CN111593144B - Urogenital system infection pathogen nucleic acid detection kit, application and method - Google Patents

Urogenital system infection pathogen nucleic acid detection kit, application and method Download PDF

Info

Publication number
CN111593144B
CN111593144B CN202010521877.0A CN202010521877A CN111593144B CN 111593144 B CN111593144 B CN 111593144B CN 202010521877 A CN202010521877 A CN 202010521877A CN 111593144 B CN111593144 B CN 111593144B
Authority
CN
China
Prior art keywords
std
reaction
sequence
probe
quality control
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010521877.0A
Other languages
Chinese (zh)
Other versions
CN111593144A (en
Inventor
王瑜新
程鲁向
程天龄
夏小凯
黄迎燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jienuo Biotechnology Co ltd
Original Assignee
Shanghai Geneodx Biotech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Geneodx Biotech Co ltd filed Critical Shanghai Geneodx Biotech Co ltd
Priority to CN202010521877.0A priority Critical patent/CN111593144B/en
Publication of CN111593144A publication Critical patent/CN111593144A/en
Application granted granted Critical
Publication of CN111593144B publication Critical patent/CN111593144B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a urogenital system infection pathogen nucleic acid detection kit, application and a method, comprising the following steps: the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent are independently stored, and distinguishing marks are arranged among the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent. The kit of the present invention is based on a single-tube multiplex technology, and can perform highly complex analysis of up to 12 target genes in a single PCR reaction. Can detect 5 kinds of bacteria (7 pathogens), 2 kinds of DNA viruses and 1 kind of parasites, and can detect the bacteria, the DNA viruses and the parasites more sensitively, specifically, quickly and simply and conveniently.

Description

Urogenital system infection pathogen nucleic acid detection kit, application and method
Technical Field
The invention belongs to the technical field of nucleic acid detection, and particularly relates to a urogenital system infection pathogen nucleic acid detection kit, application and a method.
Background
In recent years, the rapid development of molecular biology technology opens a window for the accurate identification of pathogenic bacteria at the molecular level. The PCR technology is adopted to detect the pathogen nucleic acid in the sample, so that the method is quick, simple, sensitive and specific, in-vitro culture is not needed, and the method has more advantages on the pathogens which are difficult to culture and can not be cultured. Common molecular detection means include ordinary PCR, nested PCR and fluorescent quantitative PCR. Singleplex PCR is the earliest established PCR method, amplifying against only a single pathogen target. However, clinical samples have a large variety of infection pathogens, mixed infection or repeated infection exists, and single pathogen detection or single species (viruses or bacteria) cannot reflect the real pathogen infection condition in the samples. If the multiple pathogens are detected one by one, not only is a great deal of manpower consumed, but also the detection time is prolonged as a whole. In order to meet the requirements of pathogen detection of clinical samples, various multiplex PCR detection methods are continuously established, namely, two or more pairs of primers are added into the same reaction system, and a plurality of target fragments are simultaneously amplified to achieve the purpose of simultaneously detecting a plurality of pathogens. The method has unique advantages and high practical value in the differential diagnosis of clinical mixed infection. Although the multiplex PCR detection method is qualitative detection, the development is mature, and a reaction system can keep higher specificity and positive coincidence rate after systematic optimization, so that the multiplex PCR detection method is suitable for wide clinical application.
At present, most of nucleic acid detection kits for pathogens of urogenital system on the market at home are single detection kits, and the few nucleic acid detection kits are double or triple detection kits, and no kit for simultaneously detecting 10 pathogens exists on the market. And no molecular method for detecting trichomonas vaginalis and treponema pallidum is available.
Disclosure of Invention
1. Technical problem to be solved by the invention
The invention aims to solve the problem that the existing urogenital system pathogen nucleic acid detection kit is difficult to detect 10 pathogens simultaneously.
2. Technical scheme
In order to achieve the purpose, the technical scheme provided by the invention is as follows:
the invention relates to a urogenital system infection pathogen nucleic acid detection kit, which comprises:
the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent are independently stored, and distinguishing marks are arranged among the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent.
Preferably, the STD reaction enzyme comprises Taq DNA polymerase, and at least two groups of STD reaction enzymes are provided, namely STD reaction enzyme 1 and STD reaction enzyme 2;
the STD primer comprises dNTPs and a primer;
the STD buffer solution comprises dNTPs, a primer and a fluorescent probe;
the STD internal quality control comprises M13;
the STD positive quality control comprises a plasmid;
the STD diluent comprises H2O。
Preferably, the primers comprise a first-step amplification forward primer of chlamydia trachomatis, a first-step amplification reverse primer of chlamydia trachomatis, a second-step amplification forward primer of chlamydia trachomatis and a second-step amplification reverse primer of chlamydia trachomatis, wherein the first-step amplification forward primer of chlamydia trachomatis, the second-step amplification forward primer of chlamydia trachomatis and the second-step amplification reverse primer of chlamydia trachomatis are respectively used for amplification of chlamydia trachomatis
The sequence of the first-step amplification forward primer of the chlamydia trachomatis is as follows:
GGGGTGTTGGTAGCTCCATC；
the sequence of the first-step amplification reverse primer of the chlamydia trachomatis is as follows:
TGCTTCCCTACATGCTCGTG；
the sequence of the second-step amplification forward primer of the chlamydia trachomatis is as follows:
GTGGCAGGGCGCTACGTACAAGTCACATCTTTCATACCT；
the sequence of the second-step amplification reverse primer of the chlamydia trachomatis is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACCTGATCGTAGCTGTCGATGCACTGATCGTATGCAACTTCCTTCTCTTCCTA。
preferably, the primers further comprise a Mycoplasma genitalium first-step amplification forward primer, a Mycoplasma genitalium first-step amplification reverse primer, a Mycoplasma genitalium second-step amplification forward primer and a Mycoplasma genitalium second-step amplification reverse primer, wherein
The sequence of the forward primer for the first amplification step of the mycoplasma genitalium is as follows:
CAAGTACAACACTTAACTCTA；
the sequence of the Mycoplasma genitalium first-step amplification reverse primer is as follows:
CAGCTCATGGTGAATTGAAAAGA；
the sequence of the second-step amplification forward primer of the mycoplasma genitalium is as follows:
GTGGCAGGGCGCTACGTACAAGTGACATCCCATTAAGTTTG；
the second-step amplification reverse primer sequence of the mycoplasma genitalium is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGACTACGATCGATCACACAATCAATCGATGCTAACAGTTCATG。
preferably, the primers further comprise a first-step amplification forward primer of neisseria gonorrhoeae, a first-step amplification reverse primer of neisseria gonorrhoeae, a second-step amplification forward primer of neisseria gonorrhoeae and a second-step amplification reverse primer of neisseria gonorrhoeae, wherein the primers comprise a primer pair, a primer pair and a primer pair
The sequence of the first step amplification forward primer of the neisseria gonorrhoeae is as follows:
ACGCTTGTCCCGGATTCTTT；
the sequence of the first step amplification reverse primer of the neisseria gonorrhoeae is as follows:
TATCTGCATGGAGGCAACGG；
the sequence of the second step amplification forward primer of the neisseria gonorrhoeae is as follows:
GTGGCAGGGCGCTACGTACAAGTTAGATGATGAAACAATACG；
the sequence of the neisseria gonorrhoeae second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACGACATCAGCACGATCGGCATGCGGCAAAAGATGAAGAAG。
preferably, the primers further comprise a first-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain, a first-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain, a second-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain and a second-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain, wherein the primers further comprise a first-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain, a second-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain and a second-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain, and the first-step amplification reverse primer and the second-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain are respectively
The sequence of the first-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GAACAGCGGCGCAACCGT；
the sequence of the first-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GGCCATAACCGAAAGACATGG；
the sequence of the second-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GTGGCAGGGCGCTACGTACAAGCTACCGTACAAGATACC；
the sequence of the second-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAAGCTACGACCATCAGCTAGTACGCCAGCTTCTCAACAAACCT。
preferably, the primers further comprise a Mycoplasma urealyticum first-step amplification forward primer, a Mycoplasma urealyticum first-step amplification reverse primer, a Mycoplasma urealyticum second-step amplification forward primer and a Mycoplasma urealyticum second-step amplification reverse primer, wherein
The sequence of the first-step amplification forward primer of the mycoplasma urealyticum is as follows:
GGCGGGGGTTATGTATCTGG；
the sequence of the reverse primer of the first amplification step of the mycoplasma urealyticum is as follows:
TCCATTCGTGATACCCCAAAT；
the sequence of the second-step amplification forward primer of the mycoplasma urealyticum is as follows:
GTGGCAGGGCGCTACGTACAATATTATGACAATAAATTGGTTT；
the sequence of the second-step amplification reverse primer of the mycoplasma urealyticum is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAAGCATCACCGATCAGCATGGTACGTCCTTAACTAAATCACGAAT。
preferably, the primers further comprise a forward primer for herpes simplex virus type 2 first-step amplification, a reverse primer for herpes simplex virus type 2 first-step amplification, a forward primer for herpes simplex virus type 2 second-step amplification and a reverse primer for herpes simplex virus type 2 second-step amplification, wherein
The sequence of the forward primer for the first step of herpes simplex virus type 2 amplification is as follows:
ATCGGCGGTATTGCGTTTTG；
the sequence of the first-step amplification reverse primer of the herpes simplex virus type 2 is as follows:
GGGTAGTGAAACAGCTCGATGAT；
the sequence of the second-step amplification forward primer of the herpes simplex virus type 2 is as follows:
GTGGCAGGGCGCTACGTACAACTGGTCTCAGACTCACTC；
the sequence of the herpes simplex virus type 2 second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACCTGATCGTAGCTGTCGATGCACTGATCGTATGCCCCCACAAAATGAAGCTC。
preferably, the primers further comprise a Trichomonas vaginalis first-step amplification forward primer, a Trichomonas vaginalis first-step amplification reverse primer, a Trichomonas vaginalis second-step amplification forward primer and a Trichomonas vaginalis second-step amplification reverse primer, wherein
The sequence of the first-step amplification forward primer of the trichomonas vaginalis is as follows:
TGAAGCCGCCAAGATTGCTA；
the sequence of the first-step amplification reverse primer of the trichomonas vaginalis is as follows:
TAACGAGGCAAGCGACGTTA；
the sequence of the second step of the Trichomonas vaginalis amplification forward primer is as follows:
GTGGCAGGGCGCTACGTACAACTCCAAGTTCAACTTCGA；
the sequence of the trichomonas vaginalis second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGACATGCCTAATGGTCCGAGTGGGACGTAGTTAAG。
preferably, the primers further comprise a Treponema pallidum first-step amplification forward primer, a Treponema pallidum first-step amplification reverse primer, a Treponema pallidum second-step amplification forward primer and a Treponema pallidum second-step amplification reverse primer, wherein
The sequence of the first step amplification forward primer of the treponema pallidum is as follows:
GGTACTTGCGGGCATGGTAT；
the sequence of the first amplification reverse primer of the treponema pallidum is as follows:
GTTTCCACAGCTGGGCAAAG；
the sequence of the second step amplification forward primer of the treponema pallidum is as follows:
GTGGCAGGGCGCTACGTACAAGCACTACCAATAGTCTGA；
the sequence of the second-step amplification reverse primer of the treponema pallidum is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGAGCACATCGATGTACTGTCCGTGCCGTTGAGCTTTTAGAAG。
preferably, the primers further comprise a first-step amplification forward primer of the chlamydia trachomatis LGV variant, a first-step amplification reverse primer of the chlamydia trachomatis LGV variant, a second-step amplification forward primer of the chlamydia trachomatis LGV variant and a second-step amplification reverse primer of the chlamydia trachomatis LGV variant, wherein the primers are used for amplification of the chlamydia trachomatis LGV variant and the second-step amplification reverse primer of the chlamydia trachomatis LGV variant, and the primers are used for amplification of the chlamydia trachomatis LGV variant and the second-step amplification reverse primer of the chlamydia trachomatis LGV variant
The sequence of the forward primer for the first-step amplification of the chlamydia trachomatis LGV variant is as follows:
TGCCTTTTTCTTTGAGATCTACATCA；
the sequence of the first-step amplification reverse primer of the chlamydia trachomatis LGV variant is as follows:
AGTGTCTCTCCTGCTGAAATGA；
the sequence of the second-step amplification forward primer of the chlamydia trachomatis LGV variant is as follows:
GTGGCAGGGCGCTACGTACAAGGTTCTTGTCGGTGTATC；
the sequence of the second-step amplification reverse primer of the chlamydia trachomatis LGV variant is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGAAACTACGATCGATGTCATGACCTCCAGTCCGATACTTG。
preferably, the primers further comprise a first amplification forward primer of bacteriophage M13, a first amplification reverse primer of bacteriophage M13, a second amplification forward primer of bacteriophage M13, and a second amplification reverse primer of bacteriophage M13, wherein
The sequence of the phage M13 first-step amplification forward primer is:
TGTTGGAGTTTGCTTCCGGT；
the first amplification reverse primer of the bacteriophage M13 has the following sequence:
TTAATCATTGTGAATTACCTTATGCGA；
the sequence of the second amplification forward primer of the bacteriophage M13 is as follows:
GTGGCAGGGCGCTACGTACAAGGTTATGATAGTGTTGCT；
the second amplification reverse primer of the bacteriophage M13 has the following sequence:
GGACGCGCCAGCAAGATCCAATCTAGAACGACTACGATCAATCGACTACGTTACGTGGCCATTATACCAGTCAGGAC。
preferably, the primers further comprise a forward primer for the first step amplification of herpes simplex virus type 1 and a reverse primer for the first step amplification of herpes simplex virus type 1, wherein
The sequence of the forward primer for the first step of herpes simplex virus 1 amplification is as follows:
CGTCTGTGGTGTTTTTGGCA；
the sequence of the first-step amplification reverse primer of the herpes simplex virus type 1 is as follows:
GGCAGTGAGGAACGAGAACA。
preferably, the probe comprises a chlamydia trachomatis probe, the 3' label of the chlamydia trachomatis probe is ROX, the melting temperature of the chlamydia trachomatis probe is 79 ℃, and the sequence of the chlamydia trachomatis probe is GCATACGATCAGTGCATCGACAGCTACGATCAGGT.
Preferably, the probe further comprises a Mycoplasma genitalium probe, the 3' of which is labeled ROX, the melting temperature of which is 60.2 ℃, and the sequence of which is ATTGATTGTGTGATCGATCGTAGTC.
Preferably, the probe also comprises a Neisseria gonorrhoeae probe, the 3' label of the Neisseria gonorrhoeae probe is ROX, the melting temperature of the Neisseria gonorrhoeae probe is 69 ℃, and the sequence of the Neisseria gonorrhoeae probe is CATGCCGATCGTGCTGATGTCGT.
Preferably, the probe also comprises a neisseria gonorrhoeae drug-resistant strain probe, the 3' label of the neisseria gonorrhoeae drug-resistant strain probe is Cy5, the melting temperature of the neisseria gonorrhoeae drug-resistant strain probe is 63 ℃, and the sequence of the neisseria gonorrhoeae drug-resistant strain probe is GCGTACTAGCTGATGGTCGTAGCT.
Preferably, the probe further comprises a Mycoplasma urealyticum probe, the 3' label of the Mycoplasma urealyticum probe is Cy5, the melting temperature of the Mycoplasma urealyticum probe is 68.5 ℃, and the sequence of the Mycoplasma urealyticum probe is ACGTACCATGCTGATCGGTGATGCT.
Preferably, the probe also comprises a herpes simplex virus 2 type probe, the 3' label of the herpes simplex virus 2 type probe is Cy5, the melting temperature of the herpes simplex virus 2 type probe is 79 ℃, and the sequence of the herpes simplex virus 2 type probe is TAATGCACGTCGCAGCATGAACACGAGCTGTTCAG.
Preferably, the probe also comprises a trichomonas vaginalis probe, the 3' label of the trichomonas vaginalis probe is Cy5, the melting temperature of the trichomonas vaginalis probe is 73 ℃, and the sequence of the trichomonas vaginalis probe is GGACCATTAGGCATGTCTAGATTGGATCTTGCTGGCGCG.
Preferably, the probe also comprises a treponema pallidum probe, the 3' label of the treponema pallidum probe is ROX, the melting temperature of the treponema pallidum probe is 65.2 ℃, and the sequence of the treponema pallidum probe is CACGGACAGTACATCGATGTGCTC.
Preferably, the probe further comprises a chlamydia trachomatis LGV variant probe, the 3' label of the chlamydia trachomatis LGV variant probe is Cy5, the melting temperature of the chlamydia trachomatis LGV variant probe is 52.7 ℃, and the sequence of the chlamydia trachomatis LGV variant probe is GGACCATTAGGCATG.
Preferably, the probe also comprises a herpes simplex virus 1 type probe, the 3' label of the herpes simplex virus 1 type probe is ROX, the melting temperature of the herpes simplex virus 1 type probe is 55.2 ℃, and the sequence of the herpes simplex virus 1 type probe is TCATGACATCGATCGTAGTTTC.
Preferably, the probe further comprises a phage M13 probe, the 3' label of the phage M13 probe is FAM, the melting temperature of the phage M13 probe is 73 ℃, and the sequence of the phage M13 probe is GCCACGTAACGTAGTCGATTGATCGTAGTCGT.
Preferably, the probe further comprises an amplification quality control probe, the 3' label of the amplification quality control probe is FAM, the melting temperature of the amplification quality control probe is 58.5 ℃, and the sequence of the amplification quality control probe is GTGGTCTTCGCCCAGAAGCTG.
The urogenital infection pathogen nucleic acid detection kit is applied to detection of diseases such as Lymphogranuloma (LGV) variant, mycoplasma genitalium, Neisseria gonorrhoeae including Neisseria gonorrhoeae strains and Neisseria gonorrhoeae embedded penA genes (drug-resistant strains), treponema pallidum, ureaplasma urealyticum, herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2) and trichomonas vaginalis caused by C.trachomatis including C.trachomatis serotypes D-K and L serotypes.
A detection method of a urogenital infection pathogen nucleic acid detection kit comprises the following specific steps:
s100, preparing a first-step reaction product, taking the STD reaction enzyme 1 and the STD primer out of the kit, melting at room temperature, shaking and uniformly mixing, centrifuging for 10 seconds, calculating the reaction number n [ n ═ sample number + negative control + positive control ], and subpackaging 15 mu l/portion into a PCR reaction tube/plate, wherein the STD reaction enzyme 1 is 1 mu l, and the STD primer is 14 mu l;
s200, sample adding at one time, taking out the STD positive quality control from the kit, melting at room temperature, shaking and mixing uniformly, centrifuging for 10 seconds, adding 10 mu l of extracted nucleic acid sample (including negative control) and the STD positive quality control into the PCR tube obtained in the step S100, covering a tube cover or sealing a membrane after sample adding, immediately shaking and mixing uniformly, centrifuging for a short time, and placing on ice;
s300, setting a fluorescence channel, and respectively setting detection channels FAM, ROX and Cy5 in a PCR instrument, wherein the excitation wavelength of the detection channel FAM is 465nm, the detection wavelength is 510nm, the excitation wavelength of the detection channel ROX is 465nm, the detection wavelength is 610nm, the excitation wavelength of the detection channel Cy5 is 465nm, and the detection wavelength is 660 nm;
s400, preparing a reaction product in the second step, taking out an STD buffer solution from the kit, melting at room temperature, uniformly mixing by oscillation, centrifuging for 10 seconds, taking out the STD reaction enzyme 2 from the kit, calculating the reaction number n [ n ═ sample number + negative control + positive control ], mixing and subpackaging into a PCR reaction tube/plate according to 19 mu l of the STD buffer solution and 1 mu l of the STD reaction enzyme 2;
s500, adding samples for the second time, taking out 5ul of the reaction product of the first step, adding the reaction product into the PCR reaction tube obtained in the step S400, sealing the tube opening, and then vibrating uniformly;
s600, PCR analysis, namely placing the PCR reaction tube obtained in the step S500 into
Figure BDA0002532425600000101
A PCR instrument and an operation instrument;
s700, analyzing results, selecting ROX (465) -610 and Cy5 (465) -660), and analyzing ROX and Cy5 channels of the sample reaction system. Comparing with negative control, if there is a specific peak, judging the pathogen type according to the Tm value thereof with reference to the following table; if there is no specific peak, it indicates that the pathogen corresponding to the ROX channel of the reaction system in the following table is not detected.
3. Advantageous effects
Compared with the prior art, the technical scheme provided by the invention has the following beneficial effects:
the invention relates to a urogenital system infection pathogen nucleic acid detection kit, which comprises: the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent are independently stored, and distinguishing marks are arranged among the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent. The kit of the present invention is based on a single-tube multiplex technology, and can perform highly complex analysis of up to 12 target genes in a single PCR reaction. The assay contains 12 different sets of 2SMART primers and 12 fluorescently labeled SMART probes, which allow detection of 10 different pathogens as well as internal quality control and amplification quality control. After pre-amplification, a portion of the pre-amplification reaction product was transferred to a PCR tube for reaction and detection by melting curve analysis. Can detect 5 bacteria (7 pathogens), 2 DNA viruses and 1 parasite, which can cause the transmission infection of human urogenital system, and can detect more sensitively, specifically, rapidly and simply.
Drawings
FIG. 1 is a sequence listing of the first step amplification primers for the pathogens and internal quality control of the present invention;
FIG. 2 is a sequence listing of the second step amplification primers for the pathogens and internal quality control of the present invention;
FIG. 3 is a sequence listing of probes for pathogens and internal controls of the invention.
Detailed Description
In order to facilitate an understanding of the invention, the invention will now be described more fully hereinafter with reference to the accompanying drawings, in which several embodiments of the invention are shown, but which may be embodied in many different forms and are not limited to the embodiments described herein, but rather are provided for the purpose of providing a more thorough disclosure of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; the terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention; as used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
Example 1
Referring to fig. 1-2, the nucleic acid detection kit for pathogens of urogenital infection of the present embodiment comprises:
the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent are independently stored, and distinguishing marks are arranged among the STD reaction enzyme, the STD primer, the STD buffer solution, the STD internal quality control, the STD positive quality control and the STD diluent.
Specifically, the STD reaction enzyme comprises Taq DNA polymerase, and at least two groups of STD reaction enzymes are provided, namely STD reaction enzyme 1 and STD reaction enzyme 2;
the STD primer comprises dNTPs and a primer;
the STD buffer solution comprises dNTPs, a primer and a fluorescent probe;
the STD internal quality control comprises M13;
the STD positive quality control comprises a plasmid;
the STD diluent comprises H2O。
The primers of this example include a first-step amplification forward primer for Chlamydia trachomatis, a first-step amplification reverse primer for Chlamydia trachomatis, a second-step amplification forward primer for Chlamydia trachomatis, and a second-step amplification reverse primer for Chlamydia trachomatis, wherein the first-step amplification forward primer for Chlamydia trachomatis, the second-step amplification reverse primer for Chlamydia trachomatis
The sequence of the first-step amplification forward primer of the chlamydia trachomatis is as follows:
GGGGTGTTGGTAGCTCCATC；
the sequence of the first-step amplification reverse primer of the chlamydia trachomatis is as follows:
TGCTTCCCTACATGCTCGTG；
the sequence of the second-step amplification forward primer of the chlamydia trachomatis is as follows:
GTGGCAGGGCGCTACGTACAAGTCACATCTTTCATACCT；
the sequence of the second-step amplification reverse primer of the chlamydia trachomatis is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACCTGATCGTAGCTGTCGATGCACTGATCGTATGCAACTTCCTTCTCTTCCTA。
the primers of this example also include a Mycoplasma genitalium first-step amplification forward primer, a Mycoplasma genitalium first-step amplification reverse primer, a Mycoplasma genitalium second-step amplification forward primer, and a Mycoplasma genitalium second-step amplification reverse primer, where
The sequence of the forward primer for the first amplification step of the mycoplasma genitalium is as follows:
CAAGTACAACACTTAACTCTA；
the sequence of the Mycoplasma genitalium first-step amplification reverse primer is as follows:
CAGCTCATGGTGAATTGAAAAGA；
the sequence of the second-step amplification forward primer of the mycoplasma genitalium is as follows:
GTGGCAGGGCGCTACGTACAAGTGACATCCCATTAAGTTTG；
the second-step amplification reverse primer sequence of the mycoplasma genitalium is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGACTACGATCGATCACACAATCAATCGATGCTAACAGTTCATG。
the primers of this embodiment further comprise a first step N.gonorrhoeae amplification forward primer, a first step N.gonorrhoeae amplification reverse primer, a second step N.gonorrhoeae amplification forward primer and a second step N.gonorrhoeae amplification reverse primer, wherein
The sequence of the first step amplification forward primer of the neisseria gonorrhoeae is as follows:
ACGCTTGTCCCGGATTCTTT；
the sequence of the first step amplification reverse primer of the neisseria gonorrhoeae is as follows:
TATCTGCATGGAGGCAACGG；
the sequence of the second step amplification forward primer of the neisseria gonorrhoeae is as follows:
GTGGCAGGGCGCTACGTACAAGTTAGATGATGAAACAATACG；
the sequence of the neisseria gonorrhoeae second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACGACATCAGCACGATCGGCATGCGGCAAAAGATGAAGAAG。
the primers of this embodiment further comprise a first-step amplification forward primer for a neisseria gonorrhoeae drug-resistant strain, a first-step amplification reverse primer for a neisseria gonorrhoeae drug-resistant strain, a second-step amplification forward primer for a neisseria gonorrhoeae drug-resistant strain, and a second-step amplification reverse primer for a neisseria gonorrhoeae drug-resistant strain, wherein
The sequence of the first-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GAACAGCGGCGCAACCGT；
the sequence of the first-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GGCCATAACCGAAAGACATGG；
the sequence of the second-step amplification forward primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GTGGCAGGGCGCTACGTACAAGCTACCGTACAAGATACC；
the sequence of the second-step amplification reverse primer of the neisseria gonorrhoeae drug-resistant strain is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAAGCTACGACCATCAGCTAGTACGCCAGCTTCTCAACAAACCT。
the primers of this example also include a Mycoplasma urealyticum first-step amplification forward primer, a Mycoplasma urealyticum first-step amplification reverse primer, a Mycoplasma urealyticum second-step amplification forward primer, and a Mycoplasma urealyticum second-step amplification reverse primer, wherein
The sequence of the first-step amplification forward primer of the mycoplasma urealyticum is as follows:
GGCGGGGGTTATGTATCTGG；
the sequence of the reverse primer of the first amplification step of the mycoplasma urealyticum is as follows:
TCCATTCGTGATACCCCAAAT；
the sequence of the second-step amplification forward primer of the mycoplasma urealyticum is as follows:
GTGGCAGGGCGCTACGTACAATATTATGACAATAAATTGGTTT；
the sequence of the second-step amplification reverse primer of the mycoplasma urealyticum is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAAGCATCACCGATCAGCATGGTACGTCCTTAACTAAATCACGAAT。
the primers of the embodiment further comprise a forward primer for first-step amplification of herpes simplex virus type 2, a reverse primer for first-step amplification of herpes simplex virus type 2, a forward primer for second-step amplification of herpes simplex virus type 2 and a reverse primer for second-step amplification of herpes simplex virus type 2, wherein
The sequence of the forward primer for the first step of herpes simplex virus type 2 amplification is as follows:
ATCGGCGGTATTGCGTTTTG；
the sequence of the first-step amplification reverse primer of the herpes simplex virus type 2 is as follows:
GGGTAGTGAAACAGCTCGATGAT；
the sequence of the second-step amplification forward primer of the herpes simplex virus type 2 is as follows:
GTGGCAGGGCGCTACGTACAACTGGTCTCAGACTCACTC；
the sequence of the herpes simplex virus type 2 second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAACCTGATCGTAGCTGTCGATGCACTGATCGTATGCCCCCACAAAATGAAGCTC。
the primers of the embodiment also comprise a Trichomonas vaginalis first-step amplification forward primer, a Trichomonas vaginalis first-step amplification reverse primer, a Trichomonas vaginalis second-step amplification forward primer and a Trichomonas vaginalis second-step amplification reverse primer, wherein
The sequence of the first-step amplification forward primer of the trichomonas vaginalis is as follows:
TGAAGCCGCCAAGATTGCTA；
the sequence of the first-step amplification reverse primer of the trichomonas vaginalis is as follows:
TAACGAGGCAAGCGACGTTA；
the sequence of the second step of the Trichomonas vaginalis amplification forward primer is as follows:
GTGGCAGGGCGCTACGTACAACTCCAAGTTCAACTTCGA；
the sequence of the trichomonas vaginalis second-step amplification reverse primer is as follows:
GGACGCGCCAGCAAGATCCAATCTAGACATGCCTAATGGTCCGAGTGGGACGTAGTTAAG。
the primers of this example further include a Treponema pallidum first-step amplification forward primer, a Treponema pallidum first-step amplification reverse primer, a Treponema pallidum second-step amplification forward primer, and a Treponema pallidum second-step amplification reverse primer, wherein
The sequence of the first step amplification forward primer of the treponema pallidum is as follows:
GGTACTTGCGGGCATGGTAT；
the sequence of the first amplification reverse primer of the treponema pallidum is as follows:
GTTTCCACAGCTGGGCAAAG；
the sequence of the second step amplification forward primer of the treponema pallidum is as follows:
GTGGCAGGGCGCTACGTACAAGCACTACCAATAGTCTGA；
the sequence of the second-step amplification reverse primer of the treponema pallidum is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGAGCACATCGATGTACTGTCCGTGCCGTTGAGCTTTTAGAAG。
the primers of this example also include a first-step amplification forward primer for a variant of Chlamydia trachomatis LGV, a first-step amplification reverse primer for a variant of Chlamydia trachomatis LGV, a second-step amplification forward primer for a variant of Chlamydia trachomatis LGV, and a second-step amplification reverse primer for a variant of Chlamydia trachomatis LGV, wherein
The sequence of the forward primer for the first-step amplification of the chlamydia trachomatis LGV variant is as follows:
TGCCTTTTTCTTTGAGATCTACATCA；
the sequence of the first-step amplification reverse primer of the chlamydia trachomatis LGV variant is as follows:
AGTGTCTCTCCTGCTGAAATGA；
the sequence of the second-step amplification forward primer of the chlamydia trachomatis LGV variant is as follows:
GTGGCAGGGCGCTACGTACAAGGTTCTTGTCGGTGTATC；
the sequence of the second-step amplification reverse primer of the chlamydia trachomatis LGV variant is as follows:
GGACGCGCCAGCAAGATCCAATCTAGAGAAACTACGATCGATGTCATGACCTCCAGTCCGATACTTG。
the primers of this example also included a phage M13 first-step amplification forward primer, a phage M13 first-step amplification reverse primer, a phage M13 second-step amplification forward primer, and a phage M13 second-step amplification reverse primer, where
The sequence of the phage M13 first-step amplification forward primer is:
TGTTGGAGTTTGCTTCCGGT；
the first amplification reverse primer of the bacteriophage M13 has the following sequence:
TTAATCATTGTGAATTACCTTATGCGA；
the sequence of the second amplification forward primer of the bacteriophage M13 is as follows:
GTGGCAGGGCGCTACGTACAAGGTTATGATAGTGTTGCT；
the second amplification reverse primer of the bacteriophage M13 has the following sequence:
GGACGCGCCAGCAAGATCCAATCTAGAACGACTACGATCAATCGACTACGTTACGTGGCCATTATACCAGTCAGGAC。
the primers of this example also include a forward primer for the first step of amplification of herpes simplex virus type 1 and a reverse primer for the first step of amplification of herpes simplex virus type 1, wherein
The sequence of the forward primer for the first step of herpes simplex virus 1 amplification is as follows:
CGTCTGTGGTGTTTTTGGCA；
the sequence of the first-step amplification reverse primer of the herpes simplex virus type 1 is as follows:
GGCAGTGAGGAACGAGAACA。
the probe of this example comprises a Chlamydia trachomatis probe, the 3' label of which is ROX, the melting temperature of which is 79 ℃ and the sequence of which is GCATACGATCAGTGCATCGACAGCTACGATCAGGT.
The probe of the embodiment also comprises a Mycoplasma genitalium probe, the 3' of which is marked as ROX, the melting temperature of which is 60.2 ℃, and the sequence of which is ATTGATTGTGTGATCGATCGTAGTC.
The probe of the embodiment also comprises a Neisseria gonorrhoeae probe, the 3' label of the Neisseria gonorrhoeae probe is ROX, the melting temperature of the Neisseria gonorrhoeae probe is 69 ℃, and the sequence of the Neisseria gonorrhoeae probe is CATGCCGATCGTGCTGATGTCGT.
The probe of the embodiment also comprises a neisseria gonorrhoeae drug-resistant strain probe, the 3' label of the neisseria gonorrhoeae drug-resistant strain probe is Cy5, the melting temperature of the neisseria gonorrhoeae drug-resistant strain probe is 63 ℃, and the sequence of the neisseria gonorrhoeae drug-resistant strain probe is GCGTACTAGCTGATGGTCGTAGCT.
The probe of the embodiment also comprises a mycoplasma urealytium probe, the 3' label of the mycoplasma urealytium probe is Cy5, the melting temperature of the mycoplasma urealytium probe is 68.5 ℃, and the sequence of the mycoplasma urealytium probe is ACGTACCATGCTGATCGGTGATGCT.
The probe of the embodiment also comprises a herpes simplex virus 2 type probe, the 3' label of the herpes simplex virus 2 type probe is Cy5, the melting temperature of the herpes simplex virus 2 type probe is 79 ℃, and the sequence of the herpes simplex virus 2 type probe is TAATGCACGTCGCAGCATGAACACGAGCTGTTCAG.
The probe of the embodiment also comprises a trichomonas vaginalis probe, the 3' label of the trichomonas vaginalis probe is Cy5, the melting temperature of the trichomonas vaginalis probe is 73 ℃, and the sequence of the trichomonas vaginalis probe is GGACCATTAGGCATGTCTAGATTGGATCTTGCTGGCGCG.
The probe of the embodiment also comprises a treponema pallidum probe, the 3' label of the treponema pallidum probe is ROX, the melting temperature of the treponema pallidum probe is 65.2 ℃, and the sequence of the treponema pallidum probe is CACGGACAGTACATCGATGTGCTC.
The probes of this example also included a Chlamydia trachomatis LGV variant probe, 3' of which was labeled as Cy5, which had a melting temperature of 52.7 ℃ and a sequence of GGACCATTAGGCATG.
The probe of the embodiment also comprises a herpes simplex virus 1 type probe, the 3' label of the herpes simplex virus 1 type probe is ROX, the melting temperature of the herpes simplex virus 1 type probe is 55.2 ℃, and the sequence of the herpes simplex virus 1 type probe is TCATGACATCGATCGTAGTTTC.
The probe of the present example further comprises a phage M13 probe, the 3' label of the phage M13 probe is FAM, the melting temperature of the phage M13 probe is 73 ℃, and the sequence of the phage M13 probe is GCCACGTAACGTAGTCGATTGATCGTAGTCGT.
The probe of the embodiment also comprises an amplification quality control probe, wherein the 3' label of the amplification quality control probe is FAM, the melting temperature of the amplification quality control probe is 58.5 ℃, and the sequence of the amplification quality control probe is GTGGTCTTCGCCCAGAAGCTG.
The embodiment also comprises the application of the urogenital infection pathogen nucleic acid detection kit in detecting diseases such as Lymphogranuloma (LGV) variant, mycoplasma genitalium, Neisseria gonorrhoeae including Neisseria gonorrhoeae strains and Neisseria gonorrhoeae embedded penA genes (drug-resistant strains), treponema pallidum, ureaplasma urealyticum, herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2) and trichomonas vaginalis caused by chlamydia trachomatis including serological D-K and L serotypes.
The detection method of the urogenital infection pathogen nucleic acid detection kit comprises the following specific steps:
s100, preparing a first-step reaction product, taking the STD reaction enzyme 1 and the STD primer out of the kit, melting at room temperature, shaking and uniformly mixing, centrifuging for 10 seconds, calculating the reaction number n [ n ═ sample number + negative control + positive control ], and subpackaging 15 mu l/portion into a PCR reaction tube/plate, wherein the STD reaction enzyme 1 is 1 mu l, and the STD primer is 14 mu l;
s200, sample adding at one time, taking out the STD positive quality control from the kit, melting at room temperature, shaking and mixing uniformly, centrifuging for 10 seconds, adding 10 mu l of extracted nucleic acid sample (including negative control) and the STD positive quality control into the PCR tube obtained in the step S100, covering a tube cover or sealing a membrane after sample adding, immediately shaking and mixing uniformly, centrifuging for a short time, and placing on ice;
s300, setting a fluorescence channel, and respectively setting detection channels FAM, ROX and Cy5 in a PCR instrument, wherein the excitation wavelength of the detection channel FAM is 465nm, the detection wavelength is 510nm, the excitation wavelength of the detection channel ROX is 465nm, the detection wavelength is 610nm, the excitation wavelength of the detection channel Cy5 is 465nm, and the detection wavelength is 660 nm;
s400, preparing a reaction product in the second step, taking out an STD buffer solution from the kit, melting at room temperature, uniformly mixing by oscillation, centrifuging for 10 seconds, taking out the STD reaction enzyme 2 from the kit, calculating the reaction number n [ n ═ sample number + negative control + positive control ], mixing and subpackaging into a PCR reaction tube/plate according to 19 mu l of the STD buffer solution and 1 mu l of the STD reaction enzyme 2;
s500, adding samples for the second time, taking out 5ul of the reaction product of the first step, adding the reaction product into the PCR reaction tube obtained in the step S400, sealing the tube opening, and then vibrating uniformly;
s600, PCR analysis, namely placing the PCR reaction tube obtained in the step S500 into
Figure BDA0002532425600000201
A PCR instrument and an operation instrument;
s700, analyzing results, selecting ROX (465) -610 and Cy5 (465) -660), and analyzing ROX and Cy5 channels of the sample reaction system. Comparing with negative control, if there is a specific peak, judging the pathogen type according to the Tm value thereof with reference to the following table; if there is no specific peak, it indicates that the pathogen corresponding to the ROX channel of the reaction system in the following table is not detected.
Figure BDA0002532425600000211
The pathogen nucleic acid detection kit is based on a single-tube multiplex technology, and can carry out highly complex analysis on up to 12 target genes in a single PCR reaction. The assay contains 12 different sets of 2SMART primers and 12 fluorescently labeled SMART probes, which allow detection of 10 different pathogens as well as internal quality control and amplification quality control. After pre-amplification, a portion of the pre-amplification reaction product was transferred to a PCR tube for reaction. And analyzing and detecting a melting curve.
Internal Control (IC) quality control distinguishes false negative results from true negatives due to nucleic acid degradation, PCR inhibitors or test failure. STD-
Figure BDA0002532425600000212
2SMART additionally contains an amplification quality control (AC) and can also distinguish between extraction failures and amplification failures in the assay.
Example 2
The urogenital system infection pathogen nucleic acid detection kit is used for detecting the limit of detection (LOD) of a urine sample
The specific procedure was the addition of viral and bacterial genomic DNA in dilution series to the urine of asymptomatic healthy volunteers. All samples were used
Figure BDA0002532425600000223
The medium blood nucleic acid extraction kit is used for manual extraction. The kit is used for analyzing the detection results of 20 times. The results were determined from the detection rate (. gtoreq.95% detection rate was defined as the lowest detection limit for each pathogen). The minimum detection limit for all pathogens in a urine test is summarized in the following table. By using QX200TMDroplet DigitalTMThe LOD was calculated by PCR and Bio-Rad for absolute copy number.
Ten pathogen minimum detection limits of urine sample
Figure BDA0002532425600000221
Example 3
The urogenital infection pathogen nucleic acid detection kit is used for detecting urinary secretion, cervical, vaginal, oropharyngeal and rectal swab samples. The detection process is as follows:
swab samples obtained from asymptomatic healthy volunteers using standard sterile cotton swabs and suspended in 1mL UTM, serial and bacterial genomic DNA diluted with virus. Use of
Figure BDA0002532425600000222
A small amount of blood nucleic acid extraction kit was used for manual extraction of DNA. The kit is used for detection, and the detection result is analyzed 20 times, namelyThe rate was determined (detection rate of 95% or more was defined as the lowest detection limit for each pathogen). Summary the minimum detection limit for all pathogens in the swab samples is given in the table below. By using QX200TMDroplet DigitalTMThe LOD was calculated by PCR and Bio-Rad for absolute copy number.
Minimum detection limit of ten pathogens for swab samples
Figure BDA0002532425600000231
The above-mentioned embodiments only express a certain implementation mode of the present invention, and the description thereof is specific and detailed, but not construed as limiting the scope of the present invention; it should be noted that, for those skilled in the art, without departing from the concept of the present invention, several variations and modifications can be made, which are within the protection scope of the present invention; therefore, the protection scope of the present patent shall be subject to the appended claims.

Claims (5)

1. A urogenital infection pathogen nucleic acid detection kit, comprising: an STD first-step primer group, an STD second-step primer group and an STD fluorescent probe group,
wherein the STD first step primer group consists of the following primers:
Figure FDA0003164623260000011
wherein, the STD second-step primer group consists of the following primers:
Figure FDA0003164623260000012
Figure FDA0003164623260000021
wherein the STD fluorescent probe set consists of the following probes:
Figure FDA0003164623260000022
Figure FDA0003164623260000031
the neisseria gonorrhoeae drug-resistant strain is neisseria gonorrhoeae embedded with penA genes.
2. The urogenital infection pathogen nucleic acid detection kit of claim 1, wherein: and also comprising separate storage
STD reaction enzyme 1, STD reaction enzyme 2, an STD first-step primer group, an STD buffer solution containing an STD second-step primer group and an STD fluorescent probe group, STD internal quality control, STD positive quality control and an STD diluent; the STD internal quality control is phage M13; and each component is provided with a distinguishing mark.
3. The urogenital infection pathogen nucleic acid detection kit of claim 2, wherein:
the STD reaction enzyme 1 and the STD reaction enzyme 2 are Taq DNA polymerase;
the STD first step primer group and the STD buffer solution contain dNTPs;
the STD positive quality control is plasmid and is used as a positive control;
the STD diluent is H2O, as a negative control.
4. Use of a urogenital infection pathogen nucleic acid detection kit of any of claims 1-3 for the detection of chlamydia trachomatis including LGV variants of chlamydia trachomatis, mycoplasma genitalium, neisseria gonorrhoeae including neisseria gonorrhoeae embedded penA gene resistant strains, treponema pallidum, ureaplasma urealyticum, herpes simplex virus type 1 and trichomonas vaginalis, said use being non-disease diagnostic therapeutic use.
5. The method for detecting urogenital infection pathogen nucleic acid detection kit according to claim 3, which comprises the following steps:
s100, preparing a first-step reaction product, taking the STD reaction enzyme 1 and the STD first-step primer group out of the kit, melting at room temperature, uniformly mixing by oscillation, centrifuging for 10 seconds, calculating a first-step reaction number m, wherein m is the sample number, the negative control and the positive control, mixing and subpackaging into a PCR reaction tube or a PCR reaction plate by 15 mu L/portion, wherein the STD reaction enzyme 1 is 1 mu L, and the STD first-step primer group is 14 mu L;
s200, sample adding at one time, taking the STD positive quality control out of the kit, melting at room temperature, uniformly mixing by oscillation, centrifuging for 10 seconds, adding 10 mu L of the extracted nucleic acid sample, the STD positive quality control and the STD diluent into the PCR tube obtained in the step S100, covering a tube cover or sealing a membrane after sample adding, immediately uniformly mixing by oscillation, and placing on ice after short-time centrifugation;
s300, setting a fluorescence channel, and respectively setting detection channels FAM, ROX and Cy5 in a PCR instrument, wherein the excitation wavelength of the detection channel FAM is 465nm, the detection wavelength is 510nm, the excitation wavelength of the detection channel ROX is 465nm, the detection wavelength is 610nm, the excitation wavelength of the detection channel Cy5 is 465nm, and the detection wavelength is 660 nm;
s400, preparing a second-step reaction product, taking out an STD buffer solution from the kit, melting at room temperature, uniformly mixing by oscillation, centrifuging for 10 seconds, taking out the STD reaction enzyme 2 from the kit, calculating a second-step reaction number n, mixing and subpackaging the second-step reaction number n with 20 mu L/portion into a PCR reaction tube or plate, wherein the volume of the STD reaction enzyme 2 is 1 mu L, and the volume of the STD buffer solution is 19 mu L;
s500, adding samples for the second time, taking out 5uL of the reaction product of the first step, adding the reaction product into the PCR reaction tube obtained in the step S400, sealing the tube opening, and then vibrating uniformly;
s600, performing PCR analysis, namely putting the PCR reaction tube obtained in the step S500 into a PCR instrument, and operating the instrument;
s700, result analysis, namely selecting ROX and Cy5, analyzing ROX and Cy5 channels of a sample reaction system, comparing with a negative control, and judging the type of a pathogen according to the following table if a specific peak exists according to the Tm value of the specific peak; if there is no specific peak, it indicates that the pathogens in the following table are not detected;
the detection method is a non-disease diagnosis and treatment method;
the table is:
Figure FDA0003164623260000041
Figure FDA0003164623260000051
CN202010521877.0A 2020-06-10 2020-06-10 Urogenital system infection pathogen nucleic acid detection kit, application and method Active CN111593144B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010521877.0A CN111593144B (en) 2020-06-10 2020-06-10 Urogenital system infection pathogen nucleic acid detection kit, application and method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010521877.0A CN111593144B (en) 2020-06-10 2020-06-10 Urogenital system infection pathogen nucleic acid detection kit, application and method

Publications (2)

Publication Number Publication Date
CN111593144A CN111593144A (en) 2020-08-28
CN111593144B true CN111593144B (en) 2021-08-24

Family

ID=72190066

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010521877.0A Active CN111593144B (en) 2020-06-10 2020-06-10 Urogenital system infection pathogen nucleic acid detection kit, application and method

Country Status (1)

Country Link
CN (1) CN111593144B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112574872B (en) * 2020-12-16 2023-05-16 魏红 Device and method for detecting vaginal microorganisms

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105734176A (en) * 2016-05-05 2016-07-06 赣南医学院第一附属医院 Method for jointly detecting DNA of various venereal disease pathogens
CN109355437A (en) * 2018-12-11 2019-02-19 上海捷诺生物科技有限公司 A kind of respiratory pathogen Multiple detection kit

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101482681B1 (en) * 2013-02-05 2015-01-16 (주)다이오진 A method for detecting microorganisms occuring sexually transmitted diseases using liquid beads array and multiplex pcr

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105734176A (en) * 2016-05-05 2016-07-06 赣南医学院第一附属医院 Method for jointly detecting DNA of various venereal disease pathogens
CN109355437A (en) * 2018-12-11 2019-02-19 上海捷诺生物科技有限公司 A kind of respiratory pathogen Multiple detection kit

Also Published As

Publication number Publication date
CN111593144A (en) 2020-08-28

Similar Documents

Publication Publication Date Title
CN110317861B (en) Kit for detecting pathogen
CN112176079B (en) Primer probe combination for detecting female vaginal microorganisms based on quadruple liquid drop digital PCR and application thereof
CN115029459A (en) Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application
CN114774565A (en) Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system
CN111041130B (en) Compositions, kits and methods for detecting pathogens
CN110616253A (en) Kit and method for detecting fungi based on micro-drop digital PCR technology
CN111593144B (en) Urogenital system infection pathogen nucleic acid detection kit, application and method
US7381547B2 (en) Methods and compositions to detect bacteria using multiplex PCR
CN112592992A (en) Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
NL2031160B1 (en) Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
CN116121411A (en) Real-time fluorescent quantitative PCR primer, kit and detection method for detecting various genital tract microecological flora
CN103725761B (en) Group B streptococcus (GBS) nucleic acid detection kit and detection method
CN111500751B (en) Detection method and kit for rapidly detecting high-virulence klebsiella pneumoniae
CN110029179B (en) Nucleotide molecules and application thereof in identification of corynebacterium striatum
CN107557456B (en) LAMP (loop-mediated isothermal amplification) detection primer group and kit for ureaplasma urealyticum
KR20210046887A (en) Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria
US6518020B1 (en) Haemobartonella PCR methods and materials
CN112410445B (en) Method for detecting croton body by TaqMan probe fluorescence quantitative PCR and application
CN113151570B (en) Loop-mediated isothermal amplification LAMP technology based on LNA modification and application of LAMP technology in rapid detection of candida
CN107604085B (en) LAMP (loop-mediated isothermal amplification) detection primer group, kit and method for ureaplasma parvum
US20220396828A1 (en) Method of determining the presence of a hyper-virulent clostridioides difficile strain of the b1/nap1/027 group in a sample
CN114763577A (en) Microdroplet digital PCR (polymerase chain reaction) detection method for ureaplasma urealyticum and kit thereof
CN116732202A (en) Kit and method for detecting chlamydia cat through fluorescent recombinase-mediated isothermal nucleic acid amplification
CN118064616A (en) Method for rapidly detecting bacterial, fungal and mycoplasma pollution in mesenchymal stem cell culture process based on fluorescence quantitative PCR

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: 200231, 1st Floor, Building 3, No. 218 Yindu Road, Xuhui District, Shanghai

Patentee after: Shanghai Jienuo Biotechnology Co.,Ltd.

Address before: 200231 first floor, building 3, No. 466 Yindu Road, Xuhui District, Shanghai

Patentee before: SHANGHAI GENEODX BIOTECH CO.,LTD.

CP03 Change of name, title or address