CN114717192A

CN114717192A - Pluripotent stem cell expressing Amyloid beta targeted inhibitory factor, derivative and application thereof

Info

Publication number: CN114717192A
Application number: CN202011524197.0A
Authority: CN
Inventors: 王淋立; 陈月花; 莫健; 杨建国
Original assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Current assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2022-07-08

Abstract

The invention discloses a pluripotent stem cell expressing an Amyloid beta targeted inhibitory factor, a derivative and an application thereof. An expression sequence of an Amyloid beta inhibitor is introduced into a genome of the pluripotent stem cell or a derivative thereof, and the Amyloid beta inhibitor is at least one of shRNA and/or shRNA-miR of a target Amyloid beta. After the Amyloid beta inhibitor expressed by the pluripotent stem cells or the derivatives thereof is wrapped by the exosome, the exosome carries the Amyloid beta inhibitor to be combined with the target cells, and the Amyloid beta inhibitor contained in the exosome is released, so that the Amyloid beta pathway is blocked, the immunosuppression is relieved, the immune system is activated, and the Alzheimer's disease is effectively treated.

Description

Pluripotent stem cell expressing Amyloid beta targeted inhibitory factor, derivative and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell expressing an Amyloid beta targeted inhibitory factor, a derivative thereof and application thereof.

Background

Beta-amyloid (amyloid-beta, Abeta) is a 39-43 amino acid polypeptide produced by the proteolysis of Amyloid Precursor Protein (APP) by beta-and gamma-secretases. It is produced by a variety of cells, circulates in the blood, cerebrospinal fluid and cerebral interstitial fluid, is mostly bound to chaperone molecules, and exists in a few free states. The beta-amyloid protein fragment is located in a transmembrane region of amyloid precursor protein, the amyloid precursor protein is firstly split into a beta-N-terminal fragment (sAPP beta) and a beta-C-terminal fragment at a beta site through beta-secretase, then the gamma-secretase hydrolyzes in a transmembrane region near the N end of the beta-C-terminal fragment to release an A beta peptide segment consisting of 39-43 amino acids, and the process is called as an amyloid degradation pathway of APP.

On the other hand, in the field of cell therapy, the problem of immunological compatibility of allogens remains a big problem. In recent years, a plurality of reports have been provided that the deletion expression of genes on the cell surfaces of HLA-I and HLA-II or the genes thereof is realized by knocking out genes such as B2M, CIITA and the like, so that the cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.

Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 high-frequency immune match HLA-C antigen species are very different, and the part of the area can only account for 70 percent by verification and calculation, while the HLA data of large sample size which is not authoritative currently in China, Indian and other big countries is displayed, so that the prepared general PSCs are still subjected to huge match vacancy tests; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible protocols are also a matter of expediency in the "transition period", and many problems remain that are not better solved.

In addition, inducing killing of the suicide gene after donor tissue and cell disease has been induced, which results in serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that proper donor cells, tissues and organs do not exist after the cell death of the design.

Disclosure of Invention

The present invention aims to provide a pluripotent stem cell or a derivative thereof;

the invention also aims to provide application of the pluripotent stem cells or the derivatives thereof and exosomes secreted by the pluripotent stem cells in preparation of a preparation or a medicament for treating the Alzheimer's disease.

It is another object of the invention to provide an exosome.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, wherein an expression sequence of an Amyloid β inhibitory factor is introduced into the genome of the pluripotent stem cell or the derivative thereof; the Amyloid beta inhibitor is at least one of shRNA and shRNA-miR of the targeted Amyloid beta.

The inventor finds that after the expression sequence of the Amyloid beta inhibitor is introduced into the pluripotent stem cell or the derivative thereof, the Amyloid beta inhibitor targeting Amyloid beta secreted in the pluripotent stem cell or the derivative thereof can be combined with a target cell to effectively treat Alzheimer's disease.

Further, the sequences of the shRNA and shRNA-miR of the targeting Amyloid beta are shown in SEQ ID NO. 1.

In a second aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, wherein an expression sequence of an Amyloid β inhibitory factor is introduced into the genome of the pluripotent stem cell or the derivative thereof; the Amyloid beta inhibiting factor is at least one of shRNA and shRNA-miR of the target Amyloid beta.

The B2M gene and/or CIITA gene of the genome of the pluripotent stem cell or the derivative thereof are knocked out.

When the B2M and CIITA genes are knocked out, the influence of HLA-I and HLA-II molecules is completely eliminated, so that the treatment effect of the Alzheimer's disease is optimal.

In a third aspect of the present invention, there is provided:

A first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or the derivative thereof; and the pluripotent stem cell or the derivative thereof has a second nucleic acid molecule introduced into the 3' UTR region of the immune response-related gene; the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

In the technical scheme, the small nucleic acid molecule coded by the first nucleic acid molecule can be specifically combined with a transcription product of a second nucleic acid molecule introduced from a 3' UTR region of an immune response related gene, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked, so that the cell has the immune compatibility characteristic, and the allogeneic immune rejection response can be eliminated or reduced. Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3 'UTR of the immune response-related gene only acts on the donor cells, without interfering with the genome of the recipient's cells.

Further, the small nucleic acid molecule includes short interfering nucleic acid, short interfering RNA, and double-stranded RNA, and preferably at least one of miRNA, shRNA, and shRNA-miR.

Further, the pluripotent stem cell or a derivative thereof is derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of humans.

The small nucleic acid molecule is preferably derived from caenorhabditis elegans. For example:

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.2)；

5’-TCACAACCTCCTAGAAAGAGTAGA-3’(SEQ ID NO.101)。

further, the second nucleic acid molecule comprises a reverse complement of at least 3 repeated small nucleic acid molecule sequences, preferably 6-10 repeated small nucleic acid molecule sequences.

Furthermore, an inducible gene expression system is introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating the expression of the first nucleic acid molecule.

In the technical scheme, the inducible gene expression system is regulated and controlled by an exogenous inducer, and the on-off of the inducible gene expression system is controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, so that the expression quantity of small nucleic acid molecules is controlled.

When the inducible gene expression system is started, the small nucleic acid molecule normally expressed is specifically combined with a transcription product of a second nucleic acid molecule introduced from the 3' UTR region of the immune response related gene, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the transplant and the recipient can be improved.

When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules is closed, the interference effect of the small nucleic acid on mRNA of the immune response related gene is stopped, the normal expression of the immune response related gene is recovered, the antigen presenting capability of graft cells is recovered, and the receptor can remove the pathological graft, so that the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells or the derivatives thereof in clinical application is greatly expanded.

Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-associated gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3' UTR of the immune response-associated gene only acts on the donor cells, without interfering with the genome of the recipient cells.

In a fourth aspect of the present invention, there is provided:

The genome of the pluripotent stem cell or the derivative thereof is further introduced with an expression sequence of at least one immune-compatible molecule for regulating the expression of a gene associated with an immune response in the pluripotent stem cell or the derivative thereof.

In the technical scheme, the immune compatible molecules can regulate and control the expression of genes related to immune response in the pluripotent stem cells or the derivatives thereof, so that the pluripotent stem cells or the derivatives thereof have low immunogenicity, and can eliminate or reduce allogeneic immune rejection response and improve the immune compatibility between a graft and a recipient when the pluripotent stem cells or the derivatives thereof are transplanted into the recipient. The exosome carries the inhibiting factors to be combined with target cells, and then the inhibiting factors are released, so that the Amyloid beta pathway is blocked, the immune suppression is relieved, the immune system is activated, and the Alzheimer's disease can be effectively treated.

Furthermore, an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and is used for regulating and controlling the expression of the immune compatible molecules.

In the technical scheme, the inducible gene expression system is regulated by an exogenous inducer, the on and off of the inducible gene expression system are controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, and the expression quantity of an immune compatible molecular expression sequence is further controlled, so that the reversible regulation of the immune compatibility of the pluripotent stem cells or derivatives thereof is realized. When the immune compatible molecule is normally expressed, the expression of genes related to immune response in the pluripotent stem cell or the derivative thereof is inhibited or overexpressed, so that when allogeneic cell therapy is performed, allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the donor cell and the recipient can be improved. When the donor cell is diseased, the expression of the immune compatible molecules can be closed by induction of an exogenous inducer, so that the HLA class I molecules can be reversibly re-expressed on the surface of the donor cell, the antigen presenting capability of the donor cell is recovered, and then the receptor immune system enables the receptor to eliminate the diseased cell by identifying unmatched HLA class I molecules or by cross HLA class I molecule antigen presenting (antigen presenting/identifying between classical incompatible HLA) mutated molecules, so that the clinical safety of the general pluripotent stem cell or the derivative thereof is improved, and the value of the general pluripotent stem cell in clinical application is greatly expanded.

With respect to the third and fourth aspects of the present invention, further, the genes associated with immune response include:

(1) major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(2) major histocompatibility complex-associated genes including at least one of B2M and CIITA.

With respect to the fourth aspect of the present invention, further, the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;

(3) shRNA and/or shRNA-miR targeting major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(4) shRNA and/or shRNA-miR targeting major histocompatibility complex-associated genes including at least one of B2M and CIITA.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 9-SEQ ID NO. 11;

the target sequence of the shRNA and/or shRNA-miR targeting CIITA is selected from one of SEQ ID No. 12-SEQ ID No. 14;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-A is selected from one of SEQ ID No. 15-SEQ ID No. 17;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-B is selected from one of SEQ ID NO. 18-SEQ ID NO. 20;

the target sequence of the target HLA-C shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 21-SEQ ID NO. 23;

the target sequence of the shRNA and/or shRNA-miR of the targeted HLA-DRA is selected from one of SEQ ID NO. 24-SEQ ID NO. 26;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB1 is selected from one of SEQ ID NO. 27-SEQ ID NO. 29;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-DRB3 is selected from one of SEQ ID NO. 30-SEQ ID NO. 31;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB4 is selected from one of SEQ ID NO. 32-SEQ ID NO. 34;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB5 is selected from one of SEQ ID NO. 35-SEQ ID NO. 37;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQA1 is selected from one of SEQ ID NO. 38-SEQ ID NO. 40;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQB1 is selected from one of SEQ ID NO. 41-SEQ ID NO. 43;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPA1 is selected from one of SEQ ID NO. 44-SEQ ID NO. 46;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPB1 is selected from one of SEQ ID NO. 47-SEQ ID NO. 49.

In the first to fourth aspects of the present invention, further, the genome of the pluripotent stem cell or the derivative thereof further comprises an shRNA and/or miRNA processing complex-associated gene and/or an anti-interferon effector molecule, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of target PKR, 2-5As, IRF-3 and IRF-7.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting the PKR is selected from one of SEQ ID NO. 50-SEQ ID NO. 52;

the target sequence of the shRNA and/or shRNA-miR targeting 2-5As is selected from one of SEQ ID NO. 53-SEQ ID NO. 61;

the target sequence of the target IRF-3 shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 62-64;

the target sequence of the shRNA and/or shRNA-miR of the target IRF-7 is selected from one of SEQ ID NO. 65-SEQ ID NO. 67.

With regard to the third and fourth aspects of the present invention, the inducible gene expression system includes at least one of a Tet-Off system, a dimer inducible expression system.

When the inducible gene expression system employed is the Tet-Off system, the expression of small nucleic acid molecules in the cell or derivative thereof can be controlled by the addition of the exogenous inducer tetracycline (Doxycyline, Dox). After the pluripotent stem cells or the derivatives thereof are transplanted into a donor, the expression level of the small nucleic acid molecules can be gradually reduced even by adjusting the addition amount of Dox, so that the cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to the transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In general, Dox is added in an amount of 0 to 100 uM.

In the first to fourth aspects of the present invention, further, the genome of the pluripotent stem cell or the derivative thereof further introduces an exosome-processing synthetic gene comprising at least one of STEAP3, Syndevan-4, an L-aspartate oxidase fragment, CD63-L7Ae and Cx 43S 368A.

The secretion efficiency of the exosome and the encapsulation efficiency of shRNA, shRNA-miR and mature siRNA can be improved by introducing the exosome processing synthetic gene into the genome of the stem cell or the stem cell derivative.

The dimer inducible expression system specifically refers to: dimerized inducers or dimers are used to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP (FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin)), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

In the first to fourth aspects of the present invention, further, the expression frameworks of the amyoid β -targeting shRNA and/or shRNA-miR, major histocompatibility complex gene, major histocompatibility complex-related gene, and anti-interferon effector molecule are as follows:

the shRNA expression framework is as follows: the gene sequence sequentially comprises an shRNA sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA sequence and Poly T from 5 'to 3';

wherein the shRNA sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA sequence form a hairpin structure; poly T is a transcription terminator of RNA polymerase III;

shRNA-miR expression framework: and replacing the shRNA target sequence in the shRNA expression frame by using a shRNA-miR sequence.

In the first to fourth aspects of the present invention, further, the introduction of the expression sequence of the Amyloid β inhibitor, the first nucleic acid molecule, the expression sequence of the immune-compatible molecule, the gene associated with the shRNA and/or miRNA processing complex, the anti-interferon effector molecule, the inducible gene expression system, and the synthetic gene for exosome processing is performed by a method of viral vector interference, non-viral vector transfection, or gene editing, preferably by gene knock-in.

In the first to fourth aspects of the present invention, further, the introduction site of the expressed sequence of the Amyloid β inhibitor, the expressed sequence of the immune-compatible molecule, the shRNA and/or miRNA processing complex-related gene, the anti-interferon effector molecule, the inducible gene expression system, and the exosome processing synthetic gene is a genome safety site, preferably one or more of AAVS1 safety site, eGSH safety site, and H11 safety site.

With respect to the first to fourth aspects of the present invention, further, the pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, or induced pluripotent stem cells;

the pluripotent stem cell derivative comprises an adult stem cell, each germ layer cell or a tissue or organ into which the pluripotent stem cell is differentiated;

the adult stem cells include mesenchymal stem cells or neural stem cells.

In a fifth aspect of the present invention, there is provided:

the application of the pluripotent stem cells or the derivatives thereof and the exosomes secreted by the pluripotent stem cells in preparing the preparation or the medicine for treating the Alzheimer's disease.

In a sixth aspect of the present invention, there is provided:

an exosome secreted by the pluripotent stem cell or a derivative thereof.

The invention has the beneficial effects that:

1. the pluripotent stem cells or the derivatives thereof provided by the first aspect of the invention can be applied to autologous cell-induced iPSCs or MSCs low-immunogenicity cells. After the expression sequence of shRNA/shRNA-miR of the Amyloid beta inhibiting factor targeting Amyloid beta is introduced into the genome of iPSCs induced by autologous cells, the iPSCs can express a large amount of shRNA/shRNA-miR of the targeting Amyloid beta and are wrapped by exosomes secreted by the cells. The exosome carries the inhibitory factors to be combined with target cells and then releases the inhibitory factors, thereby blocking an Amyloid beta pathway, relieving immune suppression, activating an immune system and effectively treating the Alzheimer disease.

2. The pluripotent stem cells or derivatives thereof provided by the second aspect of the invention may also be used in allogeneic cell therapy. Because the B2M and CIITA genes in the pluripotent stem cells or the derivatives thereof are knocked out, the pluripotent stem cells or the derivatives thereof have low immunogenicity, and when the pluripotent stem cells or the derivatives thereof are transplanted into a recipient, RNA interference aiming at immune response related genes, mediated by transcription products of a small nucleic acid molecule coded by a first nucleic acid molecule and a second nucleic acid molecule, only acts on donor cells and does not interfere with the genome of cells of the recipient. Improving the immune compatibility between the graft and the recipient. The implant can continuously express shRNA/shRNA-miR targeting the Amyloid beta in a receptor endogenesis manner, and after the inhibiting factors are wrapped by the exosome, the exosome carries the inhibiting factors to be combined with target cells, so that the inhibiting factors are released, the Amyloid beta pathway is blocked, the immunosuppression is relieved, the immune system is activated, and the Alzheimer's disease can be effectively treated.

3. The pluripotent stem cells or derivatives thereof provided by the third aspect of the invention have immune compatibility, and can eliminate or reduce allogeneic immune rejection response. Furthermore, the RNA interference program of the pluripotent stem cell or the derivative thereof acts only on such an engineered pluripotent stem cell or the derivative thereof. Thus, when such cells or derivatives are transplanted into a recipient, RNA interference directed to a gene associated with an immune response mediated by the transcript of the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule acts only on the donor cell and does not interfere with the genome of the recipient cell. An inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and used for regulating and controlling the expression of the first nucleic acid molecule, so that the immune compatibility of the pluripotent stem cell or the derivative thereof is reversible.

4. The pluripotent stem cell or the derivative thereof provided by the fourth aspect of the invention has an immune-compatible molecule expression sequence introduced into its genome, so that the pluripotent stem cell or the derivative thereof has low immunogenicity, and when the pluripotent stem cell or the derivative thereof is transplanted into a recipient, RNA interference directed to an immune response-related gene mediated by a transcription product of a small nucleic acid molecule encoded by a first nucleic acid molecule and a second nucleic acid molecule only acts on a donor cell, and does not interfere with the genome of the recipient cell. Improving the immune compatibility between the graft and the recipient. The transplant can continuously express shRNA/shRNA-miR of the targeted Amyloid beta in a receptor endogenous source, and after the inhibiting factors are wrapped by the exosome, the exosome carries the inhibiting factors to be combined with the target cell and then releases the inhibiting factors, so that the Amyloid beta pathway is blocked, the immune inhibition is relieved, the immune system is activated, and the Alzheimer's disease can be effectively treated.

Furthermore, the genome of the pluripotent stem cell or the derivative thereof provided by the fourth aspect of the invention is also introduced with an inducible gene expression system, the inducible gene expression system can regulate and control the expression of the immune compatible molecules, and the inducible gene expression system is regulated and controlled by an exogenous inducer, so that the on and off of the inducible gene expression system are controlled by adjusting the addition amount, the sustained action time and the type of the exogenous inducer, and the expression quantity of the expression sequence of the immune compatible molecules is further controlled, thereby realizing the reversible regulation and control of the immune compatibility of the pluripotent stem cell or the derivative thereof. When the inducible gene expression system is started, the transcription product of the small molecule nucleic acid which is normally expressed and a second nucleic acid molecule which is introduced into the 3' UTR region of the immune response related gene is specifically combined, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the transplant and the recipient can be improved. When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules and the interference effect of the small nucleic acid molecules on mRNA of immune response related genes are stopped, the normal expression of the immune related genes is recovered, the antigen presenting capability of graft cells is further recovered, the receptor can remove the pathological graft, the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells or the derivatives thereof in clinical application is greatly expanded.

5. The pluripotent stem cells or the derivatives thereof can gradually reduce the expression amount of small nucleic acid molecules in the pluripotent stem cells or the derivatives thereof by adjusting the addition amount and the sustained action time of the exogenous inducer, so that the donor cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In this case, even though mismatched HLA class I molecules are expressed on the surface of the graft cells, they are compatible with the recipient immune system.

Drawings

Figure 1 is a plasmid map of Cas9 (D10A).

FIG. 2 is a plasmid map of sgRNA Clone AAVS 1-1.

FIG. 3 is a plasmid map of sgRNA Clone AAVS 1-2.

FIG. 4 is a plasmid map of sgRNA clone B2M-1.

FIG. 5 is a plasmid map of sgRNA clone B2M-2.

FIG. 6 is a plasmid map of sgRNA clone B2M-3.

FIG. 7 is a plasmid map of sgRNA clone B2M-4.

FIG. 8 is a plasmid map of sgRNA clone CIITA-1.

FIG. 9 is a plasmid map of sgRNA clone CIITA-2.

FIG. 10 is a plasmid map of sgRNA clone CIITA-3.

FIG. 11 is a plasmid map of sgRNA clone CIITA-4.

FIG. 12 is a plasmid map of AAVS1KI Vector (shRNA, constitutive).

FIG. 13 is a plasmid map of AAVS1KI Vector (shRNA, inducible).

FIG. 14 is a plasmid map of AAVS1KI Vector (shRNA-miR, constitutive).

FIG. 15 is a plasmid map of AAVS1KI Vector (shRNA-miR, inducible).

FIG. 16 is a plasmid map of B2M KI Vector.

FIG. 17 is a plasmid map of CIITA KI Vector.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Experimental materials:

selection of Amyloid beta inhibitors

Amyloid β inhibitor: an Amyloid beta-targeting shRNA or shRNA-miR.

The sequence of the shRNA or shRNA-miR sequence targeting the Amyloid beta used in the embodiment of the invention is shown in table 1.

TABLE 1 sequences of shRNA or shRNA-miR sequences targeting Amyloid beta

2. Construction of Small nucleic acid molecules

The sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of a human, preferably derived from caenorhabditis elegans.

The sequence of the small nucleic acid molecule used in this example was

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.2)；

Designing a first nucleic acid molecule and a second nucleic acid molecule according to the small nucleic acid molecules, wherein the first nucleic acid molecule and the second nucleic acid molecule are respectively as follows:

a first nucleic acid molecule (i.e., the shRNA expression framework or shRNA-miR expression framework of a small nucleic acid molecule):

(1) the sequence composition of the shRNA expression framework of the small nucleic acid molecule is as follows:

5’-CCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.3)N₁...N₂₁TTCAAGAGA(SEQ ID NO.4)N₂₂...N₄₂TTTTTT-3’。

wherein, the first and the second end of the pipe are connected with each other,

a)N₁...N₂₁is the sequence of the small nucleic acid molecule, N₂₂...N₄₂The reverse complementary sequence of the small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;

c) constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d) n represents A or T or G or C base.

(2) shRNA-miR expression framework of small nucleic acid molecules: the small nucleic acid molecule sequence is used for replacing a target sequence in microRNA-30 or microRNA-155 to obtain the target sequence. The specific sequence is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.5)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.6)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT-3’(SEQ ID NO.7)。

wherein the content of the first and second substances,

a)N₁...N₂₁is a small nucleic acid molecule sequence, N₂₂...N₄₂Is a reverse complementary sequence of a small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;

c) constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d) n represents A or T or G or C base, M base represents A or C base;

e) if N1 is a G base, then M₁Is A base; otherwise M₁Is a C base;

f)M₁base and M₂And (4) base complementation.

A second nucleic acid molecule: comprises a reverse complementary sequence of at least 3 repeated small nucleic acid molecule sequences, preferably a reverse complementary sequence of 6-10 repeated small nucleic acid molecule sequences. The reverse complement of the small nucleic acid molecule sequence can be linked by a random Linker sequence.

As an embodiment of the invention, the second nucleic acid molecule is formed by connecting the random sequence of the first 10nt and the reverse complement of the sequence of 8 repeated small nucleic acid molecules through a random linker sequence (CGTA):

5’-atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTA-3’(SEQ ID NO.8)。

3. selection of immune compatible molecules

The types and sequences of the immune-compatible molecules used in the examples of the present invention are shown in tables 2 and 3.

TABLE 2 types and roles of immune-compatible molecules

TABLE 3 target sequences for immune-compatible molecules

shRNA or shRNA-miR immune compatible molecule sequences of the experimental groups in the following tables 8-9 are shRNA or shRNA-miR immune compatible molecules constructed by adopting target sequences in the table 3. Those skilled in the art will understand that: the shRNA or shRNA-miR immune compatible molecule constructed by other target sequences can also realize the technical effect of the invention and all fall into the protection scope of the claims of the invention.

Selection of shRNA/miRNA processing Complex genes and anti-Interferon Effector molecules

(1) selection of shRNA/miRNA processing Complex Gene

shRNA/miRNA processing complex genes used in the present invention include shRNA and/or miRNA processing machinery that can induce off-expression. The shRNA and/or miRNA processor capable of inducing closed expression specifically comprises: drosha (Access number: NM-001100412), Ago1(Access number: NM-012199), Ago2(Access number: NM-001164623), Dicer1(Access number: NM-001195573), export-5 (Access number: NM-020750), TRBP (Access number: NM-134323), PACT (Access number: NM-003690) and DGCR8(Access number: NM-022720).

(2) Selection of anti-Interferon Effector molecules

The anti-interferon effector molecules used in the invention comprise shRNA and/or shRNA-miR expression sequences which can induce closed expression and aim at inhibiting PKR, 2-5As, IRF-3 and IRF-7 genes so As to reduce the interferon reaction induced by dsRNA and avoid generating cytotoxicity.

Wherein the target sequences of the anti-interferon effector molecules are shown in Table 4.

TABLE 4 target sequences for anti-interferon effector molecules

The anti-interferon effector molecule sequences of the experimental groups in the following tables 8-9 are all shRNA or shRNA-miR constructed by adopting the target sequences in the table 4. Those skilled in the art will understand that: the technical effect of the invention can be realized by shRNA or shRNA-miR anti-interferon effector molecules constructed by other target sequences, and the shRNA or shRNA-miR anti-interferon effector molecules fall into the protection scope of the claims of the invention.

5. Selection of exosome processing synthetic genes

The exosome processing synthetic gene is selected from at least one of STEAP3(NM _182915), Syndecano-4 (NM _002999), L-aspartate oxidase fragment (SEQ ID NO.68), CD63-L7Ae (SEQ ID NO.69) and Cx 43S 368A. Wherein Cx 43S 368A is obtained by mutating S (serine) to A (alanine)) at position 368 of Cx43 (NM-000165).

6. Selection of Stem cell vectors

The stem cell carrier in the embodiment of the invention is a pluripotent stem cell, and the pluripotent stem cell can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs and EBs cells.

Wherein the preparation method of the pluripotent stem cells comprises the following steps:

ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.

And (3) iPSCs: using an episomal-iPSCs induction system (6F/BM1-4C), pE3.1-OG- -KS and pE3.1-L-Myc- -hmiR302 cluster were electrotransferred into somatic cells, RM1 medium was cultured for 2 days, 2 days with 2uM Parnate-containing BioCISO-BM1 medium, 2 days with 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD 03254901-containing BioCISO-BM1 medium, and then cultured continuously with BioCISO medium without other substances for about 17 days, iPSCs clonal cells were picked, and the picked iPSCs clonal cells were purified, digested, and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

hPSCs-MSCs: iPSCs were cultured for 25 days in BioCISO medium containing 10uM TGF β inhibitor SB431542 until 80-90 cell confluence (2mg/mL Dispase), 1:3 passaging was performed on Matrigel-coated plates, followed by ESC-MSC medium (knockout DMEM medium containing 10% KSR, NEAA, diabody, glutamine, β -mercaptoethanol, 10ng/mL bFGF and SB-431542), fluid was changed every day, and culture was continued for 20 days until 80-90 cell confluence (1:3 passaging), and specific construction methods were as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.

NSCs: iPSCs are cultured for 14 days in an induction medium (knockout DMEM medium containing 10% KSR and TGF-beta inhibitor and BMP4 inhibitor), and rose annular nerve cells are picked and cultured in a low-adhesion culture plate. The medium in the low adhesion plates included DMEM/F12 (containing 1% N2, Invitrogen) and Neurobasal medium (containing 2% B27, Invitrogen) in a ratio of 1:1, along with 20ng/ml bFGF and 20ng/ml EGF. Digestion passages were performed using Accutase. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.

EBs cells: the iPSCs with cell confluency of 95% were digested with BioC-PDE1 for 6min, and the cells were scraped into clumps by mechanical scraping, and the clumps of cells were settled. The settled cell pellet was transferred to a low adhesion plate and incubated with BioCISO-EB1 for 7 days with fluid changes every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and subjected to adherent culture using a BioCISO medium for 7 days, thereby obtaining Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

The pluripotent stem cell derivative also includes adult stem cells, each germ layer cell or tissue, organ into which the pluripotent stem cells are differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

Construction of plasmid vectors

Plasmid vectors used in embodiments of the invention include: cas9(D10A) plasmid, sgRNA plasmid, Donor fragment.

The genes in the plasmids are edited by a CRISPR-Cas9 gene editing system, the used Cas9 protein is Cas9(D10A), Cas9(D10A) is combined with sgRNA which is responsible for specifically recognizing a target sequence (genome DNA of a cell vector), and then the Cas9(D10A) performs single-strand cleavage on the target sequence. The genomic DNA is Double-stranded broken (DSB), and there must be two Cas 9(D10A)/sgRNA groups to cleave the two strands of the genomic DNA of the cell vector separately, and the cleavage distance cannot be too far. The Cas 9(D10A)/sgRNA scheme has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA scheme.

Wherein, the specific sequence of the sgRNA is as follows:

sgRNA-AAVS1-1：5’-TATAAGGTGGTCCCAGCTCG-3’(SEQ ID NO.70)；

sgRNA-AAVS1-2：5’-AGGGCCGGTTAATGTGGCTC-3’(SEQ ID NO.71)；

sgRNA-B2M-1：5’-CTCCTGTTATATTCTAGAAC-3’(SEQ ID NO.72)；

sgRNA-B2M-2：5’-TTTCAGCATCAATGTACCCT-3’(SEQ ID NO.73)；

sgRNA-B2M-3：5’-CGCGAGCACAGCTAAGGCCA-3’(SEQ ID NO.74)；

sgRNA-B2M-4：5’–ACTCTCTCTTTCTGGCCTGG-3’(SEQ ID NO.75)；

sgRNA-CIITA-1：5’-GGCACTCAGAAGACACTGAT-3’(SEQ ID NO.76)；

sgRNA-CIITA-2：5’–AAGGTGTCTGGTCGGAGAGC-3’(SEQ ID NO.77)；

sgRNA-CIITA-3：5’–ACCCAGCAGGGCGTGGAGCC-3’(SEQ ID NO.78)；

sgRNA-CIITA-4：5’–GTCAGAGCCCCAAGGTAAAA-3’(SEQ ID NO.79)。

the specific method for constructing the plasmid vector comprises the following steps:

(1) cas9(D10A) plasmid: obtained directly from an Addgene (plasma 41816, Addgene) subscription.

(2) sgRNA plasmid: the Plasmid is constructed by putting different target sequences into original blank plasmids (Plasmid 41824, Addgene).

The target sequence put into the sgRNA plasmid comprises the sequence of the immune compatible molecule, the sequence of shRNA/miRNA processing complex gene, the sequence of an anti-interferon effector molecule and the sequence of an exosome processing synthetic gene.

(3) Donor fragment (KI plasmid):

a) designing a PCR primer, and amplifying by using a pUC18 plasmid (Takara, Code No.3218) as a template and a high fidelity enzyme (Nanjing Nozan organism, P505-d1) through a PCR method to obtain an Amp (R) -pUC origin fragment;

b) extracting genome DNA of human cells and designing corresponding primers, and then amplifying by using high-fidelity enzyme through a PCR method by taking the genome DNA of human as a template to obtain a recombinant arm;

c) designing PCR amplification primers of KI (Knock-in) plasmid elements, and then carrying out high-fidelity enzyme amplification by using plasmids containing the KI plasmid elements as templates to obtain KI plasmid elements (subclones);

d) the amplified Amp (R) -pUCeorigin fragment, the recombination arm and the KI plasmid element are connected by using multi-fragment recombinase (Nanjing Novozam organism, C113-02) or overlap PCR to form a complete circular plasmid.

Wherein the recombination arms comprise a B2M recombination arm, a CIITA recombination arm and an AAVS1 recombination arm.

The sequence of the B2M recombinant arm is shown as B2M-HR-L (SEQ ID NO.80) and B2M-HR-R (SEQ ID NO. 81).

The sequence of the CIITA recombination arm is shown as CIITA-HR-L (SEQ ID NO.82) and CIITA-HR-R (SEQ ID NO. 83).

The sequence of the AAVS1 recombination arm is shown as AAVS1-HR-L (SEQ ID NO.84) and AAVS1-HR-R (SEQ ID NO. 85).

The plasmids prepared by the embodiment of the invention can be divided into constitutive plasmids and inducible plasmids according to the expression frame type in the plasmids.

The expression frame in the constitutive plasmid comprises shRNA constitutive expression frame and shRNAMIR constitutive expression frame. The expression function of the Donor fragment obtained by enzyme digestion of the constitutive plasmid cannot be regulated after knocking in the stem cell vector genome DNA.

The expression frames in the inducible plasmid comprise shRNA inducible expression frames and shRNAMIR inducible expression frames. After the Donor fragment obtained from the inducible plasmid is digested by enzyme and the stem cell vector genome DNA is knocked in, the expression function of the fragment can be regulated and controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.

The specific sequence requirements and structural composition of the expression frameworks described above are as follows.

(1) The sequence composition of the shRNA constitutive expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACgctagcgccacc(SEQ ID NO.86)N₁...N₂₁TTCAAGAGAN₂₂...N₄₂TTTTTT-3’；

a)N₁...N₂₁shRNA target sequence which is the above-mentioned target sequence, N₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence of the target sequence;

b) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene respectively corresponds to one shRNA expression frame and then is connected seamlessly;

c) when the shRNA constitutive expression frame needs to carry different resistance genes, only the resistance gene sequences in the shRNA constitutive expression frame are different, and other sequences are the same;

d) n represents A or T or G or C base.

(2) The sequence composition of the shRNAmiR constitutive expression framework is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCGM₁N₁...N₂₁TAGTGAAGCCACAGATGTAN₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT-3’；

wherein the content of the first and second substances,

g)N₁...N₂₁shRNAMIR target sequence, N, being the above target sequence₂₂...N₄₂The reverse complement of the shRNAmiR target sequence to the target sequence;

h) when a plasmid constructed by using the shRNAMIR constitutive expression framework needs to express shRNAMIR of a plurality of genes, each gene corresponds to one shRNAMIR expression framework respectively and then is connected seamlessly;

i) when the shRNAMIR constitutive expression framework needs to carry different resistance genes, only the resistance gene sequences in the shRNAMIR constitutive expression framework are different, and other sequences are the same;

j) n represents A or T or G or C base, M base represents A or C base;

k) if N1 is a G base, then M₁Is A base; otherwise M₁Is a C base;

l)M₁base and M₂And (4) base complementation.

(3) The sequence composition of the shRNA inducible expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagctcggtacccgggtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctgctagcgccacc(SEQ ID NO.87)N₁...N₂₁TTCAAGAGAN₂₂...N₄₂TTTTTT-3’；

wherein the content of the first and second substances,

e)N₁...N₂₁the shRNA target sequence corresponding to the target sequence, N₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence and/or the small nucleic acid molecule corresponding to the target sequence;

f) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame respectively and then is connected seamlessly;

g) when the shRNA constitutive expression frame needs to carry different resistance genes, only the resistance gene sequences in the shRNA constitutive expression frame are different, and other sequences are the same;

h) n represents A or T or G or C base.

(4) The sequence composition of the shRNAmiR inducible expression framework is shown in the sequence composition of the shRNAmiR constitutive expression framework.

The plasmid map of Cas9(D10A) constructed by the method is shown in figure 1, the plasmid map of sgRNA of AAVS1 safety site is shown in figure 2-3, the plasmid map of sgRNA of B2M gene is shown in figure 4-7, the plasmid map of sgRNA of CIITA gene is shown in figure 8-11, the plasmid map (constitutive and inducible) of constructed AAVS1KI is shown in figure 12-15, the plasmid map of B2M KI is shown in figure 16, and the plasmid map of CIITA KI is shown in figure 17.

Constructing a stem cell vector:

in the technical scheme of the invention, the safety sites knocked in the genome of the stem cell vector comprise an AAVS1 safety site, an eGSH safety site and an H11 safety site.

The single-cell cloning operation of the knock-in of the AAVS1 gene comprises the following steps:

a) electric transfer program:

donor cell preparation: human pluripotent stem cells;

the kit comprises: human Stem Cell

Kit 1；

The instrument comprises the following steps: an electrotransfer instrument;

culture medium: BioCISO;

induction of plasmid: the corresponding plasmids constructed in the above examples.

b) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.

c) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.

d) The obtained single-cell clone was cultured.

Wherein, the culture reagent of the single cell clone strain comprises:

the culture medium is as follows: BioCISO medium, 300. mu.g/ml G418 and 0.5. mu.g/ml puro. The culture medium needs to be placed at room temperature in advance, placed for 30-60 minutes in a dark condition until the room temperature is recovered, but not placed at 37 ℃ for preheating, so that the activity of the biological molecules is prevented from being reduced.

Matrix glue: hESC grade Matrigel. Before passage or cell recovery, adding the Matrigel working solution into a cell culture bottle dish and shaking up to ensure that the Matrigel completely submerges the bottom of the culture bottle dish and any part of the Matrigel cannot be dried off before use. To ensure that cells adhere better and survive, Matrigel was placed in a 37 ℃ incubator for a period of time: 1:100 Xmatrigel can not be less than 0.5 hour; the 1:200 Xmatrigel cannot be less than 2 hours.

Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH 7.4. The EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure.

Freezing and storing liquid: 60% BioCISO, 30% ESCs grade FBS and 10% DMSO.

The culture step of the single-cell clone strain adopts the routine maintenance subculture process in the field.

Wherein, the optimal passage time is that the overall confluency of the cells reaches 80 to 90 percent.

The optimal ratio of passage is 1: 4-1: 7, and the optimal confluency of the next day after passage is maintained at 20-30%.

The specific passage operation steps in the invention are as follows:

a) discarding the Matrigel from the coated cell culture flask, adding appropriate amount of the above culture medium, and adding 5% CO at 37 deg.C₂Incubation in an incubator;

b) when the cells meet the passage requirements, removing culture medium supernatant, and adding a proper amount of 0.5mM EDTA digestive juice into a cell bottle dish;

c) the cells were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float), blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;

d) centrifuging, discarding supernatant, suspending the cells with culture medium, repeatedly blowing the cells until uniformly mixing, transferring the cells to a petrigel-coated bottle dish, shaking, observing under a mirror without abnormality, shaking, and standing at 37 deg.C and 5% CO₂Culturing in an incubator;

e) observing the adherent survival state of the cells the next day, sucking off the culture medium, and changing the culture medium on time every day.

The gene knock-in detection method comprises the following steps:

1. single cell clone AAVS1 gene knock-in assay.

(1) AAVS1 gene knock-in assays.

The detection principle is as follows:

the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.

The detection method comprises the following steps:

one primer was designed inside (non-recombinant arm portion) the Donor plasmid (KI plasmid), and then the other primer was designed in the genome of the cell (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the target band will appear, otherwise no target band will appear.

The specific sequences of the primers and amplification conditions are shown in the following table.

TABLE 5 detailed sequences of primers for detection of knock-in of AAVS1 Gene and amplification conditions

(2) B2M and CIITA gene knock-in test.

The detection method of the knock-in of the second nucleic acid molecule at the 3' UTR of B2M and CIITA gene was the same as the detection principle of AAVS1, and the PCR detection conditions used were as shown in tables 6 and 7.

TABLE 6 detailed sequences of knock-in detection primers for the B2M Gene and amplification conditions

TABLE 7 specific sequences of CIITA Gene knock-in detection primers and amplification conditions

Selected plasmids were knocked into the stem cell vector genome using techniques conventional in the art:

according to the grouping in the following tables 6 and 7, the sequence of the Amyloid beta inhibitor, the sequence of the immune compatible molecule, the sequence of the shRNA/miRNA processing complex gene, the sequence of the anti-interferon effector molecule and the exosome processing synthetic gene are knocked into the safe locus of the stem cell expression vector (stem cell vector) by adopting the conventional technology in the field, so as to obtain different types of constitutive stem cell expression vectors and inducible stem cell expression vectors, and detect the expression feasibility of the constitutive stem cell expression vectors and the inducible stem cell expression vectors.

TABLE 6 constitutive knock-in expression experiment grouping

Wherein a "+" symbol indicates a knock-in of a gene or nucleic acid sequence and a "-" symbol indicates a knock-out of a gene.

General principle: shRNA (or shRNA-miR) of the targeted inhibition factor is put into a shRNA (or shRNA-miR) expression frame 2 of the corresponding plasmid, shRNA (or shRNA-miR) of the other inhibition factors are put into a shRNA (or shRNA-miR) expression frame 1 of the corresponding plasmid, and the gene sequence is put into an MCS.

B2M-3 ' UTR-miRNA-focus or CIITA-3 ' UTR-miRNA-focus, i.e. the second nucleic acid molecule (SEQ ID NO.8), is knocked into the 3 ' UTR region of the B2M and CIITA genes, respectively.

The B2M/CIITA-3 'UTR-shRNA is an shRNA expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, specifically targets a transcription product of a second nucleic acid molecule in a B2M gene and a CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

B2M/CIITA-3 'UTR-shRNA-miR is an shRNA-miR expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, a transcription product of a second nucleic acid molecule in a targeting B2M gene and CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

CD47 represents the CD47 expression sequence with the knock-in site being the genomic safety site AAVS 1.

If multiple fragments need to be inserted into the expression cassette or MCS, they can be ligated together using EMCV IRESWT (SEQ ID NO.100) and then inserted.

The gene knock-in sgRNA plasmid was: sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1 and sgRNA clone CIITA-2.

sgRNA plasmids used for gene knockout were: sgRNA clone B2M-3, sgRNA clone B2M-4, sgRNA clone CIITA-3 and sgRNA clone CIITA-4.

(1) Aa1 grouping:

shRNA expression framework 2 of AAVS1KI Vector (shRNA, constitutive) plasmid placed shRNA sequences targeting Amyloid β.

(2) Aa2 grouping:

the shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid is provided with shRNA sequences targeting Amyloid beta, the shRNA expression frame 1 is provided with the rest shRNA sequences (including target sequences of B2M/CIITA-3' UTR-shRNA), and MCS is provided with gene sequences.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(3) Aa3 grouping:

and (3) placing an shRNA sequence targeting Amyloid beta into an shRNA expression frame 2 of an AAVS1KI Vector (shRNA, constitutive) plasmid, placing the rest shRNA target sequence into an shRNA expression frame 1, knocking out B2M and CIITA, and placing MCS into a gene sequence.

(4) Aa4 grouping:

the shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid is placed into the shRNA sequence of the target Amyloid beta, the shRNA expression frame 1 is placed into the rest shRNA target sequence, and the MCS is placed into the gene sequence.

(5) Ab1 groups:

the shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid is placed into an shRNA-miR sequence targeting Amyloid beta.

(6) Ab2 groups:

shRNA-miR sequences of targeting Amyloid beta are placed in an shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive type) plasmid, the rest shRNA-miR target sequences (including target sequences of B2M/CIITA-3' UTR-shRNA-miR) are placed in an shRNA-miR expression frame 1, and gene sequences are placed in an MCS.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(7) Ab3 groups:

shRNA-miR sequence of a targeting Amyloid beta is placed in a shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid, the rest shRNA-miR target sequence is placed in a shRNA-miR expression frame 1, B2M and CIITA are knocked out, and MCS is placed in a gene sequence.

(8) Ab4 groups:

shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid is placed into shRNA-miR sequence of targeting Amyloid beta, shRNA-miR expression frame 1 is placed into other shRNA-miR target sequence, and MCS is placed into gene sequence.

TABLE 9 inducible knock-in expression experiment grouping

The general principle is shown above in the constitutive knock-in expression experimental group.

(1) B1 grouping:

shRNA expression frame 2 of AAVS1KI Vector (shRNA, inducible) plasmid is placed into an shRNA sequence of a target Amyloid beta, shRNA expression frame 1 is placed into the rest shRNA target sequence (including the target sequence of B2M/CIITA-3' UTR-shRNA), and MCS is placed into a gene sequence. Adding a Tet-Off system induction system.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(2) B2 grouping:

shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, inducible) plasmid is placed into shRNA-miR sequence of targeting Amyloid beta, shRNA-miR expression frame 1 is placed into other shRNA-miR target sequence (including target sequence of B2M/CIITA-3' UTR-shRNA-miR), and MCS is placed into gene sequence. Adding a Tet-Off system induction system.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(3) B3 grouping:

(4) B4 grouping:

Wherein, when the constitutive knock-in and the inducible knock-in are used for immune compatible reconstruction, the constitutive knock-in and the inducible knock-in can be firstly reconstructed on hPSCs and then differentiated into derivatives of pluripotent stem cells for application after the reconstruction is finished; the immune compatibility can also be modified after differentiation of hPSCs into derivatives of pluripotent stem cells.

The Tet-Off system in the invention specifically comprises the following steps:

in the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of the gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

The sequence of the Tet-Off system and one or more immune compatible molecules is knocked into a genome safety site of the pluripotent stem cell, and the expression of the immune compatible molecules is accurately turned on or Off through the addition of tetracycline, so that the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof can be reversibly regulated and controlled.

Detecting the inhibitory effect of the pluripotent stem cells or the derivatives thereof expressing the targeted Amyloid beta inhibitor on Amyloid beta:

the experimental group protocols in Table 6 and Table 7 were typed into iPSCsGenome safety locus of MSCs, NSCs and EBs cells at 37 ℃ and 0.5% CO₂Culturing in an incubator, collecting culture medium supernatant, and extracting exosomes in the culture supernatant by using an exosome extraction kit (BestBio, lot # BB-3901) for cells containing a knock-in exosome processing synthetic gene sequence. Centrifuging culture supernatant at 37 deg.C for 15min at 3000g, collecting supernatant, centrifuging at 4 deg.C for 20min at 10000g, collecting supernatant, adding extractive solution A at a ratio of 4:1, reversing the upper and lower parts for 1min, and standing at 37 deg.C overnight. Centrifuging at 37 deg.C for 60min at 10000g, and collecting precipitate. Then adding the extracted Amyloid beta inhibitor or an exosome containing the Amyloid beta inhibitor into a culture medium for culturing the CHO cells expressing the Amyloid beta, culturing for 72h, and then carrying out qPCR detection to detect the expression quantity of the Amyloid beta.

The N (control) group refers to amyoid β expressing CHO cells cultured without addition of an amyoid β inhibitor. The method specifically comprises the following steps: untreated, Amyloid β -expressing CHO cells were incubated at 37 ℃ for 30 minutes, the cells were washed 2 times with PBS and FITC-labeled Amyloid β fusion protein was added to the tube and incubated at 37 ℃ for 30 minutes.

The results of the tests of the respective experimental groups are shown in Table 10.

TABLE 10 qPCR assay of Amyloid beta inhibitor expression Effect of pluripotent Stem cells or their derivatives

As can be seen from the above table, the exosome-encapsulated amyoid β inhibitory factor expressed by the pluripotent stem cell or its derivative of the present invention can effectively inhibit the expression of amyoid β in the target cell. And the inhibition degree is relatively constant in each group, so that the amyoid beta inhibitor expressed by the pluripotent stem cell derivative is not influenced by cell differentiation morphology and other exogenous genes (immune compatibility modification).

The application of the pluripotent stem cell expressing the targeted Amyloid beta inhibitor in the treatment of Alzheimer's disease:

cells (MSCs) of the inhibition factor-only expression protocol group (Aa1) were selected for testing.

In the humanized NSG mouse tumor model, groups of experimental cells (hPSCs and hPSCs-derived derivatives (hPSCs-MSCs, hPSCs-NSCs, hPSCs-EBs) capable of expressing Amyloid beta inhibitory factor) were injected, and the effect of treating Alzheimer's disease was observed using the water maze test. To avoid the problem of immune compatibility, the immunocytes used are derived from the same person as the hPSCs and derivatives of hPSCs.

The method comprises the following specific steps:

in humanized NSG mice (The Jackson Laboratory (JAX)), human immune cells from The same donor are injected to reconstitute The immune system of The mice. After 2 weeks, the mice were anesthetized with 10% chloral hydrate and 5. mu.L of condensed Abeta.1-42 (80 pmol/. mu.L) was injected into the bilateral ventricles of the mice at once to prepare a mouse Alzheimer's disease model. Test group was subjected to tail vein injection of 200. mu.L PBS (containing 10)⁶The pluripotent stem cell derivative expressing an anti-Amyloid β inhibitory factor, which is derived from the same donor as the human immune cell) for treating alzheimer's disease. The treatment effect is judged by a Morris water maze test. The control group was a mouse model injected with 200 μ L PBS (containing pluripotent stem cells and derivatives thereof that do not express Amyloid β inhibitor).

The water maze experiment is a behavior experiment method for detecting the learning and memory ability of spatial positions of animals. The water maze consists of a black round water pool and a movable organic glass platform, the area of the water pool is 122cm multiplied by 75cm, the height of the organic glass platform is 50cm, the length and the width are both 10cm, the platform is 1cm lower than the water surface, and the water temperature control range of the water pool is 23 +/-2 ℃.

The water maze experiment is divided into a training period and a testing period.

A training period: one day before the experiment, the mice were familiar with the environment of the water maze for 1 min; training the mice of each group, wherein the training period lasts for 5 days, the mice of each group of experiment are respectively put into water from the east quadrant, the west quadrant, the south quadrant and the north quadrant of the water pool to the pool wall every day, the escape latency time of the mice for finding the platform is recorded, and if the mice still do not find the platform for more than 1min, the mice are guided to the platform to stay for 30 s.

And (3) testing period: and taking the 6 th day after the training period as a testing period, removing the platform in the water pool, putting each group of mice into each quadrant respectively, monitoring the movement track of the mice by using Any-size software, recording the times of the mice passing through the original platform position and the escape latency within 1min, and calculating the average positioning navigation capacity (latency time) and the space exploration capacity (swimming distance) of the mice.

The shorter the latency time or the shorter the swimming distance, the better the effect of the treatment on Alzheimer's disease.

The results of the tests of the respective experimental groups are shown in Table 11.

TABLE 11 therapeutic Effect of Amyloid beta inhibitor-expressing pluripotent Stem cells on Alzheimer's disease

Wherein, denotes p <0.05 compared to control.

From the above table, it can be seen that the latency time of mice treated with mice injected with hPSCs expressing Amyloid β inhibitor and hPSCs derived derivative is significantly shortened, and the swimming distance is also significantly shortened, which can indicate that the learning and memory function of mice in alzheimer model can be improved, and the effect of treating alzheimer is achieved.

Immune compatibility testing of pluripotent stem cells expressing Amyloid β inhibitors:

by utilizing the characteristic of low immunogenicity of the MSCs, in a humanized NSG mouse Alzheimer disease model, hPSCs sources capable of expressing the Amyloid beta inhibitory factor are injected into the humanized NSG mouse, so that the effect of the humanized NSG mouse on Alzheimer disease treatment is observed. Wherein the immunocyte and the MSCs derived from hPSCs are derived from non-same human.

The control group is a NSG mouse Alzheimer disease model without MSCs cell injection;

the Dox addition group is: mice were continuously fed with 0.5mg/mL of Dox in the mouse diet starting with injection of Amyloid β inhibitor expressing cells until the end of the experiment. The sequences (immune compatible molecules) into which Dox can be knocked in by using an inducer exhibit an effect of not expressing.

The results of the reversible expression test for the immune-compatible molecule inducible expression panel are shown in table 12.

TABLE 12 reversible expression test results for immune-compatible molecule-inducible expression panels

Wherein, denotes p <0.05 compared to control.

The above experiment shows that: in the treatment of Alzheimer's disease. MSCs that express only suppressive factors (group 2), which have low immunogenicity and can exist within a foreign body for a certain period of time, can exert a certain therapeutic effect, while those that are immuno-compatibly engineered (groups 3-7, including constitutive and reversible inducible immuno-compatibility), which have better immuno-compatibility effects and longer in vivo (or can coexist for a long period of time) than MSCs that have not been immuno-compatibly engineered, exert better therapeutic effects, whereas group 4 is the B2M and CIITA gene knock-out group, which completely eliminate the effects of HLA-I and HLA-II molecules, and thus have the best therapeutic effects. However, there are groups 6-9 protocol settings because of their constitutive immune compatible modifications (knock-in/knock-out) and their inability to clear when a graft becomes mutated or otherwise undesirable. In groups 8-9, the mice injected with the suppressor cells were shown to have abolished the immune compatibility effect by administering Dox inducer (always administered) to the mice at the same time as the injection of the suppressor cells into the mice, which was found in vivo for a time period comparable to that of the MSCs without immune compatibility modification, and which had therapeutic effect comparable to that of the MSCs without immune compatibility modification.

The embodiments of the present invention are not limited to the embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents and are included in the scope of the present invention.

SEQUENCE LISTING

<110> future Chile regenerative medicine institute (Guangzhou) Co., Ltd

Wang Linli

<120> pluripotent stem cell expressing Amyloid beta targeted inhibitory factor, derivative and application thereof

<130>

<160> 101

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> human

<400> 1

gcagactgaa catgcacatg a 21

<210> 2

<211> 21

<212> DNA

<213> Caenorhabditis elegans

<400> 2

ttgtactaca caaaagtact g 21

<210> 3

<211> 315

<212> DNA

<213> Artificial sequence

<400> 3

ccactcccta tcagtgatag agaaaagtga aagtcgagtt taccactccc tatcagtgat 60

agagaaaagt gaaagtcgag tttaccactc cctatcagtg atagagaaaa gtgaaagtcg 120

agtttaccac tccctatcag tgatagagaa aagtgaaagt cgagctcggt acccgggtcg 180

aggtaggcgt gtacggtggg aggcctatat aagcagagct cgtttagtga accgtcagat 240

cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag 300

cctgctagcg ccacc 315

<210> 4

<211> 9

<212> DNA

<213> Artificial sequence

<400> 4

ttcaagaga 9

<210> 5

<211> 119

<212> DNA

<213> Artificial sequence

<400> 5

gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60

cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

tagtgaagcc acagatgta 19

<210> 7

<211> 119

<212> DNA

<213> Artificial sequence

<400> 7

tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60

tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119

<210> 8

<211> 210

<212> DNA

<213> Artificial sequence

<400> 8

attctagata cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta 60

cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt 120

gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt gtgtagtaca 180

acgtacagta cttttgtgta gtacaacgta 210

<210> 9

<211> 21

<212> DNA

<213> human

<400> 9

gggagcagag aattctctta t 21

<210> 10

<211> 21

<212> DNA

<213> human

<400> 10

ggagcagaga attctcttat c 21

<210> 11

<211> 21

<212> DNA

<213> human

<400> 11

gagcagagaa ttctcttatc c 21

<210> 12

<211> 21

<212> DNA

<213> human

<400> 12

gctacctgga gcttcttaac a 21

<210> 13

<211> 21

<212> DNA

<213> human

<400> 13

ggagcttctt aacagcgatg c 21

<210> 14

<211> 21

<212> DNA

<213> human

<400> 14

gggtctccag tatattcatc t 21

<210> 15

<211> 21

<212> DNA

<213> human

<400> 15

gctcccactc catgaggtat t 21

<210> 16

<211> 21

<212> DNA

<213> human

<400> 16

ggtatttctt cacatccgtg t 21

<210> 17

<211> 21

<212> DNA

<213> human

<400> 17

aggagacacg gaatgtgaag g 21

<210> 18

<211> 21

<212> DNA

<213> human

<400> 18

gctcccactc catgaggtat t 21

<210> 19

<211> 21

<212> DNA

<213> human

<400> 19

ggtatttcta cacctccgtg t 21

<210> 20

<211> 21

<212> DNA

<213> human

<400> 20

ggaccggaac acacagatct a 21

<210> 21

<211> 21

<212> DNA

<213> human

<400> 21

ttcttacttc cctaatgaag t 21

<210> 22

<211> 21

<212> DNA

<213> human

<400> 22

aagttaagaa cctgaatata a 21

<210> 23

<211> 21

<212> DNA

<213> human

<400> 23

aacctgaata taaatttgtg t 21

<210> 24

<211> 21

<212> DNA

<213> human

<400> 24

gggtctggtg ggcatcatta t 21

<210> 25

<211> 21

<212> DNA

<213> human

<400> 25

ggtctggtgg gcatcattat t 21

<210> 26

<211> 21

<212> DNA

<213> human

<400> 26

gcatcattat tgggaccatc t 21

<210> 27

<211> 21

<212> DNA

<213> human

<400> 27

gatgaccaca ttcaaggaag a 21

<210> 28

<211> 21

<212> DNA

<213> human

<400> 28

gaccacattc aaggaagaac t 21

<210> 29

<211> 21

<212> DNA

<213> human

<400> 29

gctttcctgc ttggcagtta t 21

<210> 30

<211> 21

<212> DNA

<213> human

<400> 30

gcgtaagtct gagtgtcatt t 21

<210> 31

<211> 21

<212> DNA

<213> human

<400> 31

gacaatttaa ggaagaatct t 21

<210> 32

<211> 21

<212> DNA

<213> human

<400> 32

ggccatagtt ctccctgatt g 21

<210> 33

<211> 21

<212> DNA

<213> human

<400> 33

gccatagttc tccctgattg a 21

<210> 34

<211> 21

<212> DNA

<213> human

<400> 34

gcagatgacc acattcaagg a 21

<210> 35

<211> 21

<212> DNA

<213> human

<400> 35

gcagcaggat aagtatgagt g 21

<210> 36

<211> 21

<212> DNA

<213> human

<400> 36

gcaggataag tatgagtgtc a 21

<210> 37

<211> 21

<212> DNA

<213> human

<400> 37

ggttcctgca cagagacatc t 21

<210> 38

<211> 21

<212> DNA

<213> human

<400> 38

ggatgtggaa cccacagata c 21

<210> 39

<211> 21

<212> DNA

<213> human

<400> 39

gatgtggaac ccacagatac a 21

<210> 40

<211> 21

<212> DNA

<213> human

<400> 40

gtggaaccca cagatacaga g 21

<210> 41

<211> 21

<212> DNA

<213> human

<400> 41

gggtagcaac tgtcaccttg a 21

<210> 42

<211> 21

<212> DNA

<213> human

<400> 42

ggatttcgtg ttccagttta a 21

<210> 43

<211> 21

<212> DNA

<213> human

<400> 43

gcatgtgcta cttcaccaac g 21

<210> 44

<211> 21

<212> DNA

<213> human

<400> 44

gctcacagtc atcaattata g 21

<210> 45

<211> 21

<212> DNA

<213> human

<400> 45

gccctgaaga cagaatgttc c 21

<210> 46

<211> 21

<212> DNA

<213> human

<400> 46

gcggaccatg tgtcaactta t 21

<210> 47

<211> 21

<212> DNA

<213> human

<400> 47

gcctgatagg acccatattc c 21

<210> 48

<211> 21

<212> DNA

<213> human

<400> 48

gcatccaata gacgtcattt g 21

<210> 49

<211> 21

<212> DNA

<213> human

<400> 49

gcgtcactgg cacagatata a 21

<210> 50

<211> 21

<212> DNA

<213> human

<400> 50

ggatggattt gattatgatc c 21

<210> 51

<211> 21

<212> DNA

<213> human

<400> 51

ggaccttgga acaatggatt g 21

<210> 52

<211> 21

<212> DNA

<213> human

<400> 52

gctaattctt gctgaacttc t 21

<210> 53

<211> 21

<212> DNA

<213> human

<400> 53

gcagttctgt tgccactctc t 21

<210> 54

<211> 21

<212> DNA

<213> human

<400> 54

gggagagttc atccaggaaa t 21

<210> 55

<211> 21

<212> DNA

<213> human

<400> 55

ggagagttca tccaggaaat t 21

<210> 56

<211> 21

<212> DNA

<213> human

<400> 56

gggttggttt atccaggaat a 21

<210> 57

<211> 21

<212> DNA

<213> human

<400> 57

ggatcagaag agaagccaac g 21

<210> 58

<211> 21

<212> DNA

<213> human

<400> 58

ggttcaccat ccaggtgttc a 21

<210> 59

<211> 21

<212> DNA

<213> human

<400> 59

ggaggaactt tgtgaacatt c 21

<210> 60

<211> 21

<212> DNA

<213> human

<400> 60

gctgtaagaa ggatgctttc a 21

<210> 61

<211> 21

<212> DNA

<213> human

<400> 61

gctgcaggca ggattgtttc a 21

<210> 62

<211> 19

<212> DNA

<213> human

<400> 62

gcctcgagtt tgagagcta 19

<210> 63

<211> 19

<212> DNA

<213> human

<400> 63

agacattctg gatgagtta 19

<210> 64

<211> 19

<212> DNA

<213> human

<400> 64

gggtctgtta cccaaagaa 19

<210> 65

<211> 21

<212> DNA

<213> human

<400> 65

ggacactggt tcaacacctg t 21

<210> 66

<211> 21

<212> DNA

<213> human

<400> 66

ggttcaacac ctgtgacttc a 21

<210> 67

<211> 21

<212> DNA

<213> human

<400> 67

acctgtgact tcatgtgtgc g 21

<210> 68

<211> 1607

<212> DNA

<213> human

<400> 68

atgaatactc tccctgaaca ttcatgtgac gtgttgatta tcggtagcgg cgcagccgga 60

ctttcactgg cgctacgcct ggctgaccag catcaggtca tcgttctaag taaggccggt 120

aacgaggttc aacattttat gcccagggcg gtattgccgc cgtgtttgat aaactgacag 180

cattgactcg catgtggaag acacattgat tgccggggct ggtatttgcg atcgccatgc 240

agttgaattt gtcgccagca atgcacgatc ctgtgtgcaa tggctaatcg accagggggt 300

gttgtttgat acccacattc aaccgaatgg cgaagaaagt taccatctga cccgtgaagg 360

tggacatagt caccgtcgta ttcttcatgc cgccgacgcc accggtagag aagtagaaac 420

cacgctggtg agcaaggcgc tgaaccatcc gaatattcgc gtgctggagc gcagcaacgc 480

ggttgatctg attgtttctg acaaaattgg cctgccgggc acgcgacggg ttgttggcgc 540

gtgggtatgg aaccgtaata aagaaacggt ggaaacctgc cacgcaaaag cggtggtgct 600

ggcaaccggc ggtgcgtcga aggtttatca gtacaccacc aatccggata tttcttctgg 660

cgatggcatt gctatggcgt ggcgcgcagg ctgccggttg ccaatctcga tttaatcagt 720

tccaccctac cgcgctatat cacccacagg cacgcaattt cctgttaaca gaagcactgc 780

gcggcgaggc gcttatctca agcgcccgga tggtacgcgt ttatccgatt ttgatgagcg 840

cggcgaactg ccccgcgcga tattgtcgcc cgcgccattg accatgaaat gaaacgcctc 900

ggcgcagatt gtatgttcct tgatatcagc cataagcccg ccgattttat tcgccagcat 960

ttcccgatga tttatgaaaa gctgctcggg ctgggattga tctcacacaa gaaccggtac 1020

cgattgtgcc tgctgcacat tatacctgcg gtggtgtaat ggttgatgat catgggcgta 1080

cggacgtcga gggcttgtat gccattggcg aggtgagtta taccggctta cacggcgcta 1140

accgcatggc ctcgaattca ttgctggagt gtctggtcta tggctggtcg gcggcggaag 1200

atatcaccag acgtatgcct tatgcccacg acatcagtac gttaccgccg tgggatgaaa 1260

gccgcgttga gaaccctgac gaacggtagt aattcagcat aactggcacg agctacgtct 1320

gtttatgtgg gattacgttg gcattgtgcg cacaacgaag cgcctggaac gcgccctgcg 1380

gcggataacc atgctccaac aagaaataga cgaatattac gcccatttcc gcgtctcaaa 1440

taatttgctg gagctgcgta atctggtaca ggttgccgag ttgattgttc gctgtgcaat 1500

gatgcgtaaa gagagtcggg gttgcatttc acgctggatt atccggaact gctcacccat 1560

tccggtccgt cgatccttcc cccggcaatc attacataaa cagataa 1607

<210> 69

<211> 411

<212> DNA

<213> human

<400> 69

ggaagtggtg ccggcaccgg cggcatgtac gtgcgcttcg aggtgcccga ggacatgcag 60

aacgaggccc tgagcctgct ggaaaaagtg cgcgagagcg gcaaagtgaa gaagggcacc 120

aacgaaacca ccaaggccgt ggaacggggc ctggccaagc tggtgtatat cgccgaggac 180

gtggaccccc ccgagattgt ggcccatctg cccctgctgt gcgaagagaa gaacgtgccc 240

tacatctacg tgaagtccaa gaacgacctg ggcagagccg tgggcatcga ggtgccatgt 300

gcctctgccg ccatcatcaa cgagggcgag ctgcggaaag aactgggcag cctggtggaa 360

aagatcaagg gcctgcagaa gggttccggt ggatccggtt ccggacgggc t 411

<210> 70

<211> 20

<212> DNA

<213> Artificial sequence

<400> 70

tataaggtgg tcccagctcg 20

<210> 71

<211> 20

<212> DNA

<213> Artificial sequence

<400> 71

agggccggtt aatgtggctc 20

<210> 72

<211> 20

<212> DNA

<213> Artificial sequence

<400> 72

ctcctgttat attctagaac 20

<210> 73

<211> 20

<212> DNA

<213> Artificial sequence

<400> 73

tttcagcatc aatgtaccct 20

<210> 74

<211> 20

<212> DNA

<213> Artificial sequence

<400> 74

cgcgagcaca gctaaggcca 20

<210> 75

<211> 20

<212> DNA

<213> Artificial sequence

<400> 75

actctctctt tctggcctgg 20

<210> 76

<211> 20

<212> DNA

<213> Artificial sequence

<400> 76

ggcactcaga agacactgat 20

<210> 77

<211> 20

<212> DNA

<213> Artificial sequence

<400> 77

aaggtgtctg gtcggagagc 20

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence

<400> 78

acccagcagg gcgtggagcc 20

<210> 79

<211> 20

<212> DNA

<213> Artificial sequence

<400> 79

gtcagagccc caaggtaaaa 20

<210> 80

<211> 900

<212> DNA

<213> Artificial sequence

<400> 80

cctggacttc tccagtactt tctggctgga ttggtatctg aggctagtag gaagggcttg 60

ttcctgctgg gtagctctaa acaatgtatt catgggtagg aacagcagcc tattctgcca 120

gccttatttc taaccatttt agacatttgt tagtacatgg tattttaaaa gtaaaactta 180

atgtcttcct tttttttctc cactgtcttt ttcatagatc gagacatgta agcagcatca 240

tggaggtaag tttttgacct tgagaaaatg tttttgtttc actgtcctga ggactattta 300

tagacagctc taacatgata accctcacta tgtggagaac attgacagag taacatttta 360

gcagggaaag aagaatccta cagggtcatg ttcccttctc ctgtggagtg gcatgaagaa 420

ggtgtatggc cccaggtatg gccatattac tgaccctcta cagagagggc aaaggaactg 480

ccagtatggt attgcaggat aaaggcaggt ggttacccac attacctgca aggctttgat 540

ctttcttctg ccatttccac attggacatc tctgctgagg agagaaaatg aaccactctt 600

ttcctttgta taatgttgtt ttattcttca gacagaagag aggagttata cagctctgca 660

gacatcccat tcctgtatgg ggactgtgtt tgcctcttag aggttcccag gccactagag 720

gagataaagg gaaacagatt gttataactt gatataatga tactataata gatgtaacta 780

caaggagctc cagaagcaag agagagggag gaacttggac ttctctgcat ctttagttgg 840

agtccaaagg cttttcaatg aaattctact gcccagggta cattgatgct gaaaccccat 900

<210> 81

<211> 900

<212> DNA

<213> Artificial sequence

<400> 81

tcaaatctcc tgttatattc tagaacaggg aattgatttg ggagagcatc aggaaggtgg 60

atgatctgcc cagtcacact gttagtaaat tgtagagcca ggacctgaac tctaatatag 120

tcatgtgtta cttaatgacg gggacatgtt ctgagaaatg cttacacaaa cctaggtgtt 180

gtagcctact acacgcatag gctacatggt atagcctatt gctcctagac tacaaacctg 240

tacagcctgt tactgtactg aatactgtgg gcagttgtaa cacaatggta agtatttgtg 300

tatctaaaca tagaagttgc agtaaaaata tgctatttta atcttatgag accactgtca 360

tatatacagt ccatcattga ccaaaacatc atatcagcat tttttcttct aagattttgg 420

gagcaccaaa gggatacact aacaggatat actctttata atgggtttgg agaactgtct 480

gcagctactt cttttaaaaa ggtgatctac acagtagaaa ttagacaagt ttggtaatga 540

gatctgcaat ccaaataaaa taaattcatt gctaaccttt ttcttttctt ttcaggtttg 600

aagatgccgc atttggattg gatgaattcc aaattctgct tgcttgcttt ttaatattga 660

tatgcttata cacttacact ttatgcacaa aatgtagggt tataataatg ttaacatgga 720

catgatcttc tttataattc tactttgagt gctgtctcca tgtttgatgt atctgagcag 780

gttgctccac aggtagctct aggagggctg gcaacttaga ggtggggagc agagaattct 840

cttatccaac atcaacatct tggtcagatt tgaactcttc aatctcttgc actcaaagct 900

<210> 82

<211> 900

<212> DNA

<213> Artificial sequence

<400> 82

cttgacaagt ctcctgctcc tcactatgaa gatcactgtc ccccagccct gtgctccccg 60

cactgtgctg cacgtccacc tccattccac tgcccctccc atccccccat cttgatagca 120

cccttcccag gtgtcaagct gcccctccta gagtgtcctg cctaaacccc ctctcctggc 180

tcctcccgct acagcatgtt ctctgaggac actaaccacg ctggaccttg aactgggtac 240

ttgtggacac agctcttctc caggctgtat cccatgagcc tcagcatcct ggcacccggc 300

ccctgctggt tcagggttgg cccctgcccg gctgcggaat gaaccacatc ttgctctgct 360

gacagacaca ggcccggctc caggctcctt tagcgcccag ttgggtggat gcctggtggc 420

agctgcggtc cacccaggag ccccgaggcc ttctctgaag gacattgcgg acagccacgg 480

ccaggccaga gggagtgaca gaggcagccc cattctgcct gcccaggccc ctgccaccct 540

ggggagaaag tacttctttt tttttatttt tagacagagt ctcactgttg cccaggctgg 600

cgtgcagtgg tgcgatctgg gttcactgca acctccgcct cttgggttca agcgattctt 660

ctgcttcagc ctcccgagta gctgggacta caggcaccca ccatcatgtc tggctaattt 720

ttcattttta gtagagacag ggttttgcca tgttggccag gctggtctca aactcttgac 780

ctcaggtgat ccacccacct cagcctccca aagtgctggg attacaagcg tgagccactg 840

caccgggcca cagagaaagt acttctccac cctgctctcc gaccagacac cttgacaggg 900

<210> 83

<211> 900

<212> DNA

<213> Artificial sequence

<400> 83

cacaccgggc actcagaaga cactgatggg caacccccag cctgctaatt ccccagattg 60

caacaggctg ggcttcagtg gcagctgctt ttgtctatgg gactcaatgc actgacattg 120

ttggccaaag ccaaagctag gcctggccag atgcaccagc ccttagcagg gaaacagcta 180

atgggacact aatggggcgg tgagagggga acagactgga agcacagctt catttcctgt 240

gtcttttttc actacattat aaatgtctct ttaatgtcac aggcaggtcc agggtttgag 300

ttcataccct gttaccattt tggggtaccc actgctctgg ttatctaata tgtaacaagc 360

caccccaaat catagtggct taaaacaaca ctcacattta ttctgctcac atatctgtca 420

tttgagcagg gctcagcggg gacagctcct tctgtcctac tctgtgtcag gtggggcagc 480

ttgagggttg ggctggtgtc acctgaagac tcattcttct gtacgtctga caggcaatgc 540

tggctgttgg ctgggggcct cagtgccact acggaatagt tggctaggac ccctccatgt 600

gggctagttg ggcttcctca tagtatggtg gctgggttgg agggtgtccc aaaaagaaag 660

gaggggatag agagagacca cttttcataa cctagcctta gaagtcacac agtattactt 720

ctgctacata tatatgtttt aagaggcagg gtctcactct gtcgcccagt ctggaatgca 780

gtggtatgat cacggctcac tgcagcctca acctcctggg ctaagtgatc ctcccacctc 840

agcctcccga atagctggga ctacaggtgt gagtcaccaa gcccagttaa tctttagttt 900

<210> 84

<211> 804

<212> DNA

<213> Artificial sequence

<400> 84

tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360

tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

gtcccctcca ccccacagtg gggc 804

<210> 85

<211> 837

<212> DNA

<213> Artificial sequence

<400> 85

actagggaca ggattggtga cagaaaagcc ccatccttag gcctcctcct tcctagtctc 60

ctgatattgg gtctaacccc cacctcctgt taggcagatt ccttatctgg tgacacaccc 120

ccatttcctg gagccatctc tctccttgcc agaacctcta aggtttgctt acgatggagc 180

cagagaggat cctgggaggg agagcttggc agggggtggg agggaagggg gggatgcgtg 240

acctgcccgg ttctcagtgg ccaccctgcg ctaccctctc ccagaacctg agctgctctg 300

acgcggccgt ctggtgcgtt tcactgatcc tggtgctgca gcttccttac acttcccaag 360

aggagaagca gtttggaaaa acaaaatcag aataagttgg tcctgagttc taactttggc 420

tcttcacctt tctagtcccc aatttatatt gttcctccgt gcgtcagttt tacctgtgag 480

ataaggccag tagccagccc cgtcctggca gggctgtggt gaggaggggg gtgtccgtgt 540

ggaaaactcc ctttgtgaga atggtgcgtc ctaggtgttc accaggtcgt ggccgcctct 600

actccctttc tctttctcca tccttctttc cttaaagagt ccccagtgct atctgggaca 660

tattcctccg cccagagcag ggtcccgctt ccctaaggcc ctgctctggg cttctgggtt 720

tgagtccttg gcaagcccag gagaggcgct caggcttccc tgtccccctt cctcgtccac 780

catctcatgc ccctggctct cctgcccctt ccctacaggg gttcctggct ctgctct 837

<210> 86

<211> 253

<212> DNA

<213> Artificial sequence

<400> 86

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgctagcgcc acc 253

<210> 87

<211> 686

<212> DNA

<213> Artificial sequence

<400> 87

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660

gaccgatcca gcctgctagc gccacc 686

<210> 88

<211> 22

<212> DNA

<213> Artificial sequence

<400> 88

ccatagctca gtctggtcta tc 22

<210> 89

<211> 22

<212> DNA

<213> Artificial sequence

<400> 89

ctcttcgtcc agatcatcct ga 22

<210> 90

<211> 22

<212> DNA

<213> Artificial sequence

<400> 90

ccatagctca gtctggtcta tc 22

<210> 91

<211> 20

<212> DNA

<213> Artificial sequence

<400> 91

cacaccttgc cgatgtcgag 20

<210> 92

<211> 24

<212> DNA

<213> Artificial sequence

<400> 92

gcactgaacg aacatctcaa gaag 24

<210> 93

<211> 22

<212> DNA

<213> Artificial sequence

<400> 93

ctcttcgtcc agatcatcct ga 22

<210> 94

<211> 24

<212> DNA

<213> Artificial sequence

<400> 94

gcactgaacg aacatctcaa gaag 24

<210> 95

<211> 20

<212> DNA

<213> Artificial sequence

<400> 95

cacaccttgc cgatgtcgag 20

<210> 96

<211> 22

<212> DNA

<213> Artificial sequence

<400> 96

tgctccgggt ttgtctcaga tg 22

<210> 97

<211> 22

<212> DNA

<213> Artificial sequence

<400> 97

ctcttcgtcc agatcatcct ga 22

<210> 98

<211> 22

<212> DNA

<213> Artificial sequence

<400> 98

tgctccgggt ttgtctcaga tg 22

<210> 99

<211> 20

<212> DNA

<213> Artificial sequence

<400> 99

cacaccttgc cgatgtcgag 20

<210> 100

<211> 590

<212> DNA

<213> Artificial sequence

<400> 100

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590

<210> 101

<211> 24

<212> DNA

<213> Caenorhabditis elegans

<400> 101

tcacaacctc ctagaaagag taga 24

Claims

1.A pluripotent stem cell or a derivative thereof, wherein an expression sequence of an Amyloid β inhibitor is introduced into the genome of the pluripotent stem cell or the derivative thereof; the Amyloid beta inhibitor is at least one of shRNA and shRNA-miR of the targeted Amyloid beta.

2. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the sequence of the Amyloid β -targeting shRNA and shRNA-miR is shown in SEQ ID No. 1.

3. The pluripotent stem cell or derivative thereof according to claim 1, wherein the B2M gene and/or the CIITA gene of the genome of the pluripotent stem cell or derivative thereof is knocked out.

4. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the genome of the pluripotent stem cell or the derivative thereof is also introduced with a first nucleic acid molecule;

and, a second nucleic acid molecule is further introduced into the 3' UTR region of the immune response-associated gene in the pluripotent stem cell or the derivative thereof;

the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, which small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and which small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

5. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the small nucleic acid molecule comprises at least one of a short interfering nucleic acid, a short interfering RNA, a double-stranded RNA, preferably miRNA, shRNA-miR.

6. The pluripotent stem cells or the derivatives thereof according to claim 5, wherein the pluripotent stem cells or the derivatives thereof are derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of humans.

7. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the second nucleic acid molecule comprises the reverse complement of at least 3 repeats of the sequence of the small nucleic acid molecule, preferably 6 to 10 repeats of the sequence of the small nucleic acid molecule.

8. The pluripotent stem cells or the derivatives thereof according to claim 1, wherein the genome of the pluripotent stem cells or the derivatives thereof further comprises an expression sequence of at least one immune compatible molecule for regulating the expression of genes associated with an immune response in the pluripotent stem cells or the derivatives thereof.

9. The pluripotent stem cell or the derivative thereof according to claim 4 or 8, wherein the genes associated with the immune response comprise:

10. The pluripotent stem cell or derivative thereof of claim 8, wherein the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(4) shRNA and/or shRNA-miR targeting a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.

11. The pluripotent stem cell or derivative thereof of claim 10, wherein:

the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 9-SEQ ID NO. 11;

the target sequence of the shRNA and/or shRNA-miR of the targeting CIITA is selected from one of SEQ ID NO. 12-SEQ ID NO. 14;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-A is selected from one of SEQ ID NO. 15-SEQ ID NO. 17;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-DRB1 is selected from one of SEQ ID NO. 27-SEQ ID NO. 29;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB3 is selected from one of SEQ ID NO. 30-SEQ ID NO. 31;

12. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 11, wherein a shRNA and/or miRNA processing complex-associated gene and/or an anti-interferon effector molecule is further introduced into the genome of the pluripotent stem cell or the derivative thereof, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of targeting PKR, 2-5As, IRF-3 and IRF-7.

13. The pluripotent stem cell or the derivative thereof according to claim 12, wherein the target sequence of the PKR-targeting shRNA and/or shRNA-miR is selected from one of SEQ ID No.50 to SEQ ID No. 52;

the target sequence of the shRNA and/or shRNA-miR of the targeted IRF-3 is selected from one of SEQ ID NO. 62-SEQ ID NO. 64;

14. The pluripotent stem cell or the derivative thereof according to claim 2, 11 or 13, wherein the expression frameworks of the Amyloid β -targeting shRNA and/or shRNA-miR, major histocompatibility complex gene, major histocompatibility complex-related gene, anti-interferon effector molecule are as follows:

the shRNA expression framework is as follows: the gene sequence sequentially comprises an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3';

wherein the shRNA target sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA target sequence form a hairpin structure; poly T is a transcription terminator of RNA polymerase III;

shRNA-miR expression framework: and replacing the shRNA target sequence in the shRNA expression frame by using the shRNA-miR target sequence.

15. The pluripotent stem cell or the derivative thereof according to claim 4, 8 or 12, wherein an inducible gene expression system is further introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating the expression of the first nucleic acid molecule and/or the immune-compatible molecule and/or the shRNA and/or the miRNA processing complex-associated gene and/or the anti-interferon effector molecule.

16. The pluripotent stem cells or derivatives thereof according to claim 15, wherein the inducible gene expression system comprises at least one of a Tet-Off system, a dimer inducible expression system.

17. The pluripotent stem cell or derivative thereof according to any one of claims 1 to 16, wherein the genome of the pluripotent stem cell or derivative thereof further comprises an exosome-processing synthetic gene comprising at least one of STEAP3, Syndevan-4, an L-aspartate oxidase fragment, CD63-L7Ae and Cx 43S 368A.

18. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 17, wherein the introduction of the sequence expressing the Amyloid β inhibitor, the first nucleic acid molecule, the sequence expressing an immune-compatible molecule, the gene associated with the shRNA and/or miRNA processing complex, the anti-interferon effector molecule, the inducible gene expression system, the synthetic gene for exosome processing is performed by a method of viral vector interference, non-viral vector transfection or gene editing, preferably by knock-in.

19. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 17, wherein the introduction site of the expression sequence of the Amyloid β inhibitor, the expression sequence of an immune-compatible molecule, the gene associated with shRNA and/or miRNA processing complex, the anti-interferon effector molecule, the inducible gene expression system, the synthetic gene for exosome processing is a genome-safe site, preferably one or more of an AAVS 1-safe site, an eGSH-safe site, and an H11-safe site.

20. The pluripotent stem cell or derivative thereof of any one of claims 1 to 19, wherein:

the pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic cancer cells, or induced pluripotent stem cells;

the adult stem cells include mesenchymal stem cells or neural stem cells.

21. Use of the pluripotent stem cell or the derivative thereof and the exosome secreted by the pluripotent stem cell according to claim 20 for the preparation of a therapeutic agent or a drug for alzheimer's disease.

22. An exosome secreted from the pluripotent stem cell or derivative thereof of any one of claims 1 to 20.