CN114747687A

CN114747687A - Pet daily ration processing technology for adjusting intestinal flora and immunity of dogs or cats and pet daily ration

Info

Publication number: CN114747687A
Application number: CN202210410393.8A
Authority: CN
Inventors: 姜博文; 张洪才; 段卫帅
Original assignee: Shenzhen Douchai Pet Products Co ltd; Shanghai Jiaotong University
Current assignee: Shenzhen Douchai Pet Products Co ltd; Shanghai Jiaotong University
Priority date: 2022-04-19
Filing date: 2022-04-19
Publication date: 2022-07-15

Abstract

The invention discloses a pet daily ration processing technology for adjusting canine or feline intestinal flora and immunity and a pet daily ration, wherein the processing technology comprises the following steps: (1) crushing, mixing and extruding raw materials of the pet basic ration to prepare the puffed pet basic ration; (2) spraying a first mixture comprising a complex enzyme preparation, trehalose and grease on the surface of the puffed pet basic ration; (3) spraying a second mixture comprising bacillus subtilis, trehalose, and oil. The pet daily ration prepared by the processing technology has high survival rate of bacillus subtilis and good activity of the complex enzyme preparation, can prevent pet diarrhea, improves serum immunity indexes of dogs or cats, and obviously improves intestinal health of pets.

Description

Pet daily ration processing technology for adjusting intestinal flora and immunity of dogs or cats and pet daily ration

Technical Field

The invention relates to a pet daily ration processing technology, in particular to a daily ration processing technology for adjusting canine or feline intestinal flora and immunity and a pet daily ration.

Background

The diarrhea of the pet is the most common disease of the dog or the cat, causes great damage to the health of the pet organism, can cause symptoms such as collapse, dehydration, inappetence, mental depression and the like, and can further cause the immune function of the dog or the cat to be reduced and die. At present, the treatment of diarrhea diseases of pets mainly takes oral antibiotic medicines as main medicines, and the antibiotic can cause dysbacteriosis of intestinal tracts of the pets, so that the sick pets are difficult to completely recover. Therefore, it is important to find a method for preventing or treating diarrhea in pets.

In addition to antibiotic treatment, at present, the diarrhea of pets is mainly prevented or treated by three methods, including a physical adsorbent, a probiotic preparation and/or an enzyme preparation, wherein the three methods are often used simultaneously, the addition amount of the physical adsorbent needs to be controlled, otherwise, the ash content of the excrement of the pets is high; at present, in the daily ration processing process of pets, the survival rate of probiotics and the activity of an enzyme preparation are improved by a post-spraying method, so that the effects of regulating the intestinal microecological balance of animals, inhibiting harmful bacteria, enhancing the immunity of organisms and promoting the healthy growth of the pets are achieved. Therefore, improving the health of the digestive tract of pets and enhancing the immunity of animals is one of the problems which need to be solved urgently in the field of pets.

At present, most researches focus on adding probiotics to improve the intestinal health of pets, including yeasts, lactic acid bacteria, bacillus and the like, but the influence of extrusion, heat and the like on the daily volume of the pets in the processing process is not considered, so that the survival rate of the probiotics is reduced, and the probiotics need to be kept in the intestinal tract by 10 percent⁶CFU can exert the function of probiotics.

The complex enzyme preparation is also a common additive in pet daily ration, and can play a role in synergism of different enzymes, so that the effects of enhancing immunity, eliminating protein anti-nutritional factors, destroying cell walls of plant raw materials, improving the utilization rate of nutrients, degrading water-soluble non-starch polysaccharides and reducing the viscosity of chyme are achieved; inhibiting excessive reproduction of microorganism, improving gastrointestinal microecological environment, affecting blood hormone level of livestock and fowl, increasing organism metabolism level, and enhancing immunity.

Although many prior art has reported the use of probiotic and enzyme formulations in pet diets, as disclosed in publication No.: CN 113439803A discloses a compound enzyme preparation which can replace feed antibiotics; publication No.: CN113575761A discloses a manufacturing process and a production method of an organic pet food capable of enhancing immunity; publication No.: CN 113430150A discloses a probiotic and application thereof; publication No.: CN 113546096 a discloses an active probiotic formulation for treating constipation and diarrhea, but these prior art disclose methods of simply mixing probiotic and enzyme preparations and then adding them to the daily ration or spraying them onto the surface of the puffed food, and do not consider the characteristics of the probiotic and enzyme preparations, resulting in a greatly reduced survival rate of the probiotic in the stomach before processing and reaching the intestinal tract, and a greatly reduced activity of the complex enzyme in the stomach before processing and reaching the intestinal tract.

Disclosure of Invention

Aiming at the defects of the pet daily ration and the processing process thereof in the prior art, the invention provides the processing technology of the pet daily ration for adjusting the intestinal flora (balance) and the immunity of dogs or cats.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

a processing technology of pet daily ration for adjusting the intestinal flora and the immunity of dogs or cats comprises the following steps:

(1) crushing, mixing and extruding raw materials of the pet basic ration to prepare the puffed pet basic ration;

(2) spraying a first mixture comprising a complex enzyme preparation, trehalose and grease on the surface of the puffed pet basic ration,

(3) spraying a second mixture comprising bacillus subtilis, trehalose, and a lipid.

Preferably, the fats and oils in the first mixture and the second mixture are the same and are selected from one or more of chicken oil, fish oil and beef tallow.

Preferably, the complex enzyme preparation comprises phytase, cellulase, lysozyme, amylase, beta-glucanase and protease.

Preferably, the mass ratio of the complex enzyme preparation, the trehalose and the grease in the first mixture is (1-5): (0.5-0.8): (0.1-0.3).

Preferably, the first mixture accounts for 0.1-1.2% of the weight of the basic ration of the puffed pet.

Preferably, the mass ratio of the bacillus subtilis, the trehalose and the grease in the second mixture is (1-5): (0.5-0.8): (0.3-0.5).

Preferably, the second mixture accounts for 0.2-1.5% of the weight of the basic ration of the puffed pet.

Preferably, the puffed pet basic ration is used for dogs and comprises the following components in parts by mass:

20-35% of chicken powder, 20-35% of chicken breast, 10-25% of beef bone meal, 5-15% of millet, 5-15% of pea, 5-15% of potato, 10-20% of chicken oil, 1-5% of beet pulp, 0.5-3% of choline chloride, 0.3-0.6% of antioxidant, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt.

Preferably, the pet basic ration is used for cats and comprises the following components in parts by weight: 20-35% of chicken powder, 20-35% of chicken breast, 1-5% of fish meal, 10-15% of beef bone meal, 5-15% of chicken oil, 3-5% of fish oil, 5-10% of millet, 0.3-0.6% of antioxidant, 5-10% of pea, 0.3-0.5% of methionine, 0.3-0.5% of taurine, 0.3-0.5% of choline chloride, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt.

Preferably, the temperature of the puffing extrusion is 130-150 ℃.

Preferably, spraying the first mixture and the second mixture is performed at normal temperature.

In another aspect, the invention provides a pet diet for regulating canine or feline intestinal flora and immunity, which comprises a puffed pet basic diet and a first coating layer and a second coating layer sequentially coated on the surface of the puffed pet basic diet,

Wherein the first coating layer comprises a complex enzyme preparation, trehalose and grease, the complex enzyme preparation comprises phytase, cellulase, lysozyme, amylase, beta-glucanase and protease,

the second coating layer comprises bacillus subtilis, trehalose and grease.

The processing technology of the pet daily ration utilizes the characteristics of strong acid and alkali resistance and strong stability of the bacillus subtilis, and takes the bacillus subtilis as the outermost layer of post-spraying; the complex enzyme preparation is easily influenced by the microenvironment of gastric acid and is used as an inner layer for post-spraying; compared with the method of directly adding probiotics and enzyme preparations into the pet daily ration, the spraying mode of the invention can improve the survival rate of the probiotics and the activity of the enzyme preparations. Because the probiotics and the enzyme preparation are on the surface of the puffed daily ration for the pets and are easily influenced by gastric acid, bile acid, the enzyme preparation and other micro environments in the gastrointestinal tracts of the pets, the probiotics are difficult to colonize at the tail end (colon) of the intestinal tracts of the pets and the enzyme is difficult to play a role in the small intestine section, and therefore, the probiotics and the enzyme preparation are respectively mixed with trehalose and then sprayed, and the influence of the gastric acid, the bile acid, the enzyme preparation and other micro environments on the gastrointestinal tracts of the pets by the probiotics and the enzyme preparation can be reduced.

According to the pet daily ration for regulating the canine or feline intestinal flora and immunity, which is obtained by adjusting the processing technology, bacillus can form spores, has stress resistance such as high temperature resistance and acid and alkali resistance, can secrete digestive enzymes such as protease and amylase, promotes the absorption of animal intestinal nutrition, improves the utilization rate of feed, and reduces or replaces the use of antibiotics. Seven enzymes in the compound enzyme preparation have synergistic effect, and can improve feed digestibility, reduce food adhesion degree in intestinal tract, and relieve gastrointestinal burden. Therefore, the composition can prevent and improve the symptoms of constipation, diarrhea, dyspepsia and the like of the pets, and is beneficial to maintaining the intestinal health of the pets.

Detailed Description

Aiming at the problems in the prior art in the process of processing pet food, the inventor of the application finds that the complex enzyme preparation, the first mixture of trehalose and grease are firstly sprayed on the surface of the basic pet food, and then the second mixture of bacillus, trehalose and grease is sprayed on the surface of the basic pet food, so that the survival rate of probiotics in the finally obtained pet food is high, the activity of the enzyme preparation is good, the damage of the combined additive in the transportation and storage processes and the degradation of the combined additive by gastric acid, enzyme and the like in the stomach can be effectively reduced, and the intestinal bioactivity of the combined additive is improved. The present invention has been completed on the basis of this finding.

The processing technology of the pet daily ration for regulating the balance and immunity of the canine or feline intestinal flora provided by the invention comprises the following steps: (1) crushing, mixing and extruding raw materials of the pet basic ration to prepare the puffed pet basic ration; (2) spraying a first mixture comprising a complex enzyme preparation, trehalose and grease on the surface of the puffed pet basic ration; (3) spraying a second mixture comprising bacillus subtilis, trehalose, and a lipid.

The term "basal ration for pets" in the present invention means a ration that satisfies the basic nutrition of pets. For example, a basal diet for dogs may be formulated according to the nutritional standards for dog diets: more than or equal to 25 percent of crude protein, more than or equal to 14 percent of crude fat, less than or equal to 5.0 percent of crude fiber, less than or equal to 10 percent of crude ash, more than or equal to 1.3 percent of calcium, more than or equal to 1.0 percent of total phosphorus, less than or equal to 1.2 percent of salt and less than or equal to 10 percent of water. The basal diet for cats can be formulated according to the nutritional standards of the cat food: the crude protein is more than or equal to 25 percent, the crude fat is more than or equal to 14 percent, the crude fiber is less than or equal to 5.0 percent, the crude ash is less than or equal to 10 percent, the taurine is more than or equal to 0.2 percent, the calcium is more than or equal to 1.3 percent, the total phosphorus is more than or equal to 1.0 percent, the salt is less than or equal to 1.2 percent, and the water is less than or equal to 10 percent.

The basic ration can be pulverized in a conventional manner, the pulverized raw materials (for example, pulverized into 20-50 meshes) are fully mixed, the mixing can be performed by a method (for example, mechanical stirring) commonly used in the field, and the fully mixed raw materials are subjected to puffing extrusion. The puffing extrusion can be carried out by a puffing machine commonly used in the field to obtain the granular puffing basic ration. The puffing and extruding temperature is 130-150 ℃. Preferably, the feeding speed of the bulking machine is 22-27 Hz, the cutting speed is 15-27 Hz, and the rotating speed of the screw is 175-190 rpm. In the invention, the step (1) further comprises a step of drying the granular puffed basic ration obtained by puffing and extruding, wherein the drying temperature is preferably 60-90 ℃, and the drying time is preferably 60-90 min.

In the present invention, the fats and oils in the first mixture and the second mixture are the same, including but not limited to chicken fat, fish oil, and beef tallow.

In the invention, the complex enzyme preparation in the first mixture comprises phytase, cellulase, lysozyme, amylase, beta-glucanase and protease. The compound enzyme preparation can synergistically improve the digestibility of protein, starch and the like in the daily ration of the dog or the cat, reduce the chyme viscosity and reduce diarrhea of the dog or the cat. The enzyme activity of the compound enzyme preparation is preferably 10000-50000U/g of phytase, 5000-2000U/g of cellulase, 50000-200000U/g of lysozyme, 2000-10000U/g of amylase, 3000-10000U/g of beta-glucanase and 5000-20000U/g of protease respectively; more preferably, the phytase is 20000U/g, the cellulase is 12000U/g, the lysozyme is 55000U/g, the amylase is 2400U/g, the beta-glucanase is 9000U/g, and the protease is 6500U/g. The enzyme activity ratio of the phytase, the cellulase, the lysozyme, the amylase, the beta-glucanase and the protease in the compound enzyme preparation is preferably 0.2-1: 0.2-0.5: 1-2, and more preferably, the enzyme activity ratio of the phytase, the cellulase, the lysozyme, the amylase, the beta-glucanase and the protease is 0.5:0.5:0.3:1.5:1.5: 1.5. The skilled in the art can understand that each single enzyme selected by the complex enzyme preparation can be an enzyme with other specifications, and the single enzyme activity ratio in the complex enzyme preparation only needs to be satisfied.

The method for determining the enzyme activity of the compound enzyme preparation comprises the following steps: and (3) phytase activity determination: the temperature was 37 ℃ and the pH 7.0, the amount of enzyme required to release 1. mu. mol of phosphate in 1min being defined as one unit of phytase activity. And (3) cellulase activity determination: the temperature was 37 ℃ and the pH 5.5, and the amount of enzyme required to catalyze sodium carboxymethylcellulose to produce 1. mu. mol of reducing sugars in 1min was 1U. And (3) testing the activity of the lysozyme: at 25 deg.C, pH 6.2 and wavelength 450nm, reacting with wall-dissolving spherule solution to reduce absorbance by 0.001 to 1U per minute. And (3) amylase activity determination: the temperature was 37 ℃ and the pH 5.5, the amount of enzyme required to catalyze the production of 1. mu. mol reducing sugars in starch in 1min being 1U. And (3) measuring the activity of beta-glucanase: the temperature was 37 ℃ and the pH 7.0, and the amount of enzyme required to catalyze the production of 1. mu. mol of reducing sugars from beta-glucan in 1min was 1U. Protease activity determination: the temperature was 40 ℃ and the pH 3.0, and the amount of enzyme required to catalyze the production of 1. mu.g of tyrosine by casein in 1min was 1U.

The complex enzyme preparation of the invention has the following functions of each enzyme: 1) the phytase can destroy the strong affinity of phytic acid to mineral elements and increase the nutritional value of the mineral elements; 2) gluconic acid which can be produced by the beta-glucanase is utilized by probiotics in intestinal tracts to produce substances such as succinic acid, lactic acid, formic acid, acetic acid, propionic acid, butyric acid and the like;

3) The cellulase can degrade indigestible macromolecular polysaccharide, protein and lipid into small molecular substances, which are beneficial to digestive absorption of gastrointestinal tracts of animals, supplement the deficiency of endogenous enzyme, eliminate anti-nutritional factors and promote the healthy growth of dogs or cats; 4) lysozyme can protect gastric mucosa, reduce cholesterol and triglyceride content in blood, and prevent inappetence and dyspepsia caused by gastric ulcer; 5) amylase can decompose alpha-1, 4-glucan such as amylose, glycogen and the like, hydrolyze alpha-1, 4-glycosidic bonds and promote starch digestion; 6) the protease can degrade protein components in the endotoxin, thoroughly eliminate adverse effects of the endotoxin on intestinal inflammation and reduce diarrhea rate. Therefore, the 6 enzyme preparations can effectively reduce the diarrhea causing factors in the feed, reduce the release of toxic substances in the intestinal tract, improve the digestive capacity of the intestinal tract and reduce the diarrhea rate of dogs or cats through scientific proportioning and synergistic action.

The grease in the first mixture is mixed with the complex enzyme preparation and the trehalose, and can adhere to the surface of the expanded particles and improve the palatability of dogs and cats.

The mass ratio of the complex enzyme preparation, the trehalose and the grease in the first mixture is (1-5): 0.5-0.8): 0.1-0.3, and more preferably (2-4): 0.6-0.7): 0.2-0.3.

In the present invention, the spraying of the first mixing in the step (2) can be performed by a method commonly used in the art, and the spraying temperature is normal temperature.

In the present invention, the total viable count of Bacillus subtilis in the second mixture is 3.0X 10⁹～5.0×10¹¹CFU/g, more preferably 5.0X 10¹¹CFU/g。

In the invention, the grease in the second mixture is mixed with the bacillus subtilis and the trehalose, and can play a role in adhering to the surface of the expanded particles and improving the palatability of dogs and cats.

In the present invention, the effect of the bacillus subtilis in the second mixture is: 1) can produce digestive enzyme, can improve the activity of protease, amylase and lipase in gastrointestinal tract, and has strong degradation capability on plant carbohydrates; 2) the tolerance, high temperature resistance, salt resistance and acid resistance of the pet daily ration are provided; 3) the bacillus subtilis can consume oxygen in intestinal tracts, inhibit the colonization and growth of pathogenic bacteria and maintain the anaerobic environment in the intestinal tracts, so that the ecological balance of intestinal flora is maintained, and the healthy growth of animals is promoted; 4) the bacillus subtilis is also a better immune activator, and can stimulate the organism to generate cellular immunity and humoral immunity by generating antibodies and improving the activity of macrophages, thereby enhancing the immunity and disease resistance of the organism.

The mass ratio of the bacillus subtilis to the trehalose to the grease in the second mixture is preferably (1-5): (0.5-0.8): 0.3-0.5), and more preferably (2-4): 0.6-0.7): 0.3-0.5.

In the invention, the trehalose is used as an auxiliary carrier of the bacillus subtilis and the complex enzyme preparation, and the trehalose can be used as a prebiotic of the bacillus subtilis and a humectant of a bioactive substance, so that the bioactive substance has dryness resistance, the activity of the probiotic can be increased, the intestinal micro-ecological environment can be improved, the digestion and absorption functions of gastrointestinal tracts can be enhanced, the vivotoxin can be effectively eliminated, and the immunity and disease resistance of organisms can be enhanced.

The processing technology of the pet daily ration for adjusting the balance and immunity of the canine or feline intestinal flora comprises the steps of mixing the complex enzyme preparation and the bacillus subtilis with trehalose respectively, and sequentially attaching the complex enzyme preparation and the bacillus subtilis to the surface of the pet daily ration in a layer-by-layer spraying manner, so that the fixed value rate and the enzyme activity of the bacillus subtilis and the complex enzyme of the pet daily ration in the canine or feline intestinal tract can be effectively improved, the propagation of harmful microorganisms can be effectively inhibited, the balance of the intestinal flora can be adjusted, and the diarrhea rate of the canine or feline can be reduced.

The pet daily ration for regulating the balance and immunity of the canine or feline intestinal flora provided by the pet daily ration processing technology comprises puffed pet basic daily ration, and a first coating layer and a second coating layer which are sequentially coated on the surface of the puffed pet basic daily ration, wherein the first coating layer comprises a complex enzyme preparation, trehalose and grease, the complex enzyme preparation comprises phytase, cellulase, lysozyme, amylase, beta-glucanase and protease, and the second coating layer comprises bacillus subtilis, trehalose and grease.

In the invention, sodium alginate is used as a carrier of the bacillus subtilis and the complex enzyme preparation, and plays a role in protecting the survival rate of the bacillus subtilis and the activity of the complex enzyme preparation.

In one embodiment of the invention, a puffed pet basal diet for dogs comprises the following components in parts by mass:

20-35% of chicken powder, 20-35% of chicken breast, 10-25% of beef bone meal, 5-15% of millet, 5-15% of pea, 5-15% of potato, 10-20% of chicken oil, 1-5% of beet pulp, 0.5-3% of choline chloride, 0.3-0.6% of natural antioxidant, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt. The natural antioxidant comprises a composition of vitamins, trace elements, synthetic amino acids, and the like, and is available from ott bio-products (china) limited, for example.

In one embodiment of the invention, the pet basal diet is for cats, and comprises the following components in parts by weight: 20-35% of chicken powder, 20-35% of chicken breast, 1-5% of fish meal, 10-15% of beef bone meal, 5-15% of chicken oil, 3-5% of fish oil, 5-10% of millet, 0.3-0.6% of natural antioxidant, 5-10% of pea, 0.3-0.5% of methionine, 0.3-0.5% of taurine, 0.3-0.5% of choline chloride, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt, wherein the natural antioxidant comprises vitamins, trace elements, synthetic amino acids and other components, and can be purchased from Authenia biological products (China) Limited company. In the present invention, unless otherwise specified, all the raw material components are commercially available products well known to those skilled in the art. The invention will be further illustrated with reference to the following specific examples. The specific embodiment is implemented on the premise of the technical scheme of the invention, and a detailed implementation mode and an operation process are given. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, which are not specified under specific conditions, are generally carried out under conventional conditions. Unless otherwise indicated, ratios and percentages are by weight.

In the following specific examples, the criteria for dog and cat selection and feeding are as follows:

selection criteria for dogs: the method is characterized in that a healthy dog with the weight of about 10kg, the body temperature, the respiratory rate and the heart rate normal, the age of 1.5-2.5 years and complete immune programs is selected.

Selection criteria for cats: healthy English is selected, the age is 1-2 years old, the average weight is about 3.70kg, and the immune program is complete.

A breeding mode: the dog and the cat are fed in an animal room of a Shanghai farm, the formal experiment is started when the dogs and the cats are raised in the same environment for more than 30 days, the experimental period is 63 days, the dogs and the cats are transferred to a dog house 7 days before the experiment, the dogs and the cats are raised in a single cage, the dogs and the cats are fed with free food and water, and the relative humidity is 60-70%.

In the following specific examples, the feeding effect was evaluated with reference to the following criteria: canine or feline fecal pH, canine or feline fecal score and diarrhea rate tests, canine or feline serological indicator tests, probiotic in canine or feline fecal. The assay format for these standards is as follows:

(1) and (3) measuring the pH value of the excrement:

weighing 10g of fresh excrement sample, suspending the fresh excrement sample in 20mL of distilled water, performing vortex oscillation, fully and uniformly mixing, measuring the pH value, repeating the test for three times, and taking an average value of results.

(2) Stool score and diarrhea rate detection:

feces condition of dogs or cats were observed daily and diarrhea rate was calculated:

Diarrhea rate (number of diarrhea heads/total number of heads in experimental group) 100%.

(3) Detection of canine or feline serological indicators:

collecting disodium ethylene diamine tetra acetic acid (EDTA-Na) from jugular vein of dog or cat at 0, 30 and 60 days₂) Anticoagulation blood is 0.5mL, and the anticoagulation blood is respectively used for measuring immunological indexes. The immunological index includes immunoglobulin A (IgA), and serumThe contents of immunoglobulin M (IgM) and immunoglobulin G (IgG) are determined by immunoturbidimetry, and the kit is purchased from Nanjing to build a bioengineering institute.

(4) The method for determining the probiotics in the excrement comprises the following steps:

coli, salmonella and bacillus subtilis were determined in the feces by qRT-PCR. qRT PCR reactions were performed according to the protocol of the SuperReal fluorescent quantitation Ready-mix reagents enhanced (SYBR Green) kit. The qRT PCR reaction program was set to pre-denaturation at 95 ℃ for 15min, denaturation at 95 ℃ for 10 sec, annealing/extension at 60 ℃ for 32 sec, and 40 cycles of denaturation and annealing/extension. Beta-actin is used as internal reference, 2 is adopted^-ΔΔCtThe method calculates the relative abundance of escherichia coli, salmonella and bacillus subtilis. The primers for Escherichia coli are F: AGAGTTTGATCCTGGCTCAG and R: AAGGAGGTGATCCAGCCGCA, and the primers for Salmonella are F: GCGGCGTTGGAGAGTGATA and R: AGCAATGGAAAAAGCAGGAT. The primers of the Bacillus subtilis are F: GGGTCCAGAACGCTGAGAA and R: AAAGCCTCCGACATAACCG.

In the following examples, Bacillus subtilis product lot KCS211219, available from Auterki BioProduct (China) Inc., was subjected to the implementation standard Q/370126TRH 001-2020. The complex enzyme preparation is purchased from Auteqi biological products (China) Limited company, and comprises: phytase (CAS:9001-89-2), cellulase (CAS:9012-54-8), pectinase (CAS: 9032-75-1), amylase (CAS:9001-11-0), beta-glucanase (CAS:9074-98-0), and protease (CAS:9001-92-7), purchased from Sigma; mannooligosaccharides (CAS:37288-54-3) were purchased from Olympic Biotechnology, Inc., Jiangsu; tea polyphenols (CAS:84650-60-2) and sodium alginate (CAS:9005-38-3) were purchased from Sigma.

The test kit is purchased from Nanjing institute of bioengineering.

The natural antioxidants mentioned in the following examples comprise compositions of vitamins, trace elements, synthetic amino acids, etc. available from otti biologicals (china) limited. The natural antioxidants are the same in the pet diets for dogs and cats.

Example 1

1.1 preparing a Pet diet for dogs

(1) Crushing the raw materials of the basic ration to the fineness of about 40 meshes, uniformly mixing, carrying out double-helix extrusion at 150 ℃ to prepare the expanded canine basic ration,

The basic diet for the puffed dogs comprises the following components in parts by mass: 21% of chicken meal, 32% of chicken breast meat, 15% of beef bone meal, 5% of millet, 5.7% of pea, 5% of potato, 11% of chicken fat, 3% of beet pulp, 0.7% of natural antioxidant, 1.1% of choline chloride, 0.2% of calcium hydrophosphate and 0.3% of salt;

(2) spraying a first mixture comprising a complex enzyme preparation, trehalose and grease on the surface of the puffed pet basic ration by a spraying machine,

wherein the weight ratio of the complex enzyme preparation to the trehalose to the chicken oil is 3:0.6: 0.2;

wherein the first mixture is 0.3% by weight of the expanded pet base ration;

wherein the enzyme activity of the complex enzyme preparation is preferably 50000U/g of phytase, 2000U/g of cellulase, 200000U/g of lysozyme, 10000U/g of amylase, 10000U/g of beta-glucanase and 20000U/g of protease respectively; more preferably, the phytase is 20000U/g, the cellulase is 12000U/g, the lysozyme is 55000U/g, the amylase is 2400U/g, the beta-glucanase is 9000U/g, and the protease is 6500U/g. The enzyme activity ratio of the phytase, the cellulase, the lysozyme, the amylase, the beta-glucanase and the protease is 0.5:0.5:0.3:1.5:1.5: 1.5.

(3) Spraying a second mixture comprising bacillus subtilis, trehalose and grease by a spraying machine, naturally cooling to prepare the pet daily ration for the dog,

Wherein the second mixture is 0.4% by weight of the expanded pet base ration;

wherein the weight ratio of the bacillus subtilis to the trehalose to the chicken oil is 3:0.6: 0.4.

Wherein the total viable count of Bacillus subtilis is 5.0 × 10¹¹CFU/g。

1.2 preparing a Pet diet for cats

(1) Crushing the raw materials of the basic ration to the fineness of about 40 meshes, uniformly mixing, carrying out double-helix extrusion at 150 ℃ to prepare the expanded cat basic ration,

the puffed cat basic ration comprises the following components in parts by mass:

the cat basic ration comprises the following components in parts by mass: 30% of chicken powder, 28% of chicken breast, 3% of fish meal, 13% of beef bone meal, 6% of chicken oil, 4% of fish oil, 7% of millet, 0.6% of natural antioxidant, 6% of pea, 0.5% of methionine, 0.4% of taurine, 0.4% of choline chloride, 0.6% of calcium hydrophosphate and 0.5% of salt;

wherein the weight ratio of the complex enzyme preparation, the trehalose and the chicken oil is 3:0.6: 0.2;

wherein the first mixture is 0.5% by weight of the expanded pet base ration;

(3) Spraying a second mixture comprising bacillus subtilis, trehalose and grease by a spraying machine, naturally cooling to prepare the pet diet for cats,

wherein the weight ratio of the bacillus subtilis to the trehalose to the chicken oil is 3:0.6:0.4,

wherein the second mixture is 0.4% of the weight of the puffed pet base ration;

wherein the total viable count of Bacillus subtilis is 5.0 × 10¹¹CFU/g。

Example 2

2.1 preparing a Pet diet for dogs

(1) Crushing the raw materials of the basic ration to the fineness of about 45 meshes, uniformly mixing, carrying out double-helix extrusion at 150 ℃ to prepare the expanded canine basic ration,

the basic daily ration for the puffed dog comprises the following components in parts by mass: 21% of chicken powder, 32% of chicken breast meat, 15% of beef bone meal, 5% of millet, 5.7% of pea, 5% of potato, 11% of chicken oil, 3% of beet pulp, 0.7% of natural antioxidant, 1.1% of choline chloride, 0.2% of calcium hydrophosphate and 0.3% of salt.

wherein the weight ratio of the complex enzyme preparation, the trehalose and the chicken fat is 4:0.7: 0.2.

Wherein the first mixture is 0.4% by weight of the expanded pet base ration;

Wherein the enzyme activity of the complex enzyme preparation is preferably 50000U/g of phytase, 2000U/g of cellulase, 200000U/g of lysozyme, 10000U/g of amylase, 10000U/g of beta-glucanase and 20000U/g of protease respectively; more preferably, the phytase is 20000U/g, the cellulase is 12000U/g, the lysozyme is 55000U/g, the amylase is 2400U/g, the beta-glucanase is 9000U/g, and the protease is 6500U/g. The enzyme activity ratio of the phytase to the cellulase to the lysozyme to the amylase to the beta-glucanase to the protease is 0.5:0.5:0.3:1.5:1.5: 1.5.

(3) Spraying a second mixture comprising bacillus subtilis, trehalose and grease by a spraying machine, naturally cooling to prepare the pet ration for cats,

wherein the weight ratio of the bacillus subtilis to the trehalose to the chicken oil is 2:0.7: 0.4.

Wherein the second mixture is 0.3% by weight of the expanded pet base ration;

wherein the total viable count of Bacillus subtilis is 5.0 × 10¹¹CFU/g。

2.2 preparing a Pet diet for cats

wherein the weight ratio of the complex enzyme preparation to the trehalose to the chicken oil is 4:0.5:0.3,

wherein the first mixture is 0.3% of the weight of the puffed pet's basal ration;

wherein the enzyme activity of the complex enzyme preparation is preferably 50000U/g phytase, 2000U/g cellulase, 200000U/g lysozyme, 10000U/g amylase, 10000U/g beta-glucanase and 20000U/g protease respectively; more preferably, the phytase is 20000U/g, the cellulase is 12000U/g, the lysozyme is 55000U/g, the amylase is 2400U/g, the beta-glucanase is 9000U/g, and the protease is 6500U/g. The enzyme activity ratio of the phytase, the cellulase, the lysozyme, the amylase, the beta-glucanase and the protease is 0.5:0.5:0.3:1.5:1.5: 1.5.

wherein the weight ratio of the bacillus subtilis to the trehalose to the chicken oil is 2:0.8: 0.3;

wherein the second mixture is 0.5% of the weight of the puffed pet base ration;

wherein the total viable count of Bacillus subtilis is 5.0 × 10 ¹¹CFU/g。

Comparative example

Preparation of pet diet for dogs

(1) Pulverizing the raw materials of basic ration to obtain fineness of about 40 mesh, mixing, puffing by double helix at 150 deg.C to obtain puffed canine basic ration,

(2) the puffed pet basic ration is fully mixed with a mixture containing a complex enzyme preparation (same as example 1), bacillus subtilis (same as example 1), trehalose and grease to prepare the pet ration for dogs,

wherein the weight ratio of the complex enzyme preparation to the bacillus subtilis to the trehalose to the chicken oil is 3:3:1.2: 0.6;

wherein the mixture is 0.7% of the weight of the puffed pet base ration.

Preparing a pet diet for cats

(2) the puffed pet basal diet is fully mixed with a mixture comprising a complex enzyme preparation (same as the example 1), bacillus subtilis (same as the example 1), trehalose and grease to prepare the pet diet for cats,

wherein the mixture is 0.9% by weight of the puffed pet base ration.

Comparative example

Preparation of pet diet for dogs

the basic diet for the puffed dogs comprises the following components in parts by mass: 21% of chicken meal, 32% of chicken breast, 15% of beef bone meal, 5% of millet, 5.7% of pea, 5% of potato, 11% of chicken oil, 3% of beet pulp, 0.7% of natural antioxidant, 1.1% of choline chloride, 0.2% of calcium hydrophosphate and 0.3% of salt;

(2) The mixture comprising the complex enzyme preparation (same as the example 1), the bacillus subtilis (same as the example 1), the trehalose and the grease is sprayed on the surface of the puffed pet basic ration by a spraying machine to obtain the pet ration for the dog,

wherein the mixture is 0.7% of the weight of the puffed pet base ration.

Preparing a pet diet for cats

the basic puffed cat diet comprises the following components in parts by mass:

(2) spraying a mixture comprising a complex enzyme preparation (same as example 1), bacillus subtilis (same as example 1), trehalose and grease on the surface of the puffed pet basic ration by using a spraying machine to prepare the pet daily ration for the cat,

wherein the mixture is 0.9% by weight of the puffed pet base ration.

Practical effect of the Pet diet of example 1

36 dogs and 36 cats were selected and fed with the pet diet for dogs and cat of example 1, respectively, and the experiment was performed 1 week before the experiment, and the official experiment was 60 days. Feed intake and feces scoring are measured daily, canine or feline body weight and canine or feline feces collected weekly, and daily weight gain and feed digestibility determined. Dogs and cats were bled intravenously on days 0, 30 and 60, respectively, and serum and whole blood were collected. As can be seen from table 1, the pH of the dog feces was 6.17, and the diarrhea rate was 0%, and the pH of the cat feces was 6.36, and the diarrhea rate was 0%.

As shown in Table 2, the E.coli, 4.90, 4.32 and 3.12lgCFU/g, Salmonella 4.92, 3.24 and 2.94lgCFU/g and Bacillus subtilis 2.34, 4.39 and 7.67lgCFU/g were observed in dog feces at days 0, 30 and 60, respectively. On days 0, 30 and 60, the Bacillus species in cat litter were 4.37, 3.26 and 2.36lgCFU/g, respectively, Salmonella 3.65, 2.85 and 2.46lgCFU/g, respectively, and Bacillus subtilis 3.57, 5.37 and 6.92lgCFU/g, respectively. Coli, salmonella and bacillus subtilis were significantly different in feces of dogs or cats compared to the control group. Therefore, when the feed is fed for 60 days, the bacillus subtilis in the excrement is more than 106lgCFU/g, can be effectively planted in the intestinal tracts of dogs or cats, and can inhibit the quantity of escherichia coli and salmonella.

As shown in Table 3, at day 0 and day 60, the IgA content in canine serum was 142.34 and 154.2mg/L, the IgG content was 1456.82 and 1488.71mg/L, and the IgM content was 310.44 and 315.01mg/L, respectively. As shown in Table 4, at day 0 and day 60, the IgA content in the cat serum was 170.89 and 192.35mg/L, the IgG content was 210.34 and 223.56mg/L, and the IgM content was 110.23 and 135.64mg/L, respectively. Therefore, the experimental group can effectively improve the content of IgA, IgG and IgM in the serum of the dog or the cat, can maintain the intestinal health of the dog or the cat, and can improve the resistance.

Practical effect of pet diet of example 2

36 dogs and 36 cats were selected and fed with the pet diet for dogs and pet diet for cats of example 2, respectively, and the experiment was performed 1 week before the experiment, and the official experiment was 60 days. Feed intake and stool scoring were measured daily, dog or cat body weight and dog or cat stool collected weekly, and daily weight gain and feed digestibility determined. Dogs and cats were bled intravenously on days 0, 30, and 60, respectively, and serum and whole blood were collected. As can be seen from table 1, the pH of dog feces was 6.23, the diarrhea rate was 0%, and the pH of cat feces was 6.25, the diarrhea rate was 0%.

As shown in Table 2, the amounts of E.coli in dog feces were 5.10, 4.39 and 3.41lgCFU/g, respectively, for Salmonella 4.84, 3.35 and 2.85lgCFU/g, and for Bacillus subtilis 2.45, 4.27 and 6.62lgCFU/g, respectively, at days 0, 30 and 60. On days 0, 30 and 60, the coliform bacteria in cat feces were 4.62, 3.45 and 2.43lgCFU/g, respectively, salmonella was 3.70, 2.93 and 2.41lgCFU/g, respectively, and bacillus subtilis was 3.64, 5.82 and 7.83lgCFU/g, respectively. Coli, salmonella and bacillus subtilis were significantly different in feces of dogs or cats compared to the control group. Therefore, when the feed is fed for 60 days, the bacillus subtilis in the excrement is more than 106lgCFU/g, can be effectively planted in the intestinal tracts of dogs or cats, and can inhibit the quantity of escherichia coli and salmonella.

As shown in Table 3, at day 0 and day 60, the IgA content in canine serum was 145.63 and 155.54mg/L, IgG content was 1398.34 and 1450.32mg/L, and IgM content was 320.24 and 326.35mg/L, respectively. As shown in Table 4, at days 0 and 60, the IgA content in the cat serum was 172.34 and 192.34mg/L, the IgG content was 220.45 and 240.68mg/L, and the IgM content was 110.46 and 125.09mg/L, respectively. Therefore, the experimental group can effectively improve the content of IgA, IgG and IgM in the serum of the dog or the cat, can maintain the intestinal health of the dog or the cat, and can improve the resistance.

Actual effect of pet diet of comparative example

36 dogs and 36 cats were selected and fed with the pet diet for dogs and pet diet for cats of the control example, respectively, and the experiment was performed 1 week before the experiment, and the official experiment was performed for 60 days. Feed intake and stool scoring were measured daily, dog or cat body weight and dog or cat stool collected weekly, and daily weight gain and feed digestibility determined. Dogs and cats were bled intravenously on days 0, 30, and 60, respectively, and serum and whole blood were collected.

As can be seen from table 1, the pH of dog feces was 6.73, the rate of diarrhea was 20%, and the pH of cat feces was 6.60, the rate of diarrhea was 25%. A proportion of diarrhea occurred in dogs or cats compared to the experimental group.

As shown in Table 2, on days 0, 30 and 60, E.coli in dog feces were 5.23, 5.14 and 4.84lgCFU/g, Salmonella 4.79, 4.35 and 3.93lgCFU/g, and Bacillus subtilis was 2.95, 2.78 and 3.51lgCFU/g, respectively. At days 0, 30 and 60, the cat feces contained 4.76, 3.96 and 3.83lgCFU/g of E.coli, 3.68, 3.18 and 2.92lgCFU/g of Salmonella, and 3.47, 4.43 and 4.19lgCFU/g of Bacillus subtilis, respectively. Compared with an experimental group, the escherichia coli, the salmonella and the bacillus subtilis in the excrement of the dog or the cat have significant differences, the dog or the cat puffed daily ration which is not subjected to the novel post-spraying process is not used, and when the dog or the cat puffed daily ration is fed for 60 days, the bacillus subtilis in the excrement cannot reach the field planting quantity, and meanwhile, the quantity of the escherichia coli and the salmonella cannot be effectively inhibited.

As shown in Table 3, at day 0 and day 60, the IgA content in canine serum was 148.23 and 150.21mg/L, IgG content was 1416.56 and 1420.21mg/L, and IgM content was 317.34 and 320.10mg/L, respectively. As shown in Table 4, at days 0 and 60, the IgA content in the cat serum was 173.96 and 183.96mg/L, the IgG content was 220.57 and 226.54mg/L, and the IgM content was 100.94 and 112.88mg/L, respectively. In the control group, the content of IgA, IgG and IgM is not obviously different in the feeding period, and the actual use effect of the pet daily ration of the comparative example is

10 dogs and 10 cats were selected and fed with the pet diet for dogs and the pet diet for cats of the comparative example, respectively, and the experiment was performed 1 week before the experiment, and the formal experiment was performed for 60 days. We examined the diarrhea in these dogs and cats and although neither dogs nor cats showed diarrhea, the stool viscosity was significantly greater in half of the dogs and half of the cats when consumed than in the dogs and cats of examples 1 and 1.

The first mixture comprising the compound enzyme preparation, the trehalose and the grease is sprayed, and then the second mixture comprising the bacillus subtilis, the trehalose and the grease is sprayed, so that the activity of the compound enzyme preparation can be better protected, and the compound enzyme preparation can play a better role in intestinal tracts.

Table 1 dog and cat stool pH and diarrhea rate indices in example 1, example 2 and control examples

TABLE 2 amounts of E.coli, Salmonella and Bacillus subtilis in dog and cat faeces of example 1, example 2 and control examples

Note: the data of the same row is marked with no letters or the same lower case letters to indicate that the difference is not significant (P is more than 0.05), and different lower case letters to indicate that the difference is significant (P is less than 0.05).

TABLE 3 measurement of IgA, IgM and IgG in the sera of dogs in example 1, example 2 and control example

Note: the data shoulder marks of the same row have no letters or the same lower case letters, which indicate that the difference is not significant (P is more than 0.05), and the different lower case letters indicate that the difference is significant (P is less than 0.05).

TABLE 4 determination of IgA, IgM and IgG in the sera of cats in example 1, example 2 and the control example

The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and various modifications may be made to the above-described embodiment of the present invention. All simple and equivalent changes and modifications made according to the claims and the content of the specification of the present invention are within the scope of the claims of the present invention. The invention has not been described in detail in the conventional technical content.

Claims

1. A processing technology of pet daily ration for adjusting the intestinal flora and the immunity of dogs or cats is characterized by comprising the following steps:

2. The process for processing the pet diet for regulating the intestinal flora and immunity of dogs or cats according to claim 1, wherein the oil and fat in the first mixture and the second mixture are the same and are selected from one or more of vegetable oil, chicken oil, fish oil and beef tallow.

3. The process for processing a pet diet for regulating the intestinal flora and immunity of dogs or cats according to claim 1, characterized in that the complex enzyme preparation comprises phytase, cellulase, lysozyme, amylase, β -glucanase and protease.

4. The processing technology of the pet daily ration for adjusting the intestinal flora and the immunity of dogs or cats according to claim 1, characterized in that the mass ratio of the complex enzyme preparation, trehalose and grease in the first mixture is 1-5: 0.5-0.8: 0.1-0.3, and the first mixture is 0.1-1.2% of the weight of the basic daily ration of the puffed pet.

5. The processing technology of the pet diet for regulating canine or feline intestinal flora and immunity according to claim 1, wherein the mass ratio of bacillus subtilis, trehalose to oil in the second mixture is 1-5: 0.5-0.8: 0.3-0.5, and the second mixture is 0.2-1.5% of the weight of the puffed pet basic diet.

6. The process for processing a pet diet for regulating the intestinal flora and immunity of a dog or cat as claimed in claim 1, wherein the puffed pet basal diet is used for dogs and comprises the following components in percentage by mass:

20-35% of chicken powder, 20-35% of chicken breast meat, 10-25% of beef bone meal, 5-15% of millet, 5-15% of pea, 5-15% of potato, 10-20% of chicken oil, 1-5% of beet pulp, 0.5-3% of choline chloride, 0.3-0.6% of natural antioxidant, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt.

7. The process for processing the pet diet for regulating the intestinal flora and immunity of dogs or cats according to claim 1, wherein the pet basal diet for cats comprises the following components by weight: 20-35% of chicken powder, 20-35% of chicken breast meat, 1-5% of fish meal, 10-15% of beef bone meal, 5-15% of chicken oil, 3-5% of fish oil, 5-10% of millet, 0.3-0.6% of natural antioxidant, 5-10% of pea, 0.3-0.5% of methionine, 0.3-0.5% of taurine, 0.3-0.5% of choline chloride, 0.2-1% of calcium hydrophosphate and 0.3-0.5% of salt.

8. The process for processing a pet diet for regulating intestinal flora and immunity of a dog or cat as claimed in claim 1, wherein the temperature of the puffing and extruding is 130-150 ℃.

9. The process for processing a pet diet for regulating the intestinal flora and immunity of dogs or cats according to claim 1, wherein the spraying of the first mixture and the second mixture is performed at normal temperature.

10. A pet daily ration for regulating canine or feline intestinal flora and immunity comprises a puffed pet basic daily ration, a first coating layer and a second coating layer which are sequentially coated on the surface of the puffed pet basic daily ration,

the second coating layer comprises bacillus subtilis, trehalose and grease.