It will be readily understood by those skilled in the art that suitable conditions for polypeptide expression include, but are not limited to, suitable transformation or transfection means, suitable transformation or transfection conditions, healthy host cell status, suitable host cell density, suitable cell culture environment, and suitable cell culture time. The "suitable conditions" are not particularly limited, and those skilled in the art can optimize the conditions for the expression of the polypeptide optimally according to the particular circumstances of the laboratory.

In yet another aspect, the present invention provides a pharmaceutical composition. According to an embodiment of the invention, the pharmaceutical composition comprises: a polypeptide as described above; and a pharmaceutically acceptable adjuvant. The inventor finds through a large number of experiments that the pharmaceutical composition comprising the polypeptide and the pharmaceutically acceptable adjuvant can remarkably stimulate the proliferation and secretion of CTL or TIL, remarkably kill tumor cells presenting the polypeptide antigen, and has remarkable efficacy of treating or preventing tumors, particularly tumors specifically and highly expressing the polypeptide antigen.

In another aspect, the invention features an antigen presenting cell. According to an embodiment of the present invention, the antigen presenting cell can present the aforementioned polypeptide. According to the embodiment of the invention, the antigen presenting cell presenting the polypeptide can effectively cause the immune response of a patient to the tumor specific antigen-the polypeptide, and further activate the CTL specific killing function, and in the HLA-A0201 subtype patient, the antigen presenting cell provided by the embodiment of the invention has remarkable efficacy of treating the tumor expressing the polypeptide, and has remarkable treatment effect and high safety.

According to a particular example of the invention, the antigen presenting cells are obtained by means of at least one of: contacting a cell having antigen presenting ability with said polypeptide; or introducing the nucleic acid, the nucleic acid construct, or the expression vector into the cell having antigen presenting ability. The present inventors have found through experiments that the aforementioned polypeptides can be efficiently presented by antigen-presenting cells by any one or more of the aforementioned means, and that the aforementioned polypeptides are exposed on the surface of the antigen-presenting cells, and that the antigen-presenting cells presenting the aforementioned polypeptides can efficiently induce an immune response against a tumor-specific antigen-the aforementioned polypeptides in a patient, thereby activating a CTL-specific killing function.

According to a particular embodiment of the invention, the antigen presenting cells are dendritic cells. Dendritic cells have extremely strong capacity of antigen endocytosis and processing, and can present antigens on the surfaces of cells. The inventors selected dendritic cells as antigen presenting cells that initiated, regulated and maintained an immune response to the polypeptide more strongly in vivo.

In yet another aspect, the invention features an immune effector cell. According to an embodiment of the invention, the immune effector cell may recognize the aforementioned polypeptide or recognize an antigen presenting cell that presents the aforementioned polypeptide on the cell surface. According to an embodiment of the invention, the immune effector cell is obtained byThe antigen presenting cells described above are obtained by contacting cells having an immune effector function. The inventors have found that, by contacting an antigen-presenting cell presenting the aforementioned polypeptide with a cell having an immune effector function, the antigen-presenting cell can activate an inactivated cell having an immune effector function, present an antigen-the aforementioned polypeptide, and further activate a cell having an immune effector function, thereby producing immune effector cells in a large amount, which have an effect of specifically killing a target cell expressing the aforementioned polypeptide. According to a further specific example of the invention, the cells with immune effector capacity are T lymphocytes, and the inventors have found that CD8 is preferred ⁺ T cell, CD8 ⁺ The T cells have stronger capability of receiving the activation of antigen presenting cells, and the obtained CD8 ⁺ The specific killing of T cells is more potent against target cells expressing the polypeptide.

In yet another aspect, the present invention provides a vaccine. According to an embodiment of the invention, the vaccine comprises a nucleic acid, a nucleic acid construct, an expression vector, a host cell, an antigen presenting cell as described above, or an immune effector cell as described above. As described above, the nucleic acids, nucleic acid constructs, expression vectors, and host cells of the embodiments can be used for the specific killing of tumors that highly express the polypeptides, and the antigen presenting cells of the embodiments have significant efficacy in treating tumors that express the polypeptides in patients with HLA-A0201 subtype, and the immune effector cells of the embodiments have significant efficacy in specifically killing target cells that express the polypeptides in patients with HLA-A0201 subtype. The vaccine provided by the embodiment of the invention comprises the nucleic acid, the nucleic acid construct, the expression vector, the host cell, the antigen presenting cell or the immune effector cell, and has the advantages of remarkable treatment or prevention effect on tumors expressing the polypeptide, higher safety and less side effect.

In yet another aspect, the invention features an antibody. According to an embodiment of the invention, the antibody specifically recognizes the polypeptide as described above. The antibody provided by the embodiment of the invention can be specifically bound with the polypeptide, and further can be used for specifically identifying tumor cells with high specificity expression of the polypeptide. In addition, according to an embodiment of the present invention, the antibody may be obtained by: collecting serum from an animal immunized with the polypeptide; and purifying the antibody of interest from the serum. The method for preparing the antibody can conveniently, quickly and effectively prepare the antibody with specificity for recognizing the polypeptide, and the prepared antibody can be effectively used for diagnosing, treating and preventing tumors.

In summary, the polypeptide provided by the embodiment of the present invention has higher specificity and higher specificity of the induced immune response because it is only found in the tumor tissue of the patient and does not have normal tissue, compared with other tumor polypeptide vaccines, the polypeptide has the advantages of higher safety, less side effect and less serious adverse reaction, and can be used as a vaccine, a pharmaceutical composition, etc. to induce the immune response against the tumor because of simple structure and easy artificial synthesis. The polypeptide with the sequence shown in SEQ ID NO. 1 or the variant thereof can be used as a target or a vaccine for tumor biological treatment aiming at expressing the mutant polypeptide and has the function of causing the immune response of an organism. The polypeptide plus adjuvant, or the antigen presenting cell vaccine loaded by the polypeptide, or the polypeptide specific DC-CTL, DC-CIK vaccine and the like can be adopted to specifically kill the tumor cells, prevent and treat cancers, including lung cancer, melanoma, breast cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, brain tumor and other cancer types expressing the polypeptide sequence.

Method of treatment

Further, the present invention provides a method of treatment. According to an embodiment of the invention, the method of treatment comprises: administering to the patient a therapeutically effective amount of the polypeptide as described above, the nucleic acid construct as described above, the expression vector as described above, the host cell as described above, the pharmaceutical composition as described above, the antigen presenting cell as described above, the immune effector cell as described above, the vaccine as described above or the antibody as described above. As described above, the therapeutic methods of the embodiments of the present invention, including administering an effective amount of any of the aforementioned polypeptides, etc., are effective in treating or preventing tumors expressing the polypeptides.

The term "administering" as used herein refers to introducing a predetermined amount of a substance into a patient by some suitable means. The polypeptide, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen presenting cell, immune effector cell, vaccine or antibody of the present embodiment may be administered by any common route as long as it can reach the intended tissue. Various modes of administration are contemplated, including peritoneal, intravenous, intramuscular, subcutaneous, cortical, oral, topical, nasal, pulmonary and rectal, but the invention is not limited to these exemplified modes of administration. However, because of oral administration, the active ingredients of orally administered compositions should be coated or formulated to prevent degradation in the stomach. Preferably, the composition of the present invention can be administered in an injectable formulation. In addition, the pharmaceutical compositions of the present invention may be administered using specific devices that deliver the active ingredient to the target cells.

The frequency of administration and the dose of the polypeptide, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen-presenting cell, vaccine or antibody in the present embodiment can be determined by a variety of relevant factors, including the type of disease to be treated, the administration route, the age, sex, weight and severity of the disease of the patient and the type of drug as an active ingredient. According to some embodiments of the invention, the daily dose may be divided into 1, 2 or more doses in a suitable form, to be administered 1, 2 or more times over the entire period, as long as a therapeutically effective amount is achieved.

The term "therapeutically effective amount" refers to an amount sufficient to significantly ameliorate some of the symptoms associated with a disease or condition, i.e., to provide a therapeutic effect for a given condition and dosing regimen. The term "treatment" is used to refer to obtaining a desired pharmacological and/or physiological effect. As used herein, "treatment" encompasses administration of a polypeptide, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen presenting cell, immune effector cell, vaccine, or antibody of an embodiment of the invention to an individual for treatment, including but not limited to administration to an individual in need thereof as described herein.

Diagnostic method

In addition, the invention provides a diagnostic method. According to an embodiment of the invention, the diagnostic method comprises: detecting whether a biological sample derived from the patient carries a polypeptide as described above; determining whether the patient has a tumor based on whether the biological sample carries the polypeptide. The polypeptide provided by the embodiment of the invention is only found in cancer tissues, so that the free polypeptide in serum can be detected in a mass spectrum mode, and the polypeptide is used as a tumor marker for diagnosing cancer to determine whether a patient has the cancer. The inventors found that the polypeptide is specifically and highly expressed in tumor tissues, and the diagnosis method provided by the embodiment of the invention can effectively diagnose the tumor patients with the specifically and highly expressed polypeptide.

The inventor finds that the polypeptide is specifically and highly expressed by lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, particularly breast cancer, and further, the diagnosis accuracy of the tumor, particularly breast cancer, by the method provided by the embodiment of the invention is further improved.

Meanwhile, the inventor finds that HLA-A0201 has a high proportion in Chinese population, so that the diagnosis method provided by the embodiment of the invention has a higher probability of diagnosing tumor patients expressing the polypeptide in HLA-A0201 subtype patients.

Diagnostic system

Finally, the invention proposes a diagnostic system. According to an embodiment of the present invention, referring to fig. 1, the diagnostic system includes: a polypeptide detection device 100; the diagnostic result determination means 200. Wherein the polypeptide detection device 100 is used for detecting whether a biological sample from a patient carries the polypeptide, and the diagnosis result determination device 200 is connected to the polypeptide detection device 100 and used for determining whether the patient has a tumor based on whether the biological sample carries the polypeptide. According to an embodiment of the present invention, a mass spectrometer can be used to detect whether the free polypeptide exists in the serum of the patient, and then a mass spectrometry data analysis device can be used to determine whether the free polypeptide exists in the serum of the patient, so as to determine whether the patient has a tumor. The inventors found that the polypeptide is specifically and highly expressed in tumor tissues, and the diagnostic system provided by the embodiment of the invention can be used for effectively determining tumor patients with the specifically and highly expressed polypeptide.

In addition, the inventor finds that the specificity of the lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostatic cancer, cervical cancer, leukemia or brain tumor, especially breast cancer, highly expresses the polypeptide, and the diagnosis accuracy of the diagnosis system provided by the embodiment of the invention on the tumor, especially breast cancer, is further improved.

Meanwhile, the inventor finds that HLA-A0201 has a high proportion in Chinese people, HLA-A0201 has strong affinity with the polypeptide, and the polypeptide is combined with HLA-A0201 on the cell surface to further stimulate a series of immune reactions. Thus, the diagnostic system proposed in the examples of the present invention has a higher probability of diagnosing patients with tumors expressing the polypeptide among patients of HLA-A0201 subtype.

It is to be noted that the polypeptide and the use thereof, the nucleic acid encoding the polypeptide, the nucleic acid construct, the expression vector, the host cell, the pharmaceutical composition, the antigen presenting cell, the immune effector cell, the vaccine, the antibody, the method and the system for treating and diagnosing cancer according to the embodiments of the present invention are discovered and completed by the inventors of the present application through hard inventive work and optimization work.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not indicate specific techniques or conditions, according to techniques or conditions described in literature in the field (for example, see molecular cloning, a laboratory Manual, third edition, scientific Press, ed. By SammBruker et al, huang Pentang et al) or according to the product instructions. The reagents or apparatus used are not indicated by the manufacturer, but are conventional products available commercially, for example from Illumina.

Example 1 prediction of affinity of polypeptides

According to the selected HLA allele typing, the affinity prediction of the polypeptide is carried out by utilizing self-developed 'mutation polypeptide binding capacity prediction software based on tumor DNA and RNA sequencing' (software copyright number: 2016SR 002835). IC for predicting result ₅₀ Score representation, IC ₅₀ Less than 500nM indicates an affinity, IC, for the polypeptide ₅₀ Less than 50nM indicates a high affinity for the polypeptide. The inventors performed affinity prediction for wild-type (YLLWCFHL (SEQ ID NO: 5)) polypeptide, mutant polypeptide YLLWCFYL (SEQ ID NO: 1) and its variant (SEQ ID NO: 2-4) polypeptide, and finally screened mutant polypeptide and its variant polypeptide IC ₅₀ Score less than 500nM and IC of mutant and variant polypeptides ₅₀ The score was less than that of the wild-type (YLLWCFHL (SEQ ID NO: 5)) polypeptide. The results of the affinity prediction for the polypeptides are shown in table 1. Based on the results, the next T2 affinity validation was performed.

Table 1: prediction result of polypeptide and HLA-A0201 affinity

Computer software predicted IC of mutant and deformable polypeptides ₅₀ Both are below 50nM, indicating that both the mutant polypeptide and its alternative form are predicted to be high affinity polypeptides. And IC of mutant polypeptides and their alternative forms ₅₀ Less than the wild-type (YLLWCFHL (SEQ ID NO: 5)) polypeptide. Thus, the affinity of the mutant polypeptide YLILWCFOL (SEQ ID NO: 1) and its variant (SEQ ID NO: 2-4) polypeptides was predicted to be higher than that of the wild-type (YLILWCFOL (SEQ ID NO: 5)) polypeptide.

Example 2 polypeptide T2 affinity validation

(I) polypeptide synthesis and purification

The various types of polypeptides involved in the examples of the invention were synthesized according to standard solid phase synthesis methods and purified by reverse phase HPLC. Purity (> 90%) and identity of the polypeptide were determined by HPLC and mass spectrometry, respectively.

(II) affinity verification

T2 cells are HLA-A2 positive T and B lymphocyte hybridoma cells, which can express HLA-A0201 on the cell surface, but cannot transport endogenous antigens due to the defect of the antigen polypeptide Transporter (TAP) essential in the endogenous antigen presentation pathway. T2 cells were purchased from ATCC (accession number: CRL-1992).

Take 2X 10 ⁵ The T2 cells were resuspended in a 24-well plate using 500. Mu.l IMDM serum-free medium containing human β 2 microglobulin (final concentration, 3. Mu.g/ml), the synthesized wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, YLLWCFYL (SEQ ID NO: 1) polypeptide or 3 transformable (SEQ ID NO: 2-4) polypeptides thereof (final concentration 100. Mu.M) were added, and the total volume of the cells was reduced in a culture chamber (37 ℃,5 CO% ₂ ) And cultured overnight. 2 multiple wells per group; t2 cells without added polypeptide were used as background control and CMV polypeptide (NLVPMVATV (SEQ ID NO: 6)) was added as positive control. Cells were harvested by centrifugation at 200g for 5 minutes. After the cells were washed twice with PBS, the cells were incubated directly with FITC monoclonal antibody against HLA-base:Sub>A 02. Then using a flow cytometer (BD FACSJazz) ^TM ) And its software detects and analyzes its mean fluorescence intensity. The Fluorescence Index (FI) was calculated by the following formula: FI = [ Mean Fluorescence Intensity (MFI) sample-MFIbackground]MFIbackground, where MFIbackground represents a peptide-free value. FI>1.5 shows that the peptide has high affinity for HLA-A0201 molecules, 1.0<FI<1.5 showed that the peptide had moderate affinity for HLA-base:Sub>A x 02<FI<1.0 indicated that the peptide wasbase:Sub>A low affinity HLA-base:Sub>A x 0201 molecule. The results of the affinity assays for the polypeptides are shown in table 2 and figure 2.

Table 2: detection result of affinity of polypeptide and HLA-A0201

According to the prediction of experiments, the FI of the background control is 0, the FI of the positive polypeptide of CMV is 1.98, and both are normal. Whereas FIs for both the wild-type (YLLWCFHL (SEQ ID NO: 5)) and the transformable YMILWCFYL (SEQ ID NO: 3) polypeptides were greater than 1.5, FIs for the mutant polypeptide YLLWCFYL (SEQ ID NO: 1) and its 2 transformable (SEQ ID NO:2, SEQ ID NO: 4) polypeptides were 1.0 FI-to-FI 1.5. It was further demonstrated that the wild-type (YLLWCFHL (SEQ ID NO: 5)) and YMILWCFYL (SEQ ID NO: 3) polypeptides have high affinity for HLA-A0201 molecules, and that the mutant polypeptide YLLWCFYL (SEQ ID NO: 1) and its 2 transformable (SEQ ID NO:2, SEQ ID NO: 4) polypeptides have high affinity for HLA-A0201 molecules.

EXAMPLE 3 in vitro stimulation of CD8 by Polypeptides ⁺ T cells

Collecting 100ml of peripheral blood of HLA-A0201 subtype positive healthy volunteers, separating Peripheral Blood Mononuclear Cells (PBMC) with Ficoll lymphocyte separating medium, collecting PBMC with adherence method to obtain mononuclear cells, and screening CD8 in PBMC with CD8 magnetic beads ⁺ The T cell of (1). GM-CSF (1000U/ml) and IL-4 (1000U/ml) are adopted to induce adherent monocytes to become immature DC, IFN-gamma (100U/ml) and LPS (10 ng/ml) are added, and finally mutant polypeptide YLLWCFYL (SEQ ID NO: 1) and 3 kinds of deformable polypeptides (SEQ ID NO: 2-4) are respectively added to induce adherent cells to become polypeptide specific mature DC. The mature DC cells loaded with the polypeptide are compared with CD8 of volunteers ⁺ T cells were co-cultured and IL-21 was added 3 days later, IL-2 and IL-7 were supplemented, then IL-2 and IL-7 were added once on days 5 and 7, co-cultured cells were counted on day 10, and subsequent ELISPOTs and LDH detection. The counting results are shown in table 3:

table 3: counting results after cultivation

	Total number of cells before culture	Total number of cells after culture
			YLILWCFHL(SEQ ID NO：5)	2.0×10 6	7.6×10 6
YLILWCFYL(SEQ ID NO：1)	2.0×10 6	7.9×10 6
			YLILWCFYV(SEQ ID NO：2)	2.0×10 6	8.1×10 6
YMILWCFYL(SEQ ID NO：3)	2.0×10 6	8.9×10 6
			YMILWCFYV(SEQ ID NO：4)	2.0×10 6	9.6×10 6

After 10 days of culture, the cells have obvious proliferation, and the total cell number expansion multiple is between 3 and 5 times.

Example 4 verification of polypeptide activation of CD8 by ELISPOTs ⁺ T cell immune response

The cells co-cultured in example 3 were cultured and assayed in human interferon gamma ELISPOTs plates with T2 cells loaded with the mutant polypeptide YLLWCFYL (SEQ ID NO: 1) and wild-type YLLWCFHL (SEQ ID NO: 5), respectively. Spots generated by the ELISPOT experiment were finally counted. The requirements for immunogenicity of the mutant polypeptides are as follows: number of spots (mutant polypeptide)/number of spots (wild-type) polypeptide) >2, i.e. more than twice the number of spots caused by the mutant polypeptide than the number of spots of the wild-type polypeptide is a requirement for the immunogenicity of the polypeptide.

The results are shown in Table 4 and FIG. 3. Wherein, the mutant polypeptide is loaded in an experimental hole, and the wild type polypeptide is loaded in a control hole.

The ELISPOTs detection method has the following principle: CD8 ⁺ The T cells are capable of specifically recognizing complexes of HLA-A0201 and the polypeptide, the polypeptide sequences are different, and the population of T cells recognizing complexes of the polypeptide and HLA-A0201 is different. Since T2 cells express HLA-A0201, CD8 ⁺ T cells are able to specifically recognize T2 cells loaded with the mutant polypeptide YLLWCFYL (SEQ ID NO: 1), but not T2 cells loaded with the wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide. Polypeptide-specific CD8 after specific recognition of a complex of HLA-A0201 and polypeptide ⁺ T cells can reactivate and secrete IFN-gamma interferon. And CD8 ⁺ IFN-gamma interferon secreted by activated T cells can be captured by antibodies on ELISPOTs plates, and secondary antibodies finally recognizing the IFN-gamma antibodies can catalyze substrate color development by enzymes coupled on the secondary antibodies, so that spots are finally generated. The number of spots represents the number of cells activated to secrete IFN-gamma interferon.

Table 4: polypeptide stimulation specificity CD8 ⁺ Secretion of IFN-gamma interferon by T cells

Example 5 LDH Release assay demonstrating CD8 ⁺ T cell killing Activity

The cells co-cultured in example 3 were co-cultured with the supermutant polypeptide YLLWCFYL (SEQ ID NO: 1) or 3 variants thereof, respectivelyCo-culturing polypeptide of formula (SEQ ID NO: 2-4), wild type YLLWCFHL (SEQ ID NO: 5) polypeptide and T2 cell without loading polypeptide, setting maximum release hole, volume correction hole, culture medium control hole, spontaneous release hole, control of different effect target ratio (i.e. number ratio of effector cell (T cell) and target cell (T2 cell)) in experiment, setting 3 multiple holes for each group, after 4h, taking out 50 μ l of co-cultured cell supernatant, adding into 50 μ l of LDH substrate mixed solution, allowing cell supernatant to catalyze LDH substrate reaction, finally reading 490nm wavelength and 680nm reference wavelength, and calculating CD8 according to control hole ⁺ Killing activity of T cells to kill T2.

The killing activity calculation formula is:

killing efficiency (%) = (experimental wells-effector cell spontaneous release-target cell spontaneous release + media wells)/(target cell maximal release-volume corrected wells-target cell spontaneous release + media wells) × 100%

Among these, the principle of the LDH release assay is: lactate Dehydrogenase (LDH) is one of the cytosolic enzymes of living cells and is normally impermeable to the cell membrane. When target cells are damaged by attack by effector cells, the cell membrane permeability changes and LDH can be released into the medium. The released LDH enables oxidized coenzyme I (NAD +) to be changed into reduced coenzyme I (NADH) in the process of catalyzing lactic acid to generate pyruvic acid, the latter reduces iodonitronitronitroblue tetrazolium chloride (INT) or nitroblue tetrazolium chloride (NBT) through hydrogen transferring body-phenazine dimethyl sulfate (PMS) to form a colored formazan compound, a high absorption peak is formed at the wavelength of 490nm or 570nm, and the activity of effector cells can be obtained by calculation by utilizing the read OD value.

The results are shown in Table 5 and FIG. 4.

Table 5: t cell specificity recognition and killing target cell loaded with experimental polypeptide

As can be seen from Table 5 above and FIG. 4, at a potency to target ratio of 1 or 10, 1, the mutant polypeptide and its transformable polypeptide activated T cells were able to kill T2 cells loaded with the mutant polypeptide YLLWCFYL (SEQ ID NO: 1) or its 3 transformable polypeptides (SEQ ID NO: 2-4) but not T2 cells loaded with the wild-type polypeptide YLLWCFHL (SEQ ID NO: 5), which further verified that T cells activated with the experimental group polypeptide (polypeptide of amino acid sequence shown in SEQ ID NO:1 and its transformable polypeptide) were able to specifically kill target cells loaded with the mutant polypeptide YLLWCFYL (SEQ ID NO: 1) or its 3 transformable polypeptides (SEQ ID NO: 2-4).

Example 6 establishment of a model of subcutaneous transplantable tumor of MCF 7-YLLWCFYL (SEQ ID NO: 1) polypeptide or its transformable polypeptide

(I) constructing and packaging a recombinant lentivirus synthesized YLILWCFYL (SEQ ID NO: 1) polypeptide or a variant polypeptide thereof, wherein the DNA sequence of the YLILWCFYL (SEQ ID NO: 1) polypeptide is shown in SEQ ID NO:7, AATATCTTATTTTATGGTGTTTTCACC (SEQ ID NO: 7),

and the DNA sequence of the variable YLLWCFYV (SEQ ID NO: 2) polypeptide is shown in SEQ ID NO:8, AATATCTTATTTTATGGTGTTTTCGTC (SEQ ID NO: 8),

and the DNA sequence of the transformable YMILWCFYL (SEQ ID NO: 3) polypeptide is shown as SEQ ID NO:9, AATATGTTATTTTATGGTGTTTTCACC (SEQ ID NO: 9),

and the polypeptide DNA sequence of the transformable YMILWCFYV (SEQ ID NO: 4) is shown as SEQ ID NO:10, AATATGTTATTTTATGGTGTTTTTCGTC (SEQ ID NO: 10),

and the DNA sequence corresponding to the wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide is shown as SEQ ID NO:11, AATATCTTATTTTATGGTGTTCATACC (SEQ ID NO: 11).

Respectively constructing slow virus vector pHBLV-Puro for expressing wild polypeptide YLILWCHL (SEQ ID NO: 5) and YLILWCYL (SEQ ID NO: 1) polypeptide and deformable polypeptide thereof. And named pHBLV-Puro-YLLWCFHL, pHBLV-Puro-YLLWCFYL, pHBLV-Puro-YLLWCFYV, pHBLV-Puro-YMILWCFYL, and pHBLV-Puro-YMILWCFYV, respectively. Then co-transfecting the 5 lentivirus plasmids, pSPAX2 and pMD2G helper plasmids into 293T cells, and packaging lentiviruses expressing wild-type polypeptides YLLWCFHL (SEQ ID NO: 5), YLLWCFYL (SEQ ID NO: 1) and 3 transformable polypeptides (SEQ ID NO: 2-4).

(II) establishment of human breast cancer cell line expressing YLLWCFYL (SEQ ID NO: 1) polypeptide

The human breast cancer cell line MCF7 was purchased from ATCC (accession number: HTB-22), and its HLA subtype was HLA-A0201 positive. Cells were cultured in DMEM medium containing 10% fetal bovine serum, 100U/mL penicillin and streptomycin. 37 ℃,5% of CO ₂ Culturing in an incubator. The packaged YLLWCFYL (SEQ ID NO: 1) lentivirus was transfected into MCF7 cell line, and viable MCF7 cell line was continuously selected using Puromycin antibiotic (Puromycin), finally establishing MCF7 cell line expressing YLLWCFYL (SEQ ID NO: 1) polypeptide. For example, the cell line can be named MCF 7-YLLWCFYL (SEQ ID NO: 1).

(III) NOD SCID mouse human immune reconstitution

Collecting 600-900 ml of anticoagulated peripheral blood of healthy volunteers. Ficoll Peripheral Blood Mononuclear Cells (PBMC) were isolated and the cells were collected for use. 300 NOD SCID mice with immunodeakage exclusion were injected intraperitoneally with PBMC 2X 10 ⁷ 0.5ml, NOD SCID mice were human reconstituted immunologically. Further, 4 weeks later mice were selected to be inoculated with the human breast cancer cell line model.

(IV) construction of human breast cancer tumor model

The established human breast cancer cell line MCF 7-YLLWCFYL (SEQ ID NO: 1) was cultured in DMEM medium containing 10% fetal bovine serum, 100U/mL penicillin and streptomycin. 37 ℃ C., 5% CO ₂ Culturing in an incubator. The tumor cells such as MCF 7-YLLWCFYL (SEQ ID NO: 1) were collected, centrifuged at 3000 rpm, and the tumor cells were washed 3 times with sterile physiological saline. Diluting properly, adding 10 microliters of 0.4% phloroglucinol blue into 40 microliters of cell suspension, staining and counting by microscopic examination to obtain the cell suspension with the concentration of 1 × 10 ⁸ For each ml of tumor cell suspension, the immunized and reconstituted NOD/SCID mice were selected and each mouse was inoculated subcutaneously with 100. Mu.l of tumor cell suspension. After inoculation, the inoculated part is observed day by day for infection, and the tumor naturally regresses after growth, and the tumor major axis a (length) is measured by a vernier caliper every 2-3 days) And short diameter b (wide), and the size of the tumor = a × b × b/2 is calculated. After 7 days, the mice had approximately rice-sized tumors. MCF 7-YLLWCFYL (SEQ ID NO: 1) subcutaneous tumor model NOD/SCID mice immunized for 4 weeks were treated with peptide + complete Freund's adjuvant vaccine, or peptide + DC vaccine, or lentivirus-infected DC cell vaccine, and DC-CTL vaccine, respectively, and tumor volume and mouse survival were recorded every 2 days.

Example 7 preparation of polypeptide vaccine and treatment protocol

MCF 7-YLLWCFYL (SEQ ID NO: 1) subcutaneous tumor model NOD/SCID mice immunized for 4 weeks were randomized into 6 groups: adjuvant + wild type YLLWCFHL (SEQ ID NO: 5) polypeptide group, adjuvant decaYLLWCFYL (SEQ ID NO: 1) group or 3 variable form polypeptide groups, 6 each. The first immunization dose of the wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, YLLWCFYL (SEQ ID NO: 1) polypeptide and the 3 variable forms thereof was 100. Mu.g/mouse. The above polypeptides were resuspended in PBS, mixed with 150. Mu.l/Freund's complete adjuvant, adjusted to 300. Mu.l/Freund's with PBS, and injected subcutaneously into the back at two sites. After 2 weeks, booster immunizations were performed with the same dose (1 st with complete Freund's adjuvant followed by 4 co-immunizations with incomplete Freund's adjuvant). The mice were observed daily for general characteristics including mental state, activity, reaction, diet, body weight, tumor growth, and the like. Tumor longest (length) and shortest (width) diameters were measured every 2 days with a vernier caliper. Wherein, the calculation formula of the tumor volume is as follows: 1/2 x length x width ² (ii) a The life cycle calculation formula is as follows: survival over time = mice alive over time/(mice alive over time + mice dead over time) × 100%. The results are shown in FIG. 5.

The results show that the "YLLWCFYL (SEQ ID NO: 1) polypeptide or its modified form + Freund's adjuvant" group can effectively inhibit tumor growth and prolong the survival of mice relative to the adjuvant-only group and the wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide group.

Example 8 preparation of DC polypeptide vaccine and treatment protocol

Collecting 100-150 ml of anticoagulated peripheral blood of healthy volunteers. Ficoll isolation of peripheral blood mononuclear cells (pe)PBMC), collecting PBMC cells at 2-3 × 10 ⁶ Resuspending in RPMI 1640 culture medium, incubating at 37 deg.C for 2h to obtain adherent cells as DC, and extracting nonadherent cells as Peripheral Blood Lymphocytes (PBL) for use. Using GM-CSF (1000U/ml) and IL-4 (1000U/ml) to induce adherent monocytes to become immature DCs, adding IFN-gamma (100U/ml) and LPS (10 ng/ml), finally adding wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, YLLWCFYL (SEQ ID NO: 1) polypeptide and 3 deformable polypeptides (10 mu g/ml) respectively, inducing adherent monocytes to become mature DCs, harvesting the mature DCs, and washing 3 times with physiological saline. The polypeptide-loaded DCs were adjusted to (4.0. + -. 0.5). Times.10 with physiological saline ⁷ And/ml for subsequent experiments. Mice were randomly divided into 5 groups of DC-loaded wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, DC-loaded YLLWCFYL (SEQ ID NO: 1) polypeptide, and DC-loaded 3 variable form (SEQ ID NO: 2-4) polypeptide, each of 6. DC-loaded wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, DC-loaded YLLWCFYL (SEQ ID NO: 1) polypeptide and deformable polypeptide cell suspensions of any of them were prepared. Mice were injected intradermally, 0.1ml per side, 1 time per week, near the inner thigh of the groin. The dosage is (4.0 +/-0.5) multiplied by 10 ⁶ Cells/time, 2 total injections. After the injection, the vital signs of the mice were observed, and the size of the tumor was measured every 2 days with a vernier caliper. Tumor volume was calculated as tumor volume =1/2 × length × width ² . Meanwhile, the weight change and survival of the mice were recorded. The results are shown in FIG. 6.

The results show that the YLLWCFYL (SEQ ID NO: 1) polypeptide or its variant (any one of SEQ ID NO: 2-4) loaded DC vaccine can significantly prolong the survival of mice and slow down the growth of mouse tumors relative to the group of wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide loaded DC vaccines.

Example 9 preparation of lentivirus-infected DC cell vaccine and treatment protocol

Collecting 100-150 ml of anticoagulated peripheral blood of healthy volunteers. Separating Peripheral Blood Mononuclear Cells (PBMC) by Ficoll, collecting PBMC cells, incubating at 37 deg.C for 2h, and washingAdherent cells, DC cells cultured by recombinant human granulocyte-macrophage colony stimulating factor (rhGM-CSF) and recombinant human interleukin-4 (rhIL-4). Culturing to the fifth day, replacing appropriate amount of culture medium and adjusting cell density to 1 × 10 ⁶ Per ml; the slow virus fluids expressed in example 6 containing appropriate amounts of wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, YLLWCFYL (SEQ ID NO: 1) polypeptide, and transformable polypeptide thereof were added separately. After 24h, the virus culture medium was removed, and the medium containing 50ng/ml rhIL-4, 100ng/ml rhGM-CSF, 100U/ml IFN-. Gamma.and 100ng/ml LPS was added and incubated at 37 ℃ for 5% CO ₂ Culturing in an incubator. And (5) observing lentivirus infected DC cells under a fluorescence microscope after 48-72h, and collecting mature DC cells for mouse tumor model treatment. Washed 3 times with physiological saline and DC adjusted to (4.0 + -0.5) x10 ⁷ Pieces/ml for subsequent experiments. Mice were randomly divided into 5 groups, a wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide-DC group, a YLLWCFYL (SEQ ID NO: 1) polypeptide-DC group, and 3 variant forms thereof (shown by any one of SEQ ID NO: 2-4) polypeptide-DC groups, each of which had 6 mice. Preparing cell suspension of DC-loaded wild-type YLLWCFHL (SEQ ID NO: 5) polypeptide, DC-loaded YLLWCFYL (SEQ ID NO: 1) polypeptide or 3 deformable polypeptides (shown by any sequence of SEQ ID NO: 2-4) thereof. Mice were injected intradermally, 0.1ml per side, 1 time per week, near the inner thigh of the groin. The dosage is (4.0 +/-0.5) multiplied by 10 ⁶ Cells/time, 2 total injections. After the injection, the vital signs of the mice were observed, and the size of the tumor was measured every 2 days with a vernier caliper. Tumor volume is calculated as tumor volume =1/2 × length × width ² . Meanwhile, the weight change and survival of the mice were recorded. The results are shown in FIG. 7.

The result shows that the lentiviral infected DC vaccine expressing YLILWCFYL (SEQ ID NO: 1) polypeptide or a deformable polypeptide (shown by any sequence of SEQ ID NO: 2-4) gene package has obvious tumor inhibition effect and can remarkably prolong the survival time of mice compared with a wild type polypeptide control group.

Example 10 preparation of polypeptide-specific DC-CTL vaccines and treatment protocols

Example 8 collection of PBL by magnetic bead sorting to obtain CD8 ⁺ Incubating and sensitizing T and DC loaded with wild YLLWCFHL (SEQ ID NO: 5) polypeptide and YLLWCFYL (SEQ ID NO: 1) polypeptide or 3 variable type (shown by any sequence of SEQ ID NO: 2-4) polypeptides, wherein the cell ratio is DC: CD8 ⁺ T = 1. Adding IL-2 at 500IU/ml and IL-7 at 50ng/ml to the culture medium, 5% CO at 37 ℃ ₂ Incubating together in an incubator, and counting cells after 1 week of culture; a second round of stimulation with DCs loaded with the YLILWCCFYL (SEQ ID NO: 1) polypeptide or 3 of its alternative polypeptides, DCs loaded with the wild-type YLILWCF HL (SEQ ID NO: 5) polypeptide, and 500IU/ml IL-2 was performed at week 2. Three co-stimulations were performed, with appropriate addition of medium during the culture. The number of lymphocytes was counted on days 0,7, 14 and 21 of culture, and the cell Proliferation Index (PI) was calculated. Wherein PI = number of cells after expansion/number of seeded cells. Cells were harvested on day 7 after the 3 rd stimulation, i.e., cytotoxic T Lymphocytes (CTLs). Resuspending the cells in normal saline, the resuspension volume is 0.2ml, and the cells are returned via tail vein, and the number of the returned cells of each tumor model mouse is about 1x10 ⁸ A cell. After the injection, the mice were observed with care for vital signs, and the length and width of the tumor were measured with a vernier caliper every 2 days. The results are shown in FIG. 8.

The results show that the DC-CTL vaccine activated by the YLLWCFYL (SEQ ID NO: 1) polypeptide or the transformable polypeptide (shown by any sequence of SEQ ID NO: 2-4) thereof has obvious tumor inhibition effect and can remarkably prolong the survival period of the mice compared with the wild type YLLWCFHL (SEQ ID NO: 5) polypeptide control group.

Industrial applicability

The polypeptide can be effectively applied to preparation of kits, medicines or vaccines, the specificity of immune response caused by the medicines or vaccines is higher, compared with other tumor polypeptide vaccines, the polypeptide has the advantages of safety, small side effect and less serious adverse reaction, and the polypeptide can be used as a vaccine, a pharmaceutical composition and the like to cause the immune response aiming at tumors due to simple structure and easy artificial synthesis.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Various modifications and substitutions of those details may be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

In the description of the present specification, reference to the description of "one embodiment," "some embodiments," "an illustrative embodiment," "an example," "a specific example," or "some examples" or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

SEQUENCE LISTING

<110> Shenzhen Hua Dagene institute

<120> polypeptide and use thereof

<130> PIOC3168032PCN

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 9

<212> PRT

<213> Artificial

<220>

<223> sequence of mutant polypeptide

<400> 1

Tyr Leu Ile Leu Trp Cys Phe Tyr Leu

1 5

<210> 2

<211> 9

<212> PRT

<213> Artificial

<220>

<223> amino acid sequence of variant forms of mutant polypeptide

<400> 2

Tyr Leu Ile Leu Trp Cys Phe Tyr Val

1 5

<210> 3

<211> 9

<212> PRT

<213> Artificial

<220>

<223> amino acid sequence of variant forms of mutant polypeptide

<400> 3

Tyr Met Ile Leu Trp Cys Phe Tyr Leu

1 5

<210> 4

<211> 9

<212> PRT

<213> Artificial

<220>

<223> amino acid sequence of variant forms of mutant polypeptide

<400> 4

Tyr Met Ile Leu Trp Cys Phe Tyr Val

1 5

<210> 5

<211> 9

<212> PRT

<213> Artificial

<220>

<223> amino acid sequence of wild-type polypeptide

<400> 5

Tyr Leu Ile Leu Trp Cys Phe His Leu

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial

<220>

<223> amino acid sequence of CMV polypeptide

<400> 6

Asn Leu Val Pro Met Val Ala Thr Val

1 5

<210> 7

<211> 27

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of DNA encoding mutant polypeptide

<400> 7

aatatcttat tttatggtgt tttcacc 27

<210> 8

<211> 27

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of DNA encoding mutant polypeptide transformable polypeptide

<400> 8

aatatcttat tttatggtgt tttcgtc 27

<210> 9

<211> 27

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of DNA encoding mutant polypeptide transformable polypeptide

<400> 9

aatatgttat tttatggtgt tttcacc 27

<210> 10

<211> 27

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of DNA encoding mutant polypeptide transformable polypeptide

<400> 10

aatatgttat tttatggtgt tttcgtc 27

<210> 11

<211> 27

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of DNA encoding wild-type polypeptide

<400> 11

aatatcttat tttatggtgt tcatacc 27

Claims (13)

1. An isolated polypeptide selected from the group consisting of:

SEQ ID NO: 1. 2, 3 or 4.

2. Use of the polypeptide of claim 1 in the manufacture of a medicament for the prevention or treatment of a tumor, said tumor being breast cancer.

3. An isolated nucleic acid, wherein said nucleic acid is:

a nucleic acid encoding the polypeptide of claim 1.

4. A nucleic acid construct comprising:

a coding sequence which is the nucleic acid of claim 3, and

optionally a control sequence operably linked to the coding sequence.

5. An expression vector comprising the nucleic acid construct of claim 4.

6. A host cell carrying the nucleic acid construct of claim 4 or the expression vector of claim 5.

7. The host cell of claim 6, wherein the host cell is obtained by transfection or transformation of the nucleic acid construct or expression vector.

8. A pharmaceutical composition, comprising:

the polypeptide of claim 1; and

a pharmaceutically acceptable adjuvant.

9. Use of a polypeptide according to claim 1 in the manufacture of a vaccine for the prevention or treatment of a tumour, which is breast cancer.

10. An isolated antigen presenting cell which can present the polypeptide of claim 1.

11. The antigen presenting cell of claim 10, wherein the antigen presenting cell is obtained by at least one of:

contacting a cell having antigen presenting ability with said polypeptide; or

Introducing the nucleic acid of claim 3, or the nucleic acid construct of claim 4, or the expression vector of claim 5 into said antigen-presenting cell.

12. The antigen presenting cell according to claim 11, wherein the cell having antigen presenting ability is a dendritic cell.

13. A vaccine comprising the nucleic acid of claim 3, or comprising the nucleic acid construct of claim 4, or comprising the expression vector of claim 5, or comprising the host cell of claims 6-7, or comprising the antigen presenting cell of any one of claims 10-12.

Images