CN115838837B - Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus - Google Patents
Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus Download PDFInfo
- Publication number
- CN115838837B CN115838837B CN202211561712.1A CN202211561712A CN115838837B CN 115838837 B CN115838837 B CN 115838837B CN 202211561712 A CN202211561712 A CN 202211561712A CN 115838837 B CN115838837 B CN 115838837B
- Authority
- CN
- China
- Prior art keywords
- pdcov
- pedv
- probe
- kit
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a microdroplet double digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus, and relates to the technical field of biological detection. The kit comprises a primer and probe combination for detecting porcine delta coronavirus and porcine epidemic diarrhea virus, wherein the primer and probe combination comprises a PDCoV primer pair, a PDCoV probe, a PEDV primer pair and a PEDV probe. The kit provided by the invention has stronger detection specificity, higher detection sensitivity and accuracy, is used for the specific quantitative detection of low-concentration samples such as air samples around sick pigs for the first time, and provides technical support for purification of pig farm coronavirus, introduction of high-quality piglets and biological prevention and control of domestic and foreign pig farms.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a microdroplet double digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus.
Background
The pig delta coronavirus (Porcine deltacoronavirus, PDCoV) is a newly discovered coronavirus which can cause diarrhea of piglets, mainly causes the diseases characterized by clinical symptoms such as diarrhea, vomiting and the like of the piglets, and easily causes serious loss to pig industry. Porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV) is one of the world-recognized acute infections causing serious harm to the pig industry, and can cause acute, highly infectious and contagious diarrhea of piglets, with mortality rate as high as 100%. The PDCoV and the PEDV belong to the coronavirus genus, the clinical symptoms caused by the PDCoV and the PEDV have great similarity, the positive rate of the PDCoV and the PEDV is as high as 60 percent in part of pig farms, and the mixed infection is common, so that great economic loss is caused to pig industry. Currently, these two coronaviruses are only pre-controlled and no effective therapeutic measures exist. Therefore, the early diagnosis and prevention of PDCoV and PEDV are adopted in time, and the method is an important measure for guaranteeing the pig industry.
Currently, the common detection methods for PDCoV and PEDV mainly comprise virus separation and identification, polymerase Chain Reaction (PCR), SYBR Green I fluorescent quantitative PCR (qPCR), enzyme-linked immunosorbent assay (ELISA) and the like. Traditional separation and identification methods require expensive equipment and are time-consuming; the ELISA operation method is simpler, but animal serum is needed, and the blood sampling is more stressed on pigs and is not suitable for environmental pathogen monitoring; the methods such as PCR, fluorescence quantitative PCR and the like are simple to operate and strong in specificity, but only qualitative and semi-quantitative detection can be realized, the detection of quantitative results of low-concentration viruses is unstable, and accurate detection cannot be realized in samples with low virus content.
The basic principle of digital PCR is that a sample is subjected to infinite dilution to form a single molecule level and uniformly distributed in tens of thousands of independent reaction chambers, the fluorescent signals in each independent reaction chamber are collected for PCR amplification, and finally the actual copy number of an initial or target sample is obtained according to the Poisson distribution principle and the positive drop number proportion. The development of a high-sensitivity PDCoV and PEDV dual-digital PCR detection technology has important significance for the quantitative detection, early diagnosis, environmental etiology monitoring, comprehensive prevention and control of porcine coronavirus and other researches of PDCoV and PEDV.
Disclosure of Invention
The invention aims to provide a microdroplet double digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus, which solves the problems of the prior art, and has stronger detection specificity, higher detection sensitivity and accuracy.
In order to achieve the above object, the present invention provides the following solutions:
the invention provides a primer and probe combination for detecting porcine delta coronavirus and porcine epidemic diarrhea virus, which comprises a PDCoV primer pair, a PDCoV probe, a PEDV primer pair and a PEDV probe; the nucleotide sequence of the PDCoV primer pair is shown as SEQ ID NO.1-2, and the nucleotide sequence of the PDCoV probe is shown as SEQ ID NO. 3; the nucleotide sequence of the PEDV primer pair is shown as SEQ ID NO.4-5, and the nucleotide sequence of the PEDV probe is shown as SEQ ID NO. 6.
Further, the 5 'end of the PDCoV probe is connected with a FAM group, and the 3' end of the PDCoV probe is connected with a BHQ1 group; and the 5 'end of the PEDV probe is connected with an HEX group, and the 3' end of the PEDV probe is connected with a BHQ1 group.
The invention also provides application of the primer and probe combination in preparing a microdroplet double digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus.
The invention also provides a microdroplet double digital PCR kit for detecting the porcine delta coronavirus and the porcine epidemic diarrhea virus, which comprises the primer and the probe combination.
Further, the concentration ratio of the PDCoV primer pair and the PDCoV probe is 800nM/1000nM; the concentration ratio of the PEDV primer pair to the PEDV probe was 800nM/1000nM.
Further, the kit further comprises 10 XdPCRBuffer, digital PCR enzyme, PDCoV detection template, PEDV detection template and nuclease-free sterilized water.
Further, the reaction procedure of the kit is as follows: pre-denaturation at 95℃for 2min, denaturation at 95℃for 15s, annealing at 58℃for 30s,45 cycles.
The invention discloses the following technical effects:
the invention provides a microdroplet double-digital PCR kit for detecting PDCoV and PEDV, and optimizes the annealing temperature and double-primer probe system of the kit, and detects low-concentration PDCoV and PEDV templates under the condition of no need of standard curves and standard substances, so that single-copy virus particles can be detected at the lowest, and the kit has higher sensitivity and accuracy. The minimum detection limit of the kit provided by the invention is single copy (PDCoV: 3.36 copies/. Mu.L, PEDV:2.12 copies/. Mu.L), the sensitivity is 10-1000 times higher than that of the traditional RT-PCR and real-time fluorescence quantitative PCR detection methods, and two viruses can be detected simultaneously, so that absolute quantification is realized. Therefore, the kit provided by the invention has important significance for the researches of PDCoV and PEDV quantitative detection, early diagnosis, environmental etiology monitoring, porcine coronavirus comprehensive control and the like.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is an optimized scatter plot of annealing temperature, primer probe concentration ratio, and primer probe system; wherein A is an annealing temperature optimization scatter diagram of the PDCoV; b is an annealing temperature optimization scatter diagram of PEDV; c is a primer probe concentration proportion optimization scatter diagram of the PDCoV; d is a primer probe concentration proportion optimization scatter diagram of PEDV;
FIG. 2 is a two-dimensional two-channel drop generation diagram of PDCoV and PEDV;
FIG. 3 is a graph of the results of a specificity test;
FIG. 4 is a graph of the results of a sensitivity test;
FIG. 5 is a graph showing the results of a PDCoV and PEDV dual digital PCR assay of a viral aerosol air sample.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
Example 1
1. Primer and probe design
By using MEGAX for sequence comparison, the N gene of PDCoV and the M gene of PEDV are found to have high specificity and are relatively very conservative, and can be used as a virus nucleic acid detection target. The invention respectively finds a section of conserved sequence in the N gene of PDCoV and the M gene region of PEDV, respectively designs a primer and a probe (table 1), and the lengths of target fragments are 112bp and 104bp respectively.
TABLE 1
| Name of the name | Sequence (5 '-3') | Numbering device |
| PDCoV upstream primer | CCCTTACCTTCTCGTACTCAATC | SEQ ID NO.1 |
| PDCoV downstream primer | GTTTGGTGGGTGGCTCATA | SEQ ID NO.2 |
| PDCoV probe | FAM–AAGGATGCGCTCAATACGGTCGTT-BHQ1 | SEQ ID NO.3 |
| PEDV upstream primer | TGGTCTTTCAATCCTGAAACAGA | SEQ ID NO.4 |
| PEDV downstream primer | GAGTGTTAGCGTTACACCAGTT | SEQ ID NO.5 |
| PEDV probe | HEX-AGGTCTGCATTCCAGTGCTTGGA-BHQ1 | SEQ ID NO.6 |
The primers and probes were synthesized by Henan Shang Ya Biotechnology Co., ltd at a concentration of 10. Mu.M.
PDCoV and PEDV double digital PCR reaction System (see Table 2)
TABLE 2
| Reaction components | Volume of |
| Corresponding digital PCR reaction buffer solution (containing Taq enzyme and dNTP) | 4.5μL |
| Dual primer probe system | 5μL |
| Nucleic acid templates | 2μL |
| Sterilizing water | 23.5μL |
| Total volume of | 35μL |
Nucleic acid templates: recombinant positive plasmids or clinical test samples. (1) Recombinant positive plasmid: respectively carrying out PCR amplification by using the designed PDCoV and PEDV primers, and connecting a PCR product to a pMD-18T vector to construct positive plasmids serving as PDCoV and PEDV positive detection templates; (2) clinical test sample: such as air sample, nose swab, throat swab, excrement, etc., to extract nucleic acid and reverse transcribe to obtain corresponding nucleic acid template.
PDCoV and PEDV double digital PCR detection method
(1) Configuration of reaction System
The reaction system was used in an amount of 35. Mu.L, and the configuration of the reaction system was as shown in Table 1. When the reaction system is configured, the reaction system needs to be operated on ice in the whole process in a dark place.
(2) Droplet preparation and reaction
And (3) fully and uniformly mixing the prepared reaction system, preparing an oil phase and adding the oil phase into an oil phase plate, carefully adding samples into sample adding holes in the digital PCR eight rows, placing the digital PCR eight rows into a PCR full-automatic liquid drop preparation instrument according to the marks, and then transferring the digital PCR eight rows into a PCR amplification instrument for fragment amplification.
(3) Chip reading and analysis
And observing and detecting a fluorescence result by using a PCR biochip reader with analysis software, calculating the copy number of the template in the positive sample, and calculating the total copy number in the sample according to the dilution factor in the reaction system.
(4) Data analysis
The positive template detection result shows fluorescence signals, the detected positive samples show positive signals, and the negative control has no fluorescence signals.
PDCoV and PEDV double digital PCR detection method and reaction system optimization
The annealing temperature and the primer probe concentration ratio are used as important parameters in a digital PCR detection reaction system, and influence the generation number of the liquid drops and the number of positive liquid drops. The PCR amplification was performed by setting five annealing temperatures of 52℃at 54℃at 56℃at 58℃at 60℃on a digital PCR apparatus, and the result was shown in FIG. 1A and B, with the optimum annealing temperature of 58℃for the PDCoV and PEDV dual digital PCR detection method.
Subsequently, the added PDCoV primer concentration/PDCoV probe concentration and PEDV primer concentration/PEDV probe concentration were set to 300nM/200nM, 600nM/500nM, 800nM/1000nM, 1000nM/1500nM, 500nM/1000nM for the reaction system configuration, wherein the primer probe concentration ratio was 800nM/1000nM at an annealing temperature of 58℃with the maximum distance between the fluorescence values of the positive and negative droplets, the most concentrated positive droplets, the least number of intermediate hetero-droplets, and the best amplification effect.
Therefore, the optimized double-digital PCR reaction system established in this example was finally determined as: 4.5 mu L of digital PCR reaction buffer; 5 mu L of a double primer probe system; 2. Mu.L of template and 35. Mu.L of sterile water were used. The optimized reaction procedure is finally: pre-denaturation at 95℃for 2min, denaturation at 95℃for 15s, annealing at 58℃for 30s,45 cycles were used.
Example 2 specificity test
In order to establish a digital PCR detection method for simultaneously detecting the specificity of PDCoV and PEDV, nucleic acid of common diarrhea pathogenic porcine transmissible gastroenteritis virus (Transmissiblegastroenteritis ofswine, TGEV), porcine sapelo virus (Porcine sapelovirus, PSV) and porcine pseudorabies virus (Porcine pseudorabies virus, PRV) are respectively used as specific samples, nuclease-free sterilized water is used as negative control, and the optimized reaction system and reaction program of the embodiment 1 are used for carrying out digital PCR amplification, and the test result is shown as figure 3, and the established double digital PCR can only detect PDCoV and PEDV, has obvious centralized distribution of FAM and HEX channel liquid drops, and is negative in other aspects, so that the detection method has good specificity.
Example 3 sensitivity test
To explore the minimum detection limit of the digital PCR detection method established by the inventionDegree, concentration is 3.36×10 9 Copy/. Mu.L of PDCoV standard positive plasmid and concentration of 2.12X10 9 After ten-fold specific dilution of the standard positive plasmid of PEDV in copies/. Mu.L (PDCoV: 3.36X 10) 9 -3.36×10 0 copies/μL；PEDV：2.12×10 9 -2.12×10 0 The samples/. Mu.L) were individually subjected to digital PCR amplification as templates (reaction system and reaction procedure optimized in example 1), each gradient concentration was repeated 3 times, and nuclease-free sterilized water was used as a negative control. The sensitivity results of the established PDCoV and PEDV dual digital PCR detection method are shown in figure 4, and the results show that the sensitivity of the method to PDCoV and PEDV can reach single copy (PDCoV: 3.36 copies/. Mu.L, PEDV:2.12 copies/. Mu.L) at the same time, and the detection method is higher in sensitivity and more suitable for detection of clinical samples with low viral load.
Example 4 Dual digital PCR detection of PDCoV and PEDV clinical samples
The 48 pig diarrhea samples collected from pig farms in Henan, hebei and Shanxi provinces were tested by using the optimized PDCoV and PEDV dual digital PCR detection method established in example 1, and the single or mixed infection of PDCoV and PEDV was analyzed, and the results are shown in Table 3. Analysis of the digital PCR detection results shows that the PDCoV infection cases in 48 pig diarrhea samples are 11 cases, and the positive rate is 22.17%; the number of PEDV infection cases is 18, and the positive rate is 37.50%; the mixed infection cases are 5 cases, and the positive rate of mixed infection is 10.42%. The detection method can be applied to the single infection detection of PDCoV or PEDV, and can also be used for quantitatively detecting mixed infection cases of PDCoV and PEDV, so that the method can be applied to the detection of clinical infection samples of PDCoV and PEDV in pig farms, and can also realize absolute quantification of early viral infection by virtue of high sensitivity.
TABLE 3 double digital PCR clinical sample detection of PDCoV and PEDV
Example 5 Aerosol clinical monitoring application of PDCoV and PEDV Dual digital PCR detection method
The research proves that the PDCoV can propagate through air, the propagation rule of the PDCoV in the air is deeply explored, and the method has important theoretical significance for formulating effective prevention and control measures. The PDCoV and PEDV dual-digital PCR detection method has higher sensitivity and accuracy, can realize absolute quantification of trace virus particles, and provides basic data and technical support for early warning and prevention of virus propagation through air. In this experiment, 3 piglets of 5 days old were subjected to PDCoV challenge, and subsequently had symptoms such as vomiting and diarrhea. And (3) collecting air samples at horizontal distances of 0m, 2m and 4m from the virus-attacked piglet group respectively by using a Lannst air aerosol collector at 24 hours and 72 hours after virus attack. After RNA in the sample solution was extracted, the copy number of PDCoV was measured by the digital PCR detection method established in example 1, and the result is shown in FIG. 5. The results show that the closer the content of the PDCoV virus particles in the aerosol is to the offending piglet, the more the content is. At 72 hours after the virus challenge, the virus particles above the virus-challenged piglet group (horizontal distance of 0 m) can reach 2.6X10 5 copies/m 3 . The research result provides an effective data basis for the research on the propagation rule of the PDCoV in the air.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Claims (7)
1. A primer and probe combination for detecting porcine delta coronavirus and porcine epidemic diarrhea virus, comprising a PDCoV primer pair, a PDCoV probe, a PEDV primer pair and a PEDV probe; the nucleotide sequence of the PDCoV primer pair is shown as SEQ ID NO.1-2, and the nucleotide sequence of the PDCoV probe is shown as SEQ ID NO. 3; the nucleotide sequence of the PEDV primer pair is shown as SEQ ID NO.4-5, and the nucleotide sequence of the PEDV probe is shown as SEQ ID NO. 6.
2. The primer and probe combination of claim 1, wherein the PDCoV probe is linked at the 5 'end to a FAM group and at the 3' end to a BHQ1 group; and the 5 'end of the PEDV probe is connected with an HEX group, and the 3' end of the PEDV probe is connected with a BHQ1 group.
3. Use of a primer and probe combination according to claim 1 or 2 for the preparation of a microdroplet dual digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus.
4. A microdroplet dual digital PCR kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus comprising the primer and probe combination of claim 1 or 2.
5. The kit of claim 4, wherein the concentration ratio of the pair of PDCoV primers to the PDCoV probe is 800nM/1000nM; the concentration ratio of the PEDV primer pair to the PEDV probe was 800nM/1000nM.
6. The kit of claim 4, further comprising a corresponding digital PCR reaction buffer, a PDCoV detection template, a PEDV detection template, and nuclease-free sterile water.
7. The kit of claim 4, wherein the kit has a reaction sequence of: pre-denaturation at 95℃for 2min, denaturation at 95℃for 15s, annealing at 58℃for 30s,45 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211561712.1A CN115838837B (en) | 2022-12-07 | 2022-12-07 | Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211561712.1A CN115838837B (en) | 2022-12-07 | 2022-12-07 | Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115838837A CN115838837A (en) | 2023-03-24 |
| CN115838837B true CN115838837B (en) | 2023-06-16 |
Family
ID=85578178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211561712.1A Active CN115838837B (en) | 2022-12-07 | 2022-12-07 | Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115838837B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420412A (en) * | 2015-12-31 | 2016-03-23 | 河南农业大学 | Porcine deltacoronavirus and porcine epidemic diarrhea virus multiple RT-PCR detection primers and detection method therefor |
| CN111955419A (en) * | 2020-08-31 | 2020-11-20 | 河南农业大学 | PDCoV and PEDV co-infected piglet morbidity model and establishment method and application thereof |
| CN113215154A (en) * | 2021-06-17 | 2021-08-06 | 广州博达锦弘生物科技有限公司 | Primer combination and kit for TGEV, PEDV and PDCoV triple PCR detection and application thereof |
| CN113502352A (en) * | 2021-07-01 | 2021-10-15 | 华中农业大学 | EMA-ddPCR primer and probe for detecting infectious ASFV and application |
| CN114134252A (en) * | 2021-10-19 | 2022-03-04 | 中国检验检疫科学研究院 | Primer and kit for detecting coronavirus |
-
2022
- 2022-12-07 CN CN202211561712.1A patent/CN115838837B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420412A (en) * | 2015-12-31 | 2016-03-23 | 河南农业大学 | Porcine deltacoronavirus and porcine epidemic diarrhea virus multiple RT-PCR detection primers and detection method therefor |
| CN111955419A (en) * | 2020-08-31 | 2020-11-20 | 河南农业大学 | PDCoV and PEDV co-infected piglet morbidity model and establishment method and application thereof |
| CN113215154A (en) * | 2021-06-17 | 2021-08-06 | 广州博达锦弘生物科技有限公司 | Primer combination and kit for TGEV, PEDV and PDCoV triple PCR detection and application thereof |
| CN113502352A (en) * | 2021-07-01 | 2021-10-15 | 华中农业大学 | EMA-ddPCR primer and probe for detecting infectious ASFV and application |
| CN114134252A (en) * | 2021-10-19 | 2022-03-04 | 中国检验检疫科学研究院 | Primer and kit for detecting coronavirus |
Non-Patent Citations (3)
| Title |
|---|
| "Coinfection of porcine deltacoronavirus and porcine epidemic diarrhea virus increases disease severity, cell trophism and earlier upregulation of IFN‑α and IL12";Kepalee Saeng‑chuto et al.,;《Scientifc Reports》;第11卷(第3040期);第1-13页 * |
| "DB33/T 2405—2021";浙江省市场监督管理局;《浙江省地方标准》;第1-15页 * |
| 施开创等."PEDV、TGEV、PDCoV、PRoV多重TaqMan荧光定量RT-PCR检测方法的建立及应用".《中国预防兽医学报》.2019,第41卷(第6期),第595-600页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115838837A (en) | 2023-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| WO2021174984A1 (en) | Rt-pcr detection method and kit for novel coronavirus | |
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN105624330B (en) | 12 boar common virus and bacterium Taqman-MGB PCR kit for fluorescence quantitative and method are detected simultaneously | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN115279925A (en) | Novel dual detection kit for coronavirus | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN113943830A (en) | Primer probe set and kit for simultaneously detecting feline parvovirus, feline herpesvirus type 1 and feline calicivirus | |
| CN113005228B (en) | Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN111471797B (en) | RT-RPA primer pair, probe, kit and detection method for detecting cat coronavirus | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| CN111621602A (en) | Porcine circovirus type 3 rapid detection fluorescent quantitative PCR kit and application thereof | |
| CN111363851A (en) | Method and kit for detecting novel coronavirus | |
| Mo et al. | Validation of specific quantitative real-time RT-PCR assay panel for Infectious Bronchitis using synthetic DNA standards and clinical specimens | |
| CN112760421A (en) | Triple fluorescent quantitative PCR kit for simultaneously detecting bovine rotavirus, coronavirus and viral diarrhea virus and application method thereof | |
| CN115838837B (en) | Microdroplet double digital PCR (polymerase chain reaction) kit for detecting porcine delta coronavirus and porcine epidemic diarrhea virus | |
| CN114634996B (en) | Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit | |
| CN113801963B (en) | Primer probe combination, kit and method for detecting coronavirus | |
| CN110564882A (en) | Dual TaqMAN probe fluorescent quantitative PCR detection method for equine piroplasmosis | |
| CN113481324B (en) | Method and kit for detecting novel coronavirus and D614G mutant thereof | |
| CN103805717A (en) | Dual Eva Green real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection kit for detecting equine herpesviruses I and IV and application thereof | |
| CN106701942A (en) | Real-time fluorescence PCR detection reagent kit for mycoplasma hyopneumoniae of pigs and purpose of real-time fluorescence PCR detection reagent kit | |
| CN112359125A (en) | Method for rapidly detecting cryptococcus gatherensis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |