CN114763576A

CN114763576A - Microdroplet digital PCR detection method of ureaplasma parvum and kit thereof

Info

Publication number: CN114763576A
Application number: CN202110085138.6A
Authority: CN
Inventors: 黄艳芳; 赵缜
Original assignee: Individual
Current assignee: Individual
Priority date: 2021-01-14
Filing date: 2021-01-14
Publication date: 2022-07-19

Abstract

The invention belongs to the technical field of biology, and relates to a method and a kit for absolutely and quantitatively detecting ureaplasma parvum by using a droplet type digital PCR. A first set of primers and probes (labeled FAM) are designed according to the consistent sequences of the genes of 4 subtypes of ureaplasma parvum, and a second set of primers and probes (labeled VIC) are designed according to the sequence of a human glyceraldehyde-3-phosphate dehydrogenase Gene (GAPDH). The invention can simultaneously detect 4 subtypes of ureaplasma parvum and has no cross reaction with ureaplasma urealyticum. The method disclosed by the invention is used for absolutely quantifying the micro ureaplasma in the specimen by utilizing a micro-drop digital PCR technology, and has the advantages of high sensitivity, strong specificity, no need of a standard curve and incomparable accuracy. The method and the kit can be used for the auxiliary diagnosis of the micro ureaplasma parvum infection and the monitoring of the treatment effect of the antibacterial agent after use in a clinical laboratory, and have potential application value.

Description

Microdroplet digital PCR detection method of ureaplasma parvum and kit thereof

Technical Field

The invention belongs to the technical field of biology, relates to an in vitro nucleic acid diagnosis method, and particularly relates to a method and a kit for absolutely and quantitatively detecting ureaplasma parvum by using a droplet type digital PCR.

Background

Ureaplasma urealyticum (Ureaplasma spp.) is one of the pathogens responsible for urogenital infections in humans. Based on the molecular biological characteristics, the two groups are divided into two groups and 14 serotypes, and the two groups include Ureaplasma parvum (Up) and Ureaplasma urealyticum (Uu). Serotypes 1, 3, 6 and 14 with smaller genomes belong to the ureaplasma parvum and account for 90 to 92 percent of ureaplasma parvum infection; and serotypes 2, 4, 5, 8-13 with larger genome belong to ureaplasma urealyticum and only account for 8-10 percent of ureaplasma infection.

Research has shown that Ureaplasma urealyticum (Ureaplasma spp.) is closely associated with nongonococcal urethritis, cervicitis, and various adverse pregnancy outcomes (abortion, premature birth, chorioamnionitis, premature rupture of fetal membranes, etc.). The pathogenicity of ureaplasma urealyticum (Uu spp.) has been controversial. One Meta analysis indicated that there was a significant correlation between Uu and male sterility, but Up was not. However, other clinical studies have shown that infection with Up exacerbates the risk of premature delivery in pregnant women. Furthermore, it is believed by scholars that the pathogenicity of ureaplasma urealyticum may be related to the bacterial load. Therefore, accurate typing and absolute quantification of ureaplasma urealyticum will contribute to clinical diagnosis, treatment and elucidation of the pathogenic mechanism of diseases.

In the past, ureaplasma is mainly typed by serology, but serotype typing operation is complicated, cross reaction is easy to occur, and the result is difficult to accurately judge. Currently, ureaplasma urealyticum is genotyped mainly by TaqMan probe-based real-time fluorescent quantitative pcr (qpcr), such as: patents CN201410113941.6 and CN 103045721A. However, qPCR requires standard curves to be drawn with standards of known concentration to calculate the concentration of unknown samples. The standard curves constructed in different laboratories are different, and the quantitative results of different laboratories on the same sample are very different. Therefore, in order to overcome the defects and shortcomings of the prior art, the invention provides a method for absolute quantification with higher sensitivity and higher precision without depending on a standard curve.

As a third generation of quantitative detection means of nucleic acid in the micro-drop type digital PCR system, Bio-Rad has adopted the advanced microfluidics technology, each sample can generate 20,000 highly uniform nano-liter micro-droplets, and then combined with the statistical principle, the copy number content of the target sample is obtained in a digital way, and no external reference and standard substance are needed, thus realizing higher detection sensitivity and precision.

The invention establishes a micro-drop digital PCR reaction for absolutely and quantitatively detecting the micro ureaplasma according to the parC gene sequence of the micro ureaplasma.

Disclosure of Invention

The invention aims to overcome the defect of inaccurate quantification of a real-time fluorescence PCR method and provides a method for detecting ureaplasma parvum by using a droplet type digital PCR and a kit thereof. Specifically designing a specific primer and probe, and utilizing a method for absolutely and quantitatively detecting the ureaplasma parvum by utilizing a micro-drop digital PCR;

it is another object of the present invention to provide a kit for use in the above method.

The invention adopts a universal DNA extraction kit to extract the DNA of the ureaplasma parvum, and designs a universal primer which can simultaneously amplify 4 subtypes of the ureaplasma parvum without amplifying 10 subtypes of ureaplasma parvum on the basis of analyzing the sequences of the 4 subtypes of the ureaplasma parvum. In addition, no pathogenic microorganisms related to other cervicitis are amplified in a cross mode, so that the specificity is good.

More specifically, the microdroplet digital PCR detection method of the ureaplasma parvum and the kit thereof comprise the following steps:

1. preparing a primer and a probe;

based on the parC sequence of ureaplasma parvum, primers were designed and synthesized with the following sequences:

Up-F：5’AGCTGTTTATATATGGAACGAACAA3’(1782nt-1806nt)；

Up-R：5’TATCCAACTCGCTTAATTCAATT3’(1863nt-1885nt)；

Up-P：5’TATCAATTAGTTTTGGCTTCT 3’(1822nt-1842nt)。

2. droplet digital PCR:

the microdroplet digital PCR reaction comprises 4 steps of preparing a system, preparing microdroplets, amplifying cycles and reading signals.

1) Preparing a ddPCR reaction solution containing a nucleic acid sample; uniformly mixing the Bio-Rad ddPCR premix, the micro ureaplasma parvum specific primer, the probe, the internal reference specific primer, the probe and the nucleic acid sample.

2) Preparing microdroplets: the dd PCR reaction mixture was transferred to the corresponding well of the DG8 microtitre card.

3) PCR amplification using hydrolysis probe: the samples subjected to the micro-titration treatment were transferred to a 96-well PCR reaction plate and sealed. The PCR program was run.

4) Reading and analyzing the results: after the PCR is finished, the PCR reaction plate is placed in a QX200 microdroplet analyzer, microdroplet fluorescence signals are detected and analyzed one by one, whether the sample to be detected contains the ureaplasma parvum or not is judged according to the number of positive microdroplets, and the corresponding content of the ureaplasma parvum is determined.

Drawings

FIG. 1 is a graph of 2-D fluorescence intensity of a clinical sample, Microureaplasma parvum, detected by double-droplet digital PCR.

Ch1 is FAM fluorescence signal, and Ch2 is VIC fluorescence signal. Black clusters are negative droplets, blue clusters are Up positive droplets, green clusters are GAPDH positive droplets, orange clusters are droplets that are both Up and GAPDH positive.

A. The specimen is qualified, and the sample to be detected is positive to the ureaplasma parvum; B. the specimen is qualified, and the sample to be detected is negative to the small ureaplasma; C. and if the sample to be detected is unqualified in sampling or the DNA extraction fails, the DNA of the sample to be detected is recommended to be re-inspected or re-extracted.

FIG. 2. double micro-drop digital PCR test for detecting the specificity of ureaplasma parvum.

Ch1 is FAM fluorescence signal, and Ch2 is VIC fluorescence signal. From left to right, there are 7 wells, which are: a03 is Mycoplasma hominis, B03 is Mycoplasma genitalium, C03 is Chlamydia trachomatis, D03 is human papilloma virus, E03 is herpes simplex virus, F03 is Neisseria gonorrhoeae, and G03 is Streptococcus agalactiae.

FIG. 3 is a 2-D fluorescence intensity plot of the reportable range of double microdroplet digital PCR amplified microureaplasma.

Detailed Description

Design and Synthesis of primers and probes

Primers and probes were designed with software and synthesized for HPLC purification. Wherein, the 5 'end of the micro ureaplasma probe is marked with a report group FAM, and the 3' end is marked with a quenching group MGB; the 5 'end of the GAPDH probe is marked with a reporter group VIC, and the 3' end is marked with a quenching group MGB.

The primer probes involved are as follows:

Up-F：5’AGCTGTTTATATATGGAACGAACAA3’(1782nt-1806nt)；

Up-R：5’TATCCAACTCGCTTAATTCAATT3’(1863nt-1885nt)；

Up-P：5’TATCAATTAGTTTTGGCTTCT 3’(1822nt-1842nt)。

collecting actual detection sample and extracting DNA genome of ureaplasma parvum

And (3) extending the sterile swab into the cervical orifice of a female for 1-2cm, rotating for a circle, staying for about 10 seconds, taking out (with a mucous membrane), placing in a sterile sampling tube, and sealing for inspection. Samples should be tested immediately upon handling or stored at-20 ℃ for up to 6 months.

The test sample includes, but is not limited to, leucorrhea of female, cervical swab, urine, and urine of male. Sample treatment:

placing the sample tube on an oscillator to oscillate for 2-3 minutes, squeezing cotton swabs from the tube wall, sucking all liquid, transferring the liquid into a 1.5ml centrifuge tube, centrifuging at 12000rpm/min for 10 minutes, and discarding the supernatant to leave a precipitate. Then, nucleic acid of the sample to be detected is extracted according to a kit of TaKaRa company (products of the same type of other companies can also be selected).

The method comprises the following specific operation steps: adding appropriate amount of Buffer GL, protease K and RNase A into the precipitate, mixing, and performing water bath lysis at 56 deg.C for 10 min. ② adding 200 mul of Buffer GB and 200 mul of absolute ethyl alcohol, transferring the solution to Spin Column after mixing evenly, centrifuging at 12000rpm for 2 minutes, and removing the filtrate. ③ adding 500. mu.l of Buffer WA, and centrifuging at 12000rpm for 1 min. Adding 700 mul of Buffer WB, and centrifuging at 12000rpm for 3 min. Finally, 40-200 mul of precipitation Buffer is added, and the DNA template is eluted by centrifugation at 12000rpm for 2 min.

Negative quality control product: a sample of human epithelial cells was collected in an amount of 100. mu.l, and treated in the same manner as the sample.

Positive quality control product: the positive quality control product is ureaplasma urealyticum serotype 8(ATCC 27816), and 50 ul of the product is sterilized and subpackaged after liquid culture and is treated with the same sample.

Performing microdroplet digital PCR

The microdroplet digital PCR reaction comprises 4 steps of preparing the system, generating microdroplets, amplifying cycles and reading signals. A20. mu.l system as recommended by ddPCR kit for Probes kit was used, as shown in Table 2. Negative and positive controls are included in each test.

TABLE 2 digital PCR amplification ureaplasma urealyticum reaction System

Name of reagent	Adding volume	Final concentration
			2 XPCR buffer	10μl	1×
20 XUp/GAPDH primers/probes	1μl	900nM/250nM
			DNA template
	1～9μl	-
			RNase-/DNase-free H₂O	Variable	-
Total volume	20	-

Mu.l of the reaction was added to the middle row of 8 wells of a DG8 cartridge, 70. mu.l of Droplet Generation Oil was added to the bottom row of a DG8 cartridge, the gel pad was covered and the drop generator was placed, the droplets were generated and transferred to a 96-well plate and sealed with a preheated PX1 heat sealer.

After membrane sealing, the microdroplets were subjected to ddPCR amplification as shown in Table 3.

TABLE 3 digital PCR amplification Urea ureaplasma urealyticum reaction procedure

After PCR amplification was complete, fluorescent signals were collected in a QX200 Droplet Reader and the copy number was calculated using Quanta Soft software.

Evaluation of methodology

Specificity, reproducibility, reportable range, minimum detection limit tests, etc. were performed to evaluate the reliability of the method.

Specificity: DNAs of Mycoplasma hominis (ATCC 14027), Mycoplasma genitalium (ATCC 33530), Chlamydia trachomatis (ATCC VR-880), HPV52 (ATCC VRMC-29), HSVII (ATCC VR-540), Neisseria gonorrhoeae (ATCC 49226) and Streptococcus agalactiae (CMCC (B)) 32116 were extracted, respectively, and subjected to digital PCR amplification for specificity analysis.

The positive microdroplets for detecting the pathogenic microorganisms by the microdroplet digital PCR are all 0, which shows that the microdroplet digital PCR for detecting the micro ureaplasma, the human mycoplasma hominis, the chlamydia trachomatis, the Human Papilloma Virus (HPV), the human herpes virus (HSV), the neisseria gonorrhoeae and the streptococcus agalactiae has no non-specific amplification, and the specificity is 100%.

Repeatability: the method comprises the steps of respectively taking low-value and high-value samples of a national reference product, namely, the ureaplasma parvum serotype 1(Up1), repeating the experiment 3 times a day for 5 consecutive days, and calculating the CV value.

The low-value Up batch CV value of the microdroplet digital PCR detection micro ureaplasma is 3.38-4.98%, and the total CV value is 3.29%; the CV value in the high-value Up batch is 0.22 to 4.10 percent, and the total CV value is 6.36 percent

Pure cultures of ureaplasma parvum serotype 1(ATCC27813) were DNA extracted, stocks diluted 2-fold, 50,000-fold, digital PCR assayed and experiments repeated 3 times.

The stock solution has too many copies of target nucleic acid, and the 2-D fluorescence intensity graph shows that all the droplets are positive droplets and no negative droplets; the copy numbers of the stock solution diluted 2 times and 50,000 times were 8330 and 0.17 copies/. mu.l, respectively.

[ reportable range ]: the reportable range of the micro ureaplasma parvum detected by the micro-drop digital PCR is 0.17-8330 copies/mu l.

The lowest detection limit is: continuously diluting the national reference product of ureaplasma parvum serotype 1(Up1) by multiple times, requiring that the copy number of the sample can be detected after 10 times of continuous detection, and marking the average value +2Tolerance of the laser

Defined as the lowest detection limit. The minimum detection limit of the microdroplet digital PCR detection of the ureaplasma parvum is 1.42 copies/mu l.

Claims

1. A method for absolutely and quantitatively detecting ureaplasma parvum by using a droplet type digital PCR is characterized by comprising the following steps:

1) the primer and the probe for identifying the Ureaplasma parvum (Up) comprise a forward primer Up-F, a reverse primer Up-R and a probe sequence Up-P, and are characterized in that the sequence of the forward primer Up-F is as follows: 5 'AGCTGTTTATATATGGAACGAACAA 3' (1782nt-1806 nt);

the sequence of the reverse primer Up-R is as follows: 5 'TATCCAACTCGCTTAATTCAATT 3' (1863nt-1885 nt); the sequence of the probe sequence Up-P is as follows: 5 'TATCAATTAGTTTTGGCTTCT 3' (1822nt-1842 nt).

2) Preparing a ddPCR reaction solution for detecting the ureaplasma parvum by a micro-drop digital PCR;

3) and quantitatively detecting the content of the ureaplasma parvum in the sample to be detected.

2. The method of claim 1, wherein in the step 2), the reaction solution is 20. mu.l each, and each reaction solution contains the following components: mu.l of ddPCR premix, 900nM each for primers Up-F, Up-R, GAPDH-F, GAPDH-R, and 250nM each for probes Up-P and GAPDH-P.

3. The primer and probe for amplifying ureaplasma parvum as claimed in claim 1, wherein one end of the probe sequence Up-P has a first fluorescence reporter group, and the other end has a first fluorescence quencher group; the probe sequence GAPDH-P has a second fluorescent reporter group at one end and a second fluorescent quencher group at the other end.

4. The primer and probe for amplifying ureaplasma parvum as claimed in claim 1, wherein the first and second fluorescent reporter groups are selected from FAM, HEX, JOE, ROX, VIC, Texas Red, CY3 or CY 5; the first fluorescence quenching group and the second fluorescence quenching group are selected from TAMRA, BHQ1, BHQ2, MGB or NFQ.

5. The primer and probe for amplifying ureaplasma parvum as claimed in claim 1, wherein the first fluorescence reporter group is disposed at the 5 'end of the probe sequence Up-P, and the first fluorescence quencher group is disposed at the 3' end of the probe sequence Up-P; the second fluorescent reporter group is arranged at the 5 'end of the probe sequence GAPDH-P, and the second fluorescent quenching group is arranged at the 3' end of the probe sequence GAPDH-P.

6. The primer and the probe for amplifying the ureaplasma parvum as claimed in claim 1, wherein the first fluorescent reporter group and the second fluorescent reporter group are different; preferably, the first fluorescent reporter is FAM and the second fluorescent reporter is VIC.

7. The use of claim 1, wherein the sample to be tested is judged according to the following results of the kit: when the first fluorescence report group and the second fluorescence report group are both positive, the sample to be detected is positive in the ureaplasma micrum; and when the first fluorescent reporter group is negative and the second fluorescent reporter group is positive, the sample to be detected is negative to the ureaplasma micans.