CN114657137A

CN114657137A - Pluripotent stem cell or derivative thereof for expressing BTLA-targeted shRNA and/or shRNA-miR

Info

Publication number: CN114657137A
Application number: CN202011528907.7A
Authority: CN
Inventors: 王淋立; 陈月花; 杨建国; 莫健
Original assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Current assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2022-06-24

Abstract

The invention discloses a pluripotent stem cell or a derivative thereof for expressing a BTLA-targeted shRNA and/or shRNA-miR, wherein an expression sequence of the BTLA-targeted shRNA and/or shRNA-miR is introduced into a genome of the pluripotent stem cell or the derivative thereof. After the pluripotent stem cells or the derivatives thereof express the shRNA and/or shRNA-miR of the target BTLA, the exosomes carry the effector RNA molecules to be combined with the target cells and then release the target cells, so that the BTLA is blocked, the immunosuppression is removed, the immune system is activated, the activity of the T cells is recovered, and the T cells can be effectively eliminated.

Description

Pluripotent stem cell or derivative thereof for expressing BTLA-targeted shRNA and/or shRNA-miR

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell for expressing a target BTLA shRNA and/or shRNA-miR or a derivative thereof.

Background

BTLA (the B and T lymphocyte activator, BTLA) is a novel co-stimulatory molecule of the CD28 superfamily. BTLA is mainly expressed in activated B cells, differentiating Th1 and Th2 cells, but is no longer expressed after polarization of Th2 cells. BTLA is an immunosuppressive receptor and belongs to the type I transmembrane glycoprotein, whose protein structure is similar to that of cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) and programmed death receptor 1(PD-1), and includes an extracellular region, a transmembrane region, and a cytoplasmic region. The BTLA cytoplasmic domain contains 3 tyrosine residues, two Immunoreceptor Tyrosine Inhibitory Motifs (ITIMs), which upon phosphorylation bind to and activate tyrosinase SHP-1 and SHP-2. Another tyrosine residue, predicted to be the site of Crb2 recruitment, may also be linked to the p85 subunit of intracellular phosphatidylinositol kinase (PI3K), which directs the immune modulation of co-stimulation of BTLA via the PI3K pathway. Studies have shown that herpes virus invasion mediators (HVEM) interact with lymphotoxin analogs (LIGHT) to provide a positive costimulatory signal, while HVEM in combination with BTLA produce a negative costimulatory signal. HVEM expressed on Antigen Presenting Cells (APC) interacts with BTLA, producing an inhibitory signal, particularly when B7-1 is under-expressed. The ligand of BTLA is HVEM, which mainly has positive regulation function, acts with LIGHT, promotes T, B cell proliferation and Ig generation, activates NK cells through NK cell receptors and makes them secrete granulocyte-macrophage colony stimulating factor (GM-CSF) and IFN-gamma. The interaction of BTLA with HVEM transmits inhibitory signals that down-regulate the immune response of lymphocytes. BTLA and HVEM regulate T cell and APC functions primarily through dynamic expression on the cell surface, and BTLA cross-links T Cell Receptors (TCRs) to inhibit T cell activation in primary and secondary immune responses of CD4+ T cells and secondary responses of CD8+ T cells. BTLA binding to ligand not only inhibits T cell proliferation and down-regulates the T cell activation marker CD25, but also inhibits the production of IFN-gamma, IL-2, IL-4, IL-10 and the like. Namely, the expression of BTLA or the binding condition of BTLA-HVEM is closely related to the activation and proliferation of T cells, and the BTLA blocker can be used as a tumor treatment drug. Currently, only jun shi biological BTLA mab injection is in clinical stage. However, these antibody drugs have a short duration of action, require long-term injection, and are expensive for the patient.

Exosomes, designated "exosomes" by Johnstone in 1987. Nowadays, it refers in particular to discoidal vesicles with a diameter of 40-100 nm. Many cells secrete exosomes under both normal and pathological conditions. It is mainly from the multivesicular body formed by the invagination of intracellular lysosome particles, and is released into extracellular matrix after the fusion of the outer membrane of the multivesicular body and cell membrane. When secreted into a recipient cell by a host cell, exosomes may modulate the biological activity of the recipient cell by the proteins, nucleic acids, lipids, etc. they carry. Exosome-mediated cell-cell communication is mainly through three modes: one is that exosome membrane proteins can bind to target cell membrane proteins, thereby activating signaling pathways within the target cell. Secondly, in the extracellular matrix, the exosome membrane protein can be cut by protease, and the cut fragment can be used as a ligand to be combined with a receptor on a cell membrane, so that a signal path in the cell is activated. Some exosome membrane proteins have been reported to be undetectable in the cell membrane from which they were derived. And thirdly, the exosome membrane can be directly fused with a target cell membrane, and the contained protein, mRNA and microRNA are released non-selectively. At present, research on gene therapy, tumor therapy and the like by carrying siRNA, chemical small molecule drugs and the like by exosome has been tried.

Stem cells are "seed" cells with self-renewal ability and differentiation ability into specific functional somatic cells, have the potential to regenerate into various tissues, organs and human bodies, and play a central and irreplaceable role in immune response, aging, tumorigenesis and other important biological activities. Stem cells are mainly classified into: totipotent stem cells (Totipotent stem cells), Pluripotent Stem Cells (PSCs), and adult stem cells (adult stem cells). The typical PSCs mainly include Embryonic Stem Cells (ESCs), Embryonic Germ Cells (EGCs), Embryonic Carcinoma Cells (ECCs), Induced Pluripotent Stem Cells (iPSCs), and the like, and such cells have a very deep and wide application prospect due to their powerful functions and can be restricted to some extent by ethics.

Therefore, the development of the pluripotent stem cell or the derivative thereof capable of expressing the shRNA and/or shRNA-miR targeting the BTLA and the exosome secreting the shRNA and/or shRNA-miR targeting the BTLA in a human body is of great significance.

However, the conception or establishment of the autologous iPSCs cell bank or the immune matched PSCs cell bank requires great expenditure of money, material resources and manpower. The molecular immunological basis for allogeneic recipient organ, tissue or cell transplantation is based primarily on the matching of the classical major histocompatibility complexes MHC-I and MHC-II (human HLA-I, HLA-II). By 6 months 2019, over 20000 HLA system alleles have been identified and named, and only 5000 allele factors of classical HLA-A, B, C are respectively exceeded, and various possible random combinations of these classical HLA-I/II alleles will be astronomical numbers, and as the number of combinations found for new alleles increases, there is a great obstacle to tissue matching and donor selection before organ, tissue and cell transplantation, and also great difficulty in constructing a PSCs cell library covering the immune match of the human population.

Thus, the construction of allogeneic immune-compatible, universal PSCs is imminent. In recent years, a plurality of reports have been provided that the deletion expression of genes on the cell surfaces of HLA-I and HLA-II or the genes thereof is realized by knocking out genes such as B2M, CIITA and the like, so that the cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. Recently, it has been reported that when B2M and CIITA are knocked out, CD47 is knocked in, so that cells obtain escape specific immune response, and have immune tolerance or escape natural immune response of cells such as NK cells, so that the cells have more comprehensive and stronger immune compatibility characteristics. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.

Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 high-frequency immune match HLA-C antigen species are very different, and the part of the area can only account for 70 percent by verification and calculation, while the HLA data of large sample size which is not authoritative currently in China, Indian and other big countries is displayed, so that the prepared general PSCs are still subjected to huge match vacancy tests; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible schemes are also a matter of convenience in the "transition period", and many problems remain that are not better solved.

In addition, it is also designed that suicide gene is induced to kill donor tissue and cells after they are diseased, and the result of this would be serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that suitable donor cells, tissues and organs would not exist after the cells of this kind are killed.

Disclosure of Invention

The present invention aims to provide a pluripotent stem cell or a derivative thereof;

it is another object of the present invention to provide an exosome;

the invention further aims to provide application of the pluripotent stem cell or the derivative thereof and/or the exosome in preparation of a BTLA high-expression tumor treatment drug.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided a pluripotent stem cell or a derivative thereof, wherein a genome of the pluripotent stem cell or the derivative thereof has an expression sequence of a BTLA-targeted shRNA and/or shRNA-miR introduced therein.

The research of the invention discovers that after the shRNA/shRNA-miR expression sequence of the target BTLA is introduced into the pluripotent stem cell or the derivative thereof, exosomes secreted in the pluripotent stem cell or the derivative thereof contain high-abundance shRNA/shRNA-miR of the target BTLA and mature siRNA, and the exosomes carry the effect RNA molecules to be combined with the target cell and then released, so that a BTLA passage is blocked, the immune suppression is relieved, the immune system is activated, the activity of the T cell is recovered, and the tumor cell can be effectively eliminated.

The sequence of the target BTLA shRNA and/or shRNA-miR is shown in SEQ ID NO. 1-SEQ ID NO. 3.

In a second aspect of the present invention, there is provided a pluripotent stem cell or a derivative thereof, wherein an expression sequence of BTLA-targeted shRNA and/or shRNA-miR is introduced into the genome of the pluripotent stem cell or the derivative thereof, and the B2M gene and/or CIITA gene of the genome of the pluripotent stem cell or the derivative thereof is knocked out.

When B2M and CIITA genes are knocked out, the influence of HLA-I and HLA-II molecules is completely eliminated, and therefore, the tumor treatment effect is optimal.

In a third aspect of the present invention, there is provided a pluripotent stem cell or a derivative thereof, wherein a genome of the pluripotent stem cell or the derivative thereof has an introduced expression sequence of a BTLA-targeting shRNA and/or shRNA-miR, and a genome of the pluripotent stem cell or the derivative thereof has further introduced therein a first nucleic acid molecule;

and, a second nucleic acid molecule is introduced into the 3' UTR region of an immune response-associated gene in said pluripotent stem cell or a derivative thereof;

the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, which small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and which small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

In the technical scheme, the small nucleic acid molecule coded by the first nucleic acid molecule can be specifically combined with a transcription product of a second nucleic acid molecule introduced from a 3' UTR region of an immune response related gene, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked, so that the cell has the immune compatibility characteristic, and the allogeneic immune rejection response can be eliminated or reduced. Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3 'UTR of the immune response-related gene only acts on the donor cells, without interfering with the genome of the recipient's cells.

Further, the small nucleic acid molecule comprises short interfering nucleic acid, short interfering RNA and double-stranded RNA, preferably at least one of miRNA, shRNA and shRNA-miR.

Further, the pluripotent stem cell or the derivative thereof is derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of a human.

The small nucleic acid molecule is preferably derived from caenorhabditis elegans. For example:

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.4)；

5’-TCACAACCTCCTAGAAAGAGTAGA-3’(SEQ ID NO.103)。

further, the second nucleic acid molecule comprises a reverse complement of at least 3 repeated small nucleic acid molecule sequences, preferably 6-10 repeated small nucleic acid molecule sequences.

Furthermore, an inducible gene expression system is introduced into the genome of the pluripotent stem cell or the derivative thereof, and is used for regulating and controlling the expression of the first nucleic acid molecule.

In the technical scheme, the inducible gene expression system is regulated and controlled by an exogenous inducer, and the opening and closing of the inducible gene expression system are controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, so that the expression quantity of small nucleic acid molecules is controlled.

When the inducible gene expression system is started, the transcription product of the small nucleic acid molecule which is normally expressed and the second nucleic acid molecule which is introduced into the 3' UTR region of the immune response related gene is specifically combined, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the transplant and the recipient can be improved.

When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules is closed, the interference effect of the small nucleic acid on mRNA of the immune response related gene is stopped, the normal expression of the immune response related gene is recovered, the antigen presenting capability of graft cells is recovered, and the receptor can remove the pathological graft, so that the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells in clinical application is greatly expanded.

Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3 'UTR of the immune response-related gene only acts on the donor cells, without interfering with the genome of the recipient's cells.

In a fourth aspect of the present invention, there is provided:

the genome of the pluripotent stem cell or the derivative thereof is introduced with an expression sequence of shRNA and/or shRNA-miR targeting BTLA, and the genome of the pluripotent stem cell or the derivative thereof is also introduced with an expression sequence of at least one immune compatible molecule for regulating and controlling the expression of genes related to immune response in the pluripotent stem cell or the derivative thereof.

In the technical scheme, the immune compatible molecules can regulate and control the expression of genes related to immune response in the pluripotent stem cells or the derivatives thereof, so that the immunogenicity of the pluripotent stem cells or the derivatives thereof is low, and when the pluripotent stem cells or the derivatives thereof are transplanted into a recipient, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the transplant and the recipient is improved. The graft can endogenously and continuously express the shRNA/shRNA-miR of the target BTLA in a receptor, and after the inhibiting factors are wrapped by the exosome, the exosome carries the inhibiting factors to be combined with the target cell and further releases the inhibiting factors, so that the BTLA pathway is blocked, the immunosuppression is relieved, the immune system is activated, the activity of the T cell is recovered, and the T cell can effectively eliminate the tumor cell.

Furthermore, an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and is used for regulating and controlling the expression of the immune compatible molecules.

In the technical scheme, the inducible gene expression system is regulated by an exogenous inducer, the on and off of the inducible gene expression system are controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, and the expression quantity of an immune compatible molecular expression sequence is further controlled, so that the reversible regulation of the immune compatibility of the pluripotent stem cells or derivatives thereof is realized. When the immune compatible molecule is normally expressed, the expression of genes related to immune response in the pluripotent stem cell or the derivative thereof is inhibited or overexpressed, so that when allogeneic cell therapy is performed, allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the donor cell and the recipient can be improved. When the donor cell is diseased, the expression of the immune compatible molecules can be closed by induction of an exogenous inducer, so that the HLA class I molecules can be reversibly re-expressed on the surface of the donor cell, the antigen presenting capability of the donor cell is recovered, and then the receptor immune system enables the receptor to eliminate the diseased cell by identifying unmatched HLA class I molecules or by cross HLA class I molecule antigen presenting (antigen presenting/identifying between classical incompatible HLA) mutated molecules, so that the clinical safety of the general pluripotent stem cell or the derivative thereof is improved, and the value of the general pluripotent stem cell in clinical application is greatly expanded.

With respect to the third and fourth aspects of the present invention, further, the genes associated with immune response include:

(1) major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(2) major histocompatibility complex related genes including at least one of B2M and CIITA.

With respect to the fourth aspect of the present invention, further, the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;

(3) shRNA and/or shRNA-miR targeting major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(4) shRNA and/or shRNA-miR targeting major histocompatibility complex-associated genes including at least one of B2M and CIITA.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 11-SEQ ID NO. 13;

the target sequence of the shRNA and/or shRNA-miR of the targeting CIITA is selected from one of SEQ ID NO. 14-SEQ ID NO. 16;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-A is selected from one of SEQ ID NO. 17-SEQ ID NO. 19;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-B is selected from one of SEQ ID NO. 20-SEQ ID NO. 22;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-C is selected from one of SEQ ID NO. 23-SEQ ID NO. 25;

the target sequence of the shRNA and/or shRNA-miR of the targeted HLA-DRA is selected from one of SEQ ID NO. 26-SEQ ID NO. 28;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB1 is selected from one of SEQ ID NO. 29-SEQ ID NO. 31;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB3 is selected from one of SEQ ID NO. 32-SEQ ID NO. 33;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB4 is selected from one of SEQ ID NO. 34-SEQ ID NO. 36;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB5 is selected from one of SEQ ID NO. 37-SEQ ID NO. 39;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQA1 is selected from one of SEQ ID NO. 40-SEQ ID NO. 42;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQB1 is selected from one of SEQ ID NO. 43-SEQ ID NO. 45;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPA1 is selected from one of SEQ ID NO. 46-SEQ ID NO. 48;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-DPB1 is selected from one of SEQ ID NO. 49-51.

In the first to fourth aspects of the present invention, further, the genome of the pluripotent stem cell or the derivative thereof is further introduced with shRNA and/or miRNA processing complex-associated gene and/or anti-interferon effector molecule, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of target PKR, 2-5As, IRF-3 and IRF-7.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting the PKR is selected from one of SEQ ID NO. 52-SEQ ID NO. 54;

the target sequence of the shRNA and/or shRNA-miR targeting 2-5As is selected from one of SEQ ID NO. 55-SEQ ID NO. 63;

the target sequence of the shRNA and/or shRNA-miR targeting the IRF-3 is selected from one of SEQ ID NO. 64-SEQ ID NO 66;

the target sequence of the shRNA and/or shRNA-miR of the target IRF-7 is selected from one of SEQ ID NO. 67-SEQ ID NO. 69.

With regard to the third and fourth aspects of the present invention, the inducible gene expression system includes at least one of a Tet-Off system, a dimer inducible expression system.

When the inducible gene expression system used is the Tet-Off system, the expression of small nucleic acid molecules in cells or their derivatives can be controlled by the addition of the exogenous inducer tetracycline (Doxycyline, Dox). After the pluripotent stem cells or the derivatives thereof are transplanted into a donor, the expression level of the small nucleic acid molecules can be gradually reduced even by adjusting the addition amount of Dox, so that the cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to the transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In general, Dox is added in an amount of 0 to 100 uM.

The dimer inducible expression system specifically refers to: dimerized inducers or dimers are used to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP (FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin)), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

In the first to fourth aspects of the present invention, further, the genome of the above-mentioned pluripotent stem cell or the derivative thereof further introduces an exosome-processing synthetic gene comprising at least one of STEAP3, Syndevan-4, an L-aspartate oxidase fragment (SEQ ID No.72), CD63-L7Ae (SEQ ID No.73) and Cx 43S 368A.

The secretion efficiency of the exosome and the encapsulation efficiency of the exosome on shRNA, shRNA-miR and mature siRNA can be improved by introducing the exosome processing synthetic gene into the genome of the stem cell or the stem cell derivative.

In relation to the first to fourth aspects of the present invention, further, the expression frameworks of the shRNA and/or shRNA-miR targeting BTLA, major histocompatibility complex gene, major histocompatibility complex-related gene, PKR, 2-5As, IRF-3 or IRF-7 are As follows:

(1) shRNA expression framework: the gene sequence sequentially comprises an shRNA sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA sequence and Poly T from 5 'to 3'; the two reverse complementary target sequences are separated by a middle stem-loop sequence to form a hairpin structure, and finally Poly T is connected to be used as a transcription terminator of RNA polymerase III;

(2) shRNA-miR expression framework: replacing a target sequence in the microRNA-30 or the microRNA-155 with a shRNA-miR target sequence to obtain the target sequence.

In the first to fourth aspects of the present invention, further, the BTLA-targeting shRNA and/or shRNA-miR expression sequence, the first nucleic acid molecule, the immune-compatible molecule expression sequence, the shRNA and/or miRNA processing complex-related gene, the anti-interferon effector molecule, the inducible gene expression system, and the exosome processing synthetic gene are introduced by a method of viral vector interference, non-viral vector transfection, or gene editing, preferably by gene knock-in.

In the first to fourth aspects of the present invention, further, the introduction site of the BTLA-targeting shRNA and/or shRNA-miR expression sequence, the first nucleic acid molecule, the exosome processing synthetic gene, the expression sequence of the immune-compatible molecule, the shRNA and/or miRNA processing complex-related gene, the anti-interferon effector molecule, and the inducible gene expression system is a genome safety site, preferably one or more of an AAVS1 safety site, an eGSH safety site, and an H11 safety site.

With respect to the first to fourth aspects of the present invention, further, the pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, or induced pluripotent stem cells;

the pluripotent stem cell derivative comprises an adult stem cell, each germ layer cell or a tissue or organ into which the pluripotent stem cell is differentiated;

the adult stem cells include mesenchymal stem cells or neural stem cells.

In a fifth aspect of the invention, an exosome is provided, which is secreted by the pluripotent stem cell or a derivative thereof.

In a sixth aspect of the invention, the pluripotent stem cell or the derivative thereof and/or the exosome is provided for use in preparing a BTLA high-expression tumor treatment drug.

The invention has the beneficial effects that:

1. the pluripotent stem cells or the derivatives thereof provided by the first aspect of the invention can be applied to autologous cell-induced iPSCs or MSCs low-immunogenicity cells. After the expression sequence of shRNA and/or shRNA-miR of the target BTLA is introduced into the genome of iPSCs induced by autologous cells, the iPSCs can express a large amount of shRNA and/or shRNA-miR of the target BTLA and are wrapped by exosomes secreted by the cells. Exosomes carry these inhibitory factors to bind with target cells and then release them, thereby blocking BTLA pathways, relieving immune suppression, activating the immune system, and restoring T cell activity, enabling them to effectively eliminate tumor cells.

2. The pluripotent stem cells or derivatives thereof provided by the second aspect of the invention may also be used in allogeneic cell therapy. Because the B2M and CIITA genes in the pluripotent stem cells or the derivatives thereof are knocked out, the pluripotent stem cells or the derivatives thereof have low immunogenicity, and when the pluripotent stem cells or the derivatives thereof are transplanted into a recipient, RNA interference aiming at immune response related genes, mediated by transcription products of a small nucleic acid molecule coded by a first nucleic acid molecule and a second nucleic acid molecule, only acts on donor cells and does not interfere with the genome of cells of the recipient. Improving the immune compatibility between the graft and the recipient. The implant can continuously express the shRNA and/or shRNA-miR of the target BTLA in a receptor endogenously, and after the inhibition factors are wrapped by the exosomes, the exosomes carry the inhibition factors to be combined with target cells and then release the target cells, so that a BTLA pathway is blocked, immunosuppression is relieved, an immune system is activated, the activity of T cells is recovered, and the T cells can be effectively eliminated.

3. The pluripotent stem cells or derivatives thereof provided by the third aspect of the invention have immune compatibility, and can eliminate or reduce allogeneic immune rejection response. Furthermore, the RNA interference program of the pluripotent stem cell or the derivative thereof acts only on such an engineered pluripotent stem cell or the derivative thereof. Thus, when such cells or derivatives are transplanted into a recipient, RNA interference directed to a gene associated with an immune response mediated by the transcript of the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule acts only on the donor cell and does not interfere with the genome of the recipient cell.

Furthermore, an inducible gene expression system is introduced into the genome of the pluripotent stem cell or the derivative thereof, and is used for regulating the expression of the first nucleic acid molecule, so that the immune compatibility and reversibility of the pluripotent stem cell or the derivative thereof are realized.

4. The pluripotent stem cell or the derivative thereof provided by the fourth aspect of the invention has an immune-compatible molecule expression sequence introduced into its genome, so that the pluripotent stem cell or the derivative thereof has low immunogenicity, and when the pluripotent stem cell or the derivative thereof is transplanted into a recipient, RNA interference directed to an immune response-related gene mediated by a transcription product of a small nucleic acid molecule encoded by a first nucleic acid molecule and a second nucleic acid molecule only acts on a donor cell, and does not interfere with the genome of the recipient cell. Improving the immune compatibility between the graft and the recipient. The implant can continuously express the shRNA and/or shRNA-miR of the target BTLA in a receptor endogenously, and after the inhibition factors are wrapped by the exosomes, the exosomes carry the inhibition factors to be combined with target cells and then release the target cells, so that a BTLA pathway is blocked, immunosuppression is relieved, an immune system is activated, the activity of T cells is recovered, and the T cells can be effectively eliminated.

Furthermore, the genome of the pluripotent stem cell or the derivative thereof provided by the fourth aspect of the present invention further comprises an inducible gene expression system, wherein the inducible gene expression system can regulate and control the expression of the immune compatible molecules, and the inducible gene expression system is regulated and controlled by an exogenous inducer, the on and off of the inducible gene expression system is controlled by adjusting the addition amount, the duration and the type of the exogenous inducer, and the expression level of the expression sequence of the immune compatible molecules is further controlled, so that the reversible regulation and control of the immune compatibility of the pluripotent stem cell or the derivative thereof are realized. When the inducible gene expression system is started, the transcription product of the small molecule nucleic acid which is normally expressed and a second nucleic acid molecule which is introduced into the 3' UTR region of the immune response related gene is specifically combined, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response may be eliminated or reduced, and the immune compatibility between the transplant and the recipient may be improved. When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules and the interference effect of the small nucleic acid molecules on mRNA of immune response related genes are stopped, the normal expression of the immune related genes is recovered, the antigen presenting capability of graft cells is further recovered, the receptor can remove the pathological graft, the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells or the derivatives thereof in clinical application is greatly expanded.

5. The pluripotent stem cells or the derivatives thereof can gradually reduce the expression amount of small nucleic acid molecules in the pluripotent stem cells or the derivatives thereof by adjusting the addition amount and the sustained action time of the exogenous inducer, so that the donor cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In this case, even though mismatched HLA class I molecules are expressed on the surface of the graft cells, they are compatible with the recipient immune system.

Drawings

Figure 1 is a plasmid map of Cas9 (D10A).

FIG. 2 is a plasmid map of sgRNA Clone AAVS 1-1.

FIG. 3 is a plasmid map of sgRNA Clone AAVS 1-2.

FIG. 4 is a plasmid map of sgRNA clone B2M-1.

FIG. 5 is a plasmid map of sgRNA clone B2M-2.

FIG. 6 is a plasmid map of sgRNA clone B2M-3.

FIG. 7 is a plasmid map of sgRNA clone B2M-4.

FIG. 8 is a plasmid map of sgRNA clone CIITA-1.

FIG. 9 is a plasmid map of sgRNA clone CIITA-2.

FIG. 10 is a plasmid map of sgRNA clone CIITA-3.

Fig. 11 is a plasmid map of sgRNA clone CIITA-4.

FIG. 12 is a plasmid map of AAVS1KI Vector (shRNA, constitutive).

FIG. 13 is a plasmid map of AAVS1KI Vector (shRNA, inducible).

FIG. 14 is a plasmid map of AAVS1KI Vector (shRNA-miR, constitutive).

FIG. 15 is a plasmid map of AAVS1KI Vector (shRNA-miR, inducible).

FIG. 16 is a plasmid map of B2M KI Vector.

FIG. 17 is a plasmid map of CIITA KI Vector.

Detailed Description

The present invention will be described in further detail with reference to the following specific embodiments and accompanying drawings.

It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

1 Experimental materials and methods

1.1 Targeted BTLA shRNA and/or shRNA-miR

Target sequences of BTLA-targeting shRNA and/or shRNA-miR are shown in table 1.

TABLE 1 target sequences for shRNA and/or shRNA-miR targeting BTLA

In the experimental schemes in tables 8 to 9 below, the shRNA and/or shRNA-miR targeted to BTLA knocked in by each experimental group is the shRNA or shRNA-miR constructed by using the target sequence 1 in table 1. Those skilled in the art will understand that: the technical effects of the invention can be realized by constructing the target BTLA shRNA and/or shRNA-miR by other target sequences, and the target BTLA shRNA and/or shRNA-miR also fall into the protection scope of the claims of the invention.

1.2 pluripotent Stem cells or derivatives thereof

The pluripotent stem cells can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs, EBs cells. Wherein:

ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.

And (3) iPSCs: using a third generation highly efficient and safe episomal-iPSCs induction system (6F/BM1-4C) established by us, pE3.1-OG-KS and pE3.1-L-Myc-hmiR 302 cluster are transferred into somatic cells through electricity, RM1 is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD03254901 is cultured for 2 days, iPSCs clones can be picked up after being cultured to about 17 days by using a dry cell culture medium BioCISO, and the picked iPSCs clones are purified, digested and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

hPSCs-MSCs: iPSCs are cultured for 25 days by using a stem cell culture medium (BioCISO containing 10uM TGF beta inhibitor SB431542), during which digestion passage (2mg/mL Dispase digestion) is carried out at 80-90 confluence, passage is carried out at 1:3 into a Matrigel coated culture plate, then ESC-MSC culture medium (knockkockout DMEM culture medium containing 10% KSR, NEAA, diabody, glutamine, beta-mercaptoethanol, 10ng/mL bFGF and SB-431542) is cultured, fluid is changed every day, passage is carried out at 80-90 confluence (passage is carried out at 1: 3), and continuous culture is carried out for 20 days. The specific construction method is as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.

NSCs: iPSCs are cultured for 14 days by using an induction medium (a knockout DMEM medium containing 10% KSR, a TGF-beta inhibitor and a BMP4 inhibitor), rose annular nerve cells are picked to a low-adhesion culture plate for culture, the culture medium is cultured by using DMEM/F12 (containing 1% N2 and Invitrogen) and Neurobasal medium (containing 2% B27 and Invitrogen) in a ratio of 1:1 and also contains 20ng/ml bFGF and 20ng/ml EGF, and digestion is carried out by using Accutase for digestion and passage. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.

EBs cells: and digesting iPSCs with the confluence of 95% for 6min by using a BioC-PDE1, scraping the cells into blocks by using a mechanical scraping method, settling and reducing cell masses, transferring the settled cell masses into a low-adhesion culture plate, culturing for 7 days by using a BioCISO-EB1, and changing the liquid every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and adherent culture was continued using BioCISO, and Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure were obtained after 7 days. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

Said pluripotent stem cell derivative further comprises an adult stem cell into which the pluripotent stem cell is differentiated, a cell of each germ layer, or a tissue or organ; the adult stem cells include mesenchymal stem cells or neural stem cells.

1.3 Small nucleic acid molecules and corresponding first nucleic acid molecule, second nucleic acid molecule

The sequence of the small nucleic acid molecule is a random sequence derived from a non-human species that does not target any mRNA or lncRNA from humans, preferably from caenorhabditis elegans.

The sequence of the small nucleic acid molecule used in this example was

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.4)；

Designing a first nucleic acid molecule and a second nucleic acid molecule according to the small nucleic acid molecules, wherein the first nucleic acid molecule and the second nucleic acid molecule are respectively as follows:

a first nucleic acid molecule (i.e., shRNA expression framework or shRNA-miR expression framework of a small nucleic acid molecule):

(1) the sequence composition of the shRNA expression framework of the small nucleic acid molecule is as follows:

5’-CCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.5)N₁...N₂₁TTCAAGAGA(SEQ ID NO.6)N₂₂...N₄₂TTTTTT-3’。

wherein the content of the first and second substances,

a)N₁...N₂₁is the sequence of the small nucleic acid molecule, N₂₂...N₄₂The reverse complementary sequence of the small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNA of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;

c) constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d) n represents A or T or G or C base.

(2) shRNA-miR expression framework of small nucleic acid molecules: the small nucleic acid molecule sequence is used for replacing a target sequence in microRNA-30 or microRNA-155 to obtain the target sequence. The specific sequence is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.7)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.8)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT(SEQ ID NO.9)-3’。

wherein the content of the first and second substances,

a)N₁...N₂₁is a small nucleic acid molecule sequence, N₂₂...N₄₂Is a reverse complementary sequence of a small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;

c) constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes, and other sequences are the same;

d) n represents A or T or G or C base, M base represents A or C base;

e) if N1 is a G base, then M₁Is A base; otherwise M₁Is a C base;

f)M₁base and M₂And (3) base complementation.

A second nucleic acid molecule: comprises reverse complementary sequences of at least 3 repeated small nucleic acid molecule sequences, preferably 6-10 repeated small nucleic acid molecule sequences. The reverse complement of the small nucleic acid molecule sequence can be linked by a random Linker sequence.

As an embodiment of the present invention, the second nucleic acid molecule is formed by connecting the first 10nt random sequence and the reverse complement of 8 repeated small nucleic acid molecule sequences through a random linker sequence (CGTA):

atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTA(SEQ ID NO.10)。

1.4 genomic safety sites

In the technical scheme of the invention, the genome safety locus for knocking-in the gene can be selected from an AAVS1 safety locus, an eGSH safety locus or other safety loci:

(1) AAVS1 safety site

The AAVS1 site (the alias "PPP 1R2C site") is located on chromosome 19 of the human genome and is a verified "safe harbor" site that ensures the desired function of the transferred DNA fragment. The site is an open chromosome structure, can ensure that the transgene can be normally transcribed, and has no known side effect on cells when the exogenous target segment is inserted into the site.

(2) eGSH safe site

The eGSH safe site is located on chromosome 1 of the human genome and is another 'safe harbor' site which is verified by a paper and can ensure the expected function of the transferred DNA fragment.

(3) Other safety sites

The H11 safe site (also called Hipp11) is located on the number 22 chromosome of a human, is a site between two genes Eif4enif1 and Drg1, is discovered and named in 2010 by Simon Hippenmeyer, and has little risk of influencing endogenous gene expression after the insertion of a foreign gene because the H11 site is located between the two genes. The H11 site was verified to be a safe transcription activation region between genes, a new "safe harbor" site outside the AAVS1, eGSH sites.

1.5 inducible Gene expression System

The inducible gene expression system is selected from: tet-Off system or dimer-Off expression system:

(1) tet-Off system

In the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of a gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

The invention knocks the sequence of the tet-Off system and one or more immune compatible molecules into the genome safety site of the pluripotent stem cell, and accurately turns on or Off the expression of the immune compatible molecules through the addition of tetracycline, thereby reversibly regulating the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof.

(2) Dimer-switched off expression system

Dimer-mediated gene expression regulation system: there are many ways of chemically regulating transcription of target genes, most commonly regulated using allosteric modulators that influence the activity of transcription factors. One such method is the use of dimerizing inducers or dimers to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP [ FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

1.6 immune compatible molecules

The immune compatible molecule can regulate the expression of allogeneic immune rejection related genes in the pluripotent stem cells or derivatives thereof. The types and sequences of specific immune-compatible molecules are shown in table 2.

TABLE 2 immune-compatible molecules

The target sequences of the shRNA or shRNA-miR immune compatible molecules are shown in Table 3.

TABLE 3 sequences of shRNA or shRNA-miR

In the experimental schemes in tables 8 to 9 below, the knockin shRNA or shRNA-miR immune-compatible molecules in each experimental group are shRNA or shRNA-miR constructed by using the target sequence 1 in table 3. Those skilled in the art will understand that: the shRNA or shRNA-miR immune compatible molecule constructed by other target sequences can also realize the technical effect of the invention and all the shRNA or shRNA-miR immune compatible molecule fall into the protection scope of the claims of the invention.

1.7shRNA/miRNA processing Complex genes and anti-Interferon Effector molecules

The primary miRNA (pri-miRNA) in the nucleus is microprocessed through the complex Drosha-DGCR8, which cleaves the pri-miRNA into a precursor miRNA (pre-miRNA), which then forms a hairpin. Then, the pre-miRNA is transported out of the nucleus via the Exportin-5-Ran-GTP complex. The RNase Dicer enzyme, which binds to the double-stranded RNA-binding protein TRBP (TARBP2) in the cytoplasm, breaks down the pre-miRNA into mature lengths, at which point the miRNA is still in a double-stranded state. Finally, it is transported into AGO2 to form RISC (RNA-induced silencing complex). Finally, one strand of the miRNA double strand is retained in the RISC complex, and the other strand is eliminated and rapidly degraded. While DGCR8, the main binding protein of Drosha, can bind to pri-miRNA through two double-stranded RNA binding regions at its C-terminal end, recruit and guide Drosha to cut at the right position of pri-miRNA to produce pre-miRNA, which is further cut by Dicer and TRBP/PACT processing to form mature miRNA. Deletion or abnormal expression of DGCR8 affects the cleavage activity of Drosha, which in turn affects the activity of miRNA, leading to disease. TRBP is able to recruit Dicer complex mirnas to form RISC Ago 2.

According to the invention, by using a gene knock-in technology, when the shRNA-miR expression sequences aiming at HLA class I molecules, HLA class II molecules and the like which can be induced to close expression are knocked in at a genome safety site, preferably, shRNA and/or miRNA processing machines which can be induced to close expression are knocked in at the same time, wherein the shRNA and/or miRNA processing machines comprise Drosha (access number: NM-001100412), Ago1(access number: NM-012199), Ago2(access number: NM-001164623), Dicer1(access number: NM-001195573), export-5 (access number: NM-020750), TRBP (access number: NM-134323), PACT (access number: NM-003690) and DGCR8(access number: NM-022720), so that cells do not occupy the processing of other miRNAs and influence the cell functions.

In addition, during IFN induction, double-stranded RNA-dependent Protein Kinase (PKR), which is a key factor of the whole cell signal transduction pathway, and 2 ', 5' Oligoadenylate Synthetase (2,5-Oligoadenylate Synthetase,2-5As), which are closely related to dsRNA-induced IFN, are involved. PKR can inhibit protein synthesis by phosphorylating eukaryotic cell transcription factors, arrest cells in G0/G1 and G2/M phases and induce apoptosis, while dsRNA can promote synthesis of 2-5As, which results in nonspecific activation of RNase, RNaseL, degradation of all mRNA in cells and cell death. The specificity of induction of type I interferons is achieved by members of the IRF transcription factor family, which are not inducible to be secreted in many viral infections in the absence of IRF-3 and IRF-7 expression in cells. Lack of IFN response, in order to recover, needs the two proteins were expressed together.

According to the invention, by utilizing a gene knock-in technology, when an immune compatible molecule shRNA-miR expression sequence is knocked in at a genome safety site, shRNA and/or shRNA-miR expression sequences which can induce closed expression and aim at suppressing PKR, 2-5As, IRF-3 and IRF-7 genes are preferably knocked in at the same time, so that interferon reaction induced by dsRNA is reduced, and cytotoxicity is avoided.

The sequence of the insertion positions of the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule at the genome safety site is not limited, and the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule can be arranged in any sequence without mutual interference or influence on the structure and the function of other genes of the genome.

Specific target sequences for anti-interferon effector molecules are shown in table 4.

TABLE 4 target sequences for anti-interferon effector molecules

In the anti-interferon effector molecule knock-in schemes of tables 8 to 9 below, the anti-interferon effector molecules of each experimental group were all anti-interferon effector molecules constructed using target sequence 1 in table 4. Those skilled in the art will understand that: the technical effects of the invention can be achieved by constructing anti-interferon effector molecules with other target sequences, and the anti-interferon effector molecules fall into the protection scope of the claims of the invention.

1.8 Universal framework for Immunocompatible molecules, shRNA or shRNA-miR of anti-Interferon Effector molecules

The general framework sequences of the shRNA or shRNA-miR of the immune compatible molecules and the anti-interferon effector molecules are as follows:

(1) the constitutive expression framework of shRNA is:

GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGCTAGCGCCACC(SEQ ID NO.70)N₁...N₂₁TTCAAGAGA(SEQ ID NO.6)N₂₂...N₄₂TTTTTT；

wherein:

a、N₁...N₂₁shRNA target sequence for the corresponding Gene, N₂₂...N₄₂Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;

b. if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;

c. constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d. n represents A, T, G, C bp;

e. SEQ ID NO.70 is the U6 promoter sequence;

f. SEQ ID NO.6 is a stem-loop sequence.

(2) The shRNA inducible expression framework is as follows:

GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.71)N₁...N₂₁TTCAAGAGA(SEQ ID NO.6)N₂₂...N₄₂TTTTTT；

wherein:

a、N₁...N₂₁shRNA target sequence of the corresponding Gene, N₂₂...N₄₂Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;

d. n represents A, T, G, C bp;

e. SEQ ID No.71 is the H1 TO promoter sequence;

f. SEQ ID NO.6 is a stem-loop sequence.

(3) The shRNA-miR constitutive or inducible expression framework is as follows:

the shRNA-miR target sequence is used for replacing a target sequence in microRNA-30 to obtain the shRNA-miR target sequence, and the specific sequence is as follows:

GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.7)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.8)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT(SEQ ID NO.9)；

wherein:

a、N₁...N₂₁shRNA-miR target sequence, N, as a corresponding gene₂₂...N₄₂Is a reverse complementary sequence of shRNA-miR target sequence of a corresponding gene;

b. if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;

c. constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d. m is A or C, N is A, T, G, C;

e. if N is present₁Is a G base, then M₁Is A base; otherwise M₁Is a C base;

f、M₁base and M₂And (3) base complementation.

1.9 exosome processing synthetic gene

The exosome processing synthetic gene is selected from at least one of STEAP3(NM _182915), Syndecano-4 (NM _002999), L-aspartate oxidase fragment (SEQ ID NO.72), CD63-L7Ae (SEQ ID NO.73) and Cx 43S 368A. Wherein Cx 43S 368A is obtained by mutating S (serine) to A (alanine)) at position 368 of Cx43 (NM-000165).

1.10 Gene editing System, Gene editing method and inspection method

1.10.1 Gene editing System

The gene editing technology adopts a CRISPR-Cas9 gene editing system. The Cas9 protein used was Cas9(D10A), Cas9(D10A) bound to sgrnas which were responsible for specific recognition of the target sequence (genomic DNA) which was then single-stranded cleaved by Cas9 (D10A). Double Strand breaks in genomic DNA (DSB) must occur, and two Cas 9(D10A)/sgRNA must cleave the two strands of genomic DNA separately, and not too far apart. The Cas 9(D10A)/sgRNA protocol has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA protocol. The plasmids or Donor fragments used in the gene editing system were: cas9(D10A) plasmid, sgRNA clone plasmid, Donor fragment.

(1) Cas9(D10A) plasmid: a plasmid expressing the Cas9(D10A) protein, specifically single-stranded cleaving genomic DNA under the direction of sgrnas.

(2) sgRNA plasmid: a plasmid expressing sgRNA (small guide RNA) is a guide RNA (guide RNA, gRNA) responsible for directing targeted cleavage of the expressed Cas9(D10A) protein at gene editing.

The sgRNA sequences of AAVS1, B2M, CIITA are as follows:

sgRNA-AAVS1-1：5’-TATAAGGTGGTCCCAGCTCGGGG-3’(SEQ ID NO.74)；

sgRNA-AAVS1-2：5’-AGGGCCGGTTAATGTGGCTCTGG-3’(SEQ ID NO.75)；

sgRNA-B2M-1:5’-CTCCTGTTATATTCTAGAACAGG-3’(SEQ ID NO.76)；

sgRNA-B2M-2:5’-TTTCAGCATCAATGTACCCTGGG-3’(SEQ ID NO.77)；

sgRNA-B2M-3:5’-CGCGAGCACAGCTAAGGCCA-3’(SEQ ID NO.78)；

sgRNA-B2M-4:5’ACTCTCTCTTTCTGGCCTGG 3’(SEQ ID NO.79)；

sgRNA-CIITA-1:5’-GGCACTCAGAAGACACTGATGGG-3’(SEQ ID NO.80)；

sgRNA-CIITA-2:5’-AAGGTGTCTGGTCGGAGAGCAGG-3’(SEQ ID NO.81)；

sgRNA-CIITA-3:5’-ACCCAGCAGGGCGTGGAGCC-3’(SEQ ID NO.82)；

sgRNA-CIITA-4:5’-GTCAGAGCCCCAAGGTAAAA-3’(SEQ ID NO.83)。

(3) donor fragment: the two ends contain recombination arms which are respectively positioned at the left side and the right side of the breaking position of the genome DNA, and the middle part contains genes, fragments or expression elements needing to be inserted. In the presence of the Donor fragment, the cells undergo a Homologous Recombination (HR) reaction at the site of the genomic break. If the Donor fragment is not added, Non-homologous End Joining-NHEJ reaction occurs at the site of the genomic break in the cell. This fragment was obtained by digesting KI (Knock-in, the same applies hereinafter) Vector plasmid and recovering it.

AAVS1, B2M, CIITA homology arms are as follows:

(1) the nucleotide sequences of AAVS1 homologous arms AAVS1-HR-L and AAVS1-HR-R are respectively shown as SEQ ID NO.84 and SEQ ID NO. 85;

(2) the nucleotide sequences of B2M homologous arms B2M-HR-L and B2M-HR-R are respectively shown as SEQ ID NO.86 and SEQ ID NO. 87;

(3) the nucleotide sequences of CIITA-HR-L and CIITA-HR-R of the CIITA homologous arm are respectively shown as SEQ ID NO.88 and SEQ ID NO. 89.

1.10.2 constitutive plasmid and inducible plasmid

Constitutive plasmid: the expression function of the Donor fragment obtained from the constitutive plasmid cannot be regulated after knocking in the genomic DNA.

Inducible plasmids: after knocking in the genomic DNA, the expression function of the Donor fragment obtained from the inducible plasmid can be controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.

1.10.3 plasmid construction method

(1) Cas9(D10A) plasmid: this Plasmid no longer needs to be constructed and is ordered directly from Addgene (Plasmid 41816, Addgene).

(2) sgRNA plasmid: the original blank Plasmid is ordered from Addge (Plasmid 41824, Addge), then the DNA sequence is input in the website (URL: https:// ccttop. cos. uni-heidelberg. de) to design the target sequence, and finally different target sequences are respectively put into the blank sgRNA Plasmid to complete the construction.

(3) KI Vector plasmid:

acquisition of Amp (R) -pUC origin fragment: designing PCR primers, and amplifying and recovering the fragment by using a high fidelity enzyme (Nanjing Nozaki organism, P505-d1) through a PCR method by using a pUC18 plasmid as a template;

acquisition of aavs1 or eGSH recombination arms: extracting human cell genome DNA and designing corresponding primer, then using human genome DNA as template and using high fidelity enzyme (Nanjing Nozan organism, P505-d1) to amplify and recover such fragments AAVS1, B2M and CIITA homologous arm (AAVS1-HR-L, AAVS1-HR-R, B2M-HR-L, B2M-HR-R, CIITA-HR-L and CIITA-HR-R) by PCR method;

c. acquisition of the individual plasmid elements: designing PCR amplification primers of each element, and then respectively amplifying and recovering each plasmid element by using a high fidelity enzyme (Nanjing Nuozhen organism, P505-d1) through a PCR method by taking a plasmid containing the element as a template;

d. assembly into a complete plasmid: the fragments obtained in the previous step were ligated together using a multi-fragment recombinase (Nanjing Nozam, C113-02) to form a complete plasmid.

The plasmid map of Cas9(D10A) obtained by the method is shown in figure 1, the plasmid map of sgRNA of AAVS1 safety site is shown in figure 2-3, the plasmid map of sgRNA of B2M gene is shown in figure 4-7, the plasmid map of sgRNA of CIITA gene is shown in figure 8-11, the plasmid map (constitutive and inducible) of constructed AAVS1KI is shown in figure 12-15, the plasmid map of B2M KI is shown in figure 16, and the plasmid map of CIITA KI is shown in figure 17.

1.10.4 Gene editing Process

One, single cell cloning operation step of AAVS1 gene knock-in

(1) Electric transfer program:

donor cell preparation: human pluripotent stem cells.

The kit comprises: human Stem Cell

Kit 1。

The instrument comprises the following steps: an electrotransformation instrument.

Culture medium: BioCISO.

Induction of plasmid: cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neo Vector I and AAVS1 neo Vector II.

Note: induction plasmid used for the knock-in of the eGSH gene: cas9D10A, sgRNA clone eGSH-1, sgRNA clone eGSH-2, eGSH-neo/eGSH-puro (donor) comparison of the donor plasmid with AAVS1 shows that only the right and left recombination arms are different, and the other elements are the same. Since the gene editing process of eGSH is the same as that of AAVS1, the following description will not be repeated.

(2) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.

(3) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.

Second, AAVS1 gene knock-in single cell clone strain culture reagent

(1) Culture medium: BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro (should be placed at room temperature in advance, protected from light for 30-60 minutes until room temperature is restored. Note that BioCISO should not be placed at 37 ℃ for preheating to avoid reduction of the activity of the biomolecule.).

(2) Matrix glue: hESC grade Matrigel (before passage or cell recovery, the Matrigel working solution is added into a cell culture bottle dish and is shaken up to ensure that the Matrigel completely sinks to the bottom of the culture bottle dish and any Matrigel cannot be dried before use. to ensure that the cells can be attached to the wall and survive better, the Matrigel is put into a 37 ℃ culture box for 1:100X Matrigel cannot be less than 0.5 hour and 1:200X Matrigel cannot be less than 2 hours.).

(3) Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH7.4 (note: EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure).

(4) Freezing and storing liquid: 60% BioCISO + 30% ESCs grade FBS + 10% DMSO (frozen stock is preferably ready for use).

Thirdly, the conventional maintenance subculture process

(1) Optimum timing of passage and ratio of passage

a. The best passage time: the overall confluency of the cells reaches 80 to 90 percent;

b. the optimal ratio of passage: the optimal confluence degree of the passage is maintained at 20-30% in the next day after passage of 1: 4-1: 7.

(2) Passage process

a. The Matrigel in the coated cell culture flask dishes was previously aspirated away, and an appropriate amount of medium (BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro) was added to the flask and placed at 37 ℃ in 5% CO₂Incubation in an incubator;

b. when the cells meet the requirement of passage, sucking the supernatant of the culture medium, and adding a proper amount of 0.5mM EDTA digestive solution into a cell bottle dish;

c. the cells were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float, gently blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;

d. centrifuging, discarding the supernatant, suspending the cells by using a culture medium, gently and repeatedly blowing the cells for several times until the cells are uniformly mixed, and then transferring the cells to a bottle dish prepared for coating Matrigel in advance;

e. after the cells were transferred to the cell flask, the cells were horizontally shaken up all around, observed under a mirror to be free from abnormality, and then shaken up and placed at 37 ℃ with 5% CO₂Culturing in an incubator;

f. observing the adherent survival state of the cells the next day, and normally and regularly changing the culture medium every day by sucking off the culture medium.

Fourthly, freezing and storing cells

(1) According to the conventional passage operation steps, digesting the cells by using 0.5mM EDTA until most cells shrink and become round but do not float, gently blowing and beating the cells, collecting cell suspension, centrifuging for 5 minutes at 200g, removing supernatant, adding a proper amount of freezing medium to resuspend the cells, and transferring the cells to a freezing tube (suggesting that one frozen cell with 80% confluence degree of a six-well plate and 0.5 mL/cell of freezing medium is frozen);

(2) placing the freezing tube in a programmed cooling box, and immediately placing the freezing tube at-80 ℃ overnight (ensuring that the temperature of the freezing tube is reduced by 1 ℃ per minute);

(3) the next day the cells were immediately transferred into liquid nitrogen.

Fifth, cell recovery

(1) Preparing a Matrigel-coated cell bottle dish in advance, sucking out the Matrigel before recovering the cells, adding a proper amount of BioCISO into the cell bottle dish, placing at 37 ℃ and 5% CO₂Incubation in an incubator;

(2) taking out the cryopreservation tube from liquid nitrogen quickly, immediately putting the tube into a 37 ℃ water bath kettle for quick shaking to quickly melt the cells, carefully observing, stopping shaking after the ice crystals completely disappear, and transferring the cells to a biological safety cabinet;

(3) adding 10mL of DMEM/F12(1:1) basal medium into a 15mL centrifuge tube in advance, balancing to room temperature, sucking 1mL of DMEM/F12(1:1) by using a Pasteur pipette, slowly adding the DMEM/F12(1:1) into a freezing tube, gently mixing, transferring the cell suspension into a prepared 15mL centrifuge tube containing DMEM/F12(1:1), and centrifuging for 5 minutes at 200 g;

(4) carefully removing supernatant, adding appropriate amount of BioCISO, gently mixing cells, seeding into a cell bottle dish prepared in advance, shaking up horizontally, and observing under the mirror, shaking up, and standing at 37 deg.C and 5% CO₂Culturing in an incubator;

(5) the adherent survival state of the cells is observed the next day, and the liquid is normally changed on time every day. If the adherence is good, the BioCISO is changed to BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro.

1.10.5 gene knock-in detection method

1. Single cell clone AAVS1 gene knock-in assay

(1) AAVS1 Gene knock-in assay

a. The purpose of the test is as follows: the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor segments only have the difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor segments of different resistance genes respectively), and it is only possible that the double-knocked-in cell is the correct homozygous by detecting whether the genome of the cell contains the Donor segments of the two resistance genes;

b. the test method comprises the steps of designing a primer in a Donor plasmid resistance gene, and designing another primer in a genome (close to a recombination arm) of an insertion site. If the Donor fragment can be correctly inserted into the genome, a target band appears, otherwise no target band appears);

c. test protocol primer sequences and PCR protocols are shown in Table 5.

TABLE 5 test protocol primer sequences and PCR protocol

The detection method of the knock-in of the second nucleic acid molecule into the 3' UTR of B2M and CIITA gene was the same as the detection principle of AAVS1, and the PCR detection conditions used were as shown in tables 6 and 7.

TABLE 6 protocol primer sequences and PCR protocol (knock-in detection of B2M site)

TABLE 7 test protocol primer sequences and PCR protocol (detection of knockin of CIITA site)

1.10.6 testing method of knock-in gene method at genome safety locus

(1) The purpose of the test is as follows: the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.

(2) The test method comprises the following steps: first, one primer was designed inside the Donor plasmid (non-recombinant arm portion), and then the other primer was designed in the genome (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the target band will appear, otherwise no target band will appear.

1.11 detection of the blocking effect of pluripotent stem cells or derivatives thereof expressing BTLA-targeted shRNA and/or shRNA-miR and exosome on BTLA

Exosomes in culture supernatant after culturing and expressing exosome-encapsulated shRNA and/or shRNA-miR-targeted stem cells and derivatives thereof are extracted by using an exosome extraction kit (BestBio, lot # BB-3901). Centrifuging the culture supernatant at 4 deg.C for 15min at 3000g, collecting supernatant, centrifuging at 4 deg.C for 20min at 10000g, collecting supernatant, adding extractive solution A at a ratio of 4:1, reversing for 1min, and standing at 4 deg.C overnight. Centrifuging at 4 deg.C for 60min at 10000g, and collecting exosome precipitate.

And testing the blocking effect of the target BTLA shRNA and/or shRNA-miR expressed by the pluripotent stem cells by using a flow cytometry method. And adding exosomes containing shRNA and/or shRNA-miR of the target BTLA into a culture medium of the CHO cell expressing the BTLA, and culturing the CHO cell expressing the BTLA for 72 h. After digesting into single cells and washing the cells 2 times with PBS, FITC-labeled BTLA antibody fusion protein was added to the tube and incubated at 37 ℃ for 30 minutes. Flow cytometric analysis was performed using a flow cytometer. According to the dyed average fluorescence intensity (MFI), the effect of the BTLA-targeted shRNA and/or shRNA-miR expressed by the pluripotent stem cells on inhibiting the expression of BTLA by the CHO cells can be measured.

1.12CFSE detection of the Effect of BTLA-targeting shRNA and/or shRNA-miR on T cell tumor killing

(1) Preparation of effector cells:

t cell isolation: human Peripheral Blood Mononuclear Cells (PBMC) were isolated using Ficoll density gradient centrifugation (Ficoll-hypaque density gradient centrifugation) followed by Dynabeads^TMCD3(Invitrogen^TMAnd the cargo number: 11151D) T cells are isolated by the kit. The cells were resuspended in RPMI1640 medium containing 10% FBS, the cells were counted by trypan blue staining, and concentrated to 1X 10⁷cells/mL.

(2) Preparation of target cells

Tumor (MM melanoma) cells were digested and resuspended, and cells were counted by trypan blue staining to 1X 10⁷cells/mL of cell suspension.

(3) CFSE test

The fluorescent dye CFSE, also known as CFDA SE (5, 6-carboxyfluoroscein diacetate, succinimidyl ester, hydroxyfluorescein diacetate, succinimidyl succinate), is a cell membrane permeable fluorescent dye that can be detected by flow cytometry. PI (propidium iodide), which binds to DNA and RNA in cells but cannot pass through the cell membrane of living cells.

The T cells are firstly incubated for 72h by using culture medium supernatant of pluripotent stem cells expressing shRNA and/or shRNA-miR of the target BTLA, and then when the T cells are contacted with tumor cells, the T can attack the tumor cells to cause cell lysis and death. And the tumor cells which are not incubated by culture medium supernatant of the pluripotent stem cells of the shRNA and/or shRNA-miR of the target BTLA can not be identified by T cells, and the immune escape can occur. So by detecting CFSE⁺PI⁺Cells (dead target cells), i.e., cells that reflect the ability of T cells to kill tumors.

The method comprises the following specific steps:

1) CFSE working solution (final concentration of 5. mu. mol/L CFSE) was added to the target cells at 37 ℃ with 5% CO₂Incubate for 10min and wash 2 times. After trypan blue staining counting, the cell is resuspended by a culture medium to be 1 multiplied by 10⁶cells/mL are ready for use.

2) Target and effector cells were added to 5mL flow tubes, 100. mu.L of target cells (1X 10) per tube⁵ml^-1) And effector cells (E/T ═ 1:2, 1:5, 1:10, E/T is the ratio of target cells to effector cells T) with only target cells added as controls. Effector cells and target cells were gently mixed in a flow tube. Adding PI, standing at 37 deg.C, and 5% CO₂The culture was incubated for 4 h. Flow cytometry detection of CFSE⁺PI⁺Percentage of cells (dead target cells).

Target cell death (%) -target cell natural death (%) plus T cell stimulation.

1.13 methods of tumor treatment in mice

In humanized NSG mice (The Jackson Laboratory (JAX)), The right axilla was injected subcutaneously with 5X 10⁶Tumor cell (MM melanoma, HCC liver cancer, CRC colorectal cancer) cell, when the tumor grows to 60MM³In size, tail vein injection of 200uLPBS (containing human immune cells and 1X 10)⁶Expressing the exosome-encapsulated shRNA and/or shRNA-miR-targeting pluripotent stem cell derivative) for tumor treatmentTreatment, in which only the group containing human immune cells was injected as a control group. Mice were sacrificed after 20 days and tumor sizes were compared between groups and statistical analysis of differences was performed.

2. Experimental protocol

The experimental scheme of knocking in the genes related to shRNA and/or shRNA-miR, exosome processing synthetic gene, first nucleic acid molecule, second nucleic acid molecule, shRNA and/or miRNA processing complex and anti-interferon effector molecule, which express the target BTLA, into the genome of the pluripotent stem cell is shown in the table 8-table 9, wherein the sign of "+" represents knocking in of a gene or a nucleic acid sequence, and the sign of "-" represents gene knockout.

TABLE 8 constitutive expression protocol

The plasmids selected and the specific knock-in positions were as follows:

general principle: the shRNA (or shRNA-miR) of the target BTLA is put into a shRNA (or shRNA-miR) expression frame 2 of the corresponding plasmid, the rest shRNA (or shRNA-miR) is put into a shRNA (or shRNA-miR) expression frame 1 of the corresponding plasmid, and the gene sequence is put into the MCS.

B2M-3 ' UTR-miRNA-focus or CIITA-3 ' UTR-miRNA-focus, i.e. the second nucleic acid molecule (SEQ ID No.10), knocks into the 3 ' UTR region of the B2M and CIITA genes, respectively.

The B2M/CIITA-3 'UTR-shRNA is an shRNA expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, specifically targets a transcription product of a second nucleic acid molecule in a B2M gene and a CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

B2M/CIITA-3 'UTR-shRNA-miR is an shRNA-miR expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, a transcription product of a second nucleic acid molecule in a targeting B2M gene and CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

CD47 represents the CD47 expression sequence, whose knock-in site is the genomic safety site AAVS 1.

If multiple fragments need to be inserted into the expression cassette or MCS, they can be ligated together using EMCV IRESWT (SEQ ID NO.102) and then inserted.

The gene knock-in sgRNA plasmid was: sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1 and sgRNA clone CIITA-2.

sgRNA plasmids used for gene knockout were: sgRNA clone B2M-3, sgRNA clone B2M-4, sgRNA clone CIITA-3 and sgRNA clone CIITA-4.

(1) Aa1 grouping

shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid was placed into the shRNA target sequence of BTLA.

(2) Aa2 grouping

The shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid is put into a shRNA target sequence of BTLA, the shRNA expression frame 1 is put into the rest shRNA target sequences (including target sequences of B2M/CIITA-3' UTR-shRNA), and MCS is put into a gene sequence;

B2M KI Vector was put into B2M-3' UTR-miRNA-focus;

CIITA KI Vector is put into CIITA-3' UTR-miRNA-locus;

(Note: knock-in (KI) sgRNA plasmids: sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1, and sgRNA clone CIITA-2 were used).

(3) Aa3 grouping

And (3) placing an shRNA target sequence of BTLA into an shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid, placing the rest shRNA target sequences into an shRNA expression frame 1, knocking out B2M and CIITA, and placing MCS into a gene sequence.

(Note: Knockout (KO) using sgRNA plasmids: sgRNA clone B2M-3, sgRNA clone B2M-4, sgRNA clone CIITA-3, sgRNA clone CIITA-4).

(4) Aa4 grouping:

the shRNA expression frame 2 of AAVS1KI Vector (shRNA, constitutive) plasmid is placed into a shRNA sequence of the target BTLA, the shRNA expression frame 1 is placed into the rest shRNA target sequences, and the MCS is placed into a gene sequence.

(5) Ab1 grouping

The shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid is placed into the shRNA-miR target sequence of BTLA.

(6) Ab2 grouping

The shRNA-miR target sequence of BTLA is placed in a shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive type) plasmid, the rest shRNA-miR target sequences (including target sequences of B2M/CIITA-3' UTR-shRNA-miR) are placed in a shRNA-miR expression frame 1, and the gene sequence is placed in MCS;

B2M KI Vector was put into B2M-3' UTR-miRNA-focus;

CIITA KI Vector is put into CIITA-3' UTR-miRNA-locus;

(Note: Gene knock-in (KI)) sgRNA plasmids were used as sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1, and sgRNA clone CIITA-2.

(7) Ab3 grouping

The shRNA-miR target sequence of BTLA is placed in a shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid, the rest shRNA-miR target sequences are placed in a shRNA-miR expression frame 1, B2M and CIITA are knocked out, and MCS is placed in a gene sequence;

(8) Ab4 groups:

shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, constitutive) plasmid is provided with a shRNA-miR sequence of target BTLA, shRNA-miR expression frame 1 is provided with the rest shRNA-miR target sequence, and MCS is provided with a gene sequence.

When immune compatibility transformation is carried out, transformation can be carried out on hPSCs, and the derivative which is transformed into the pluripotent stem cells is used after the transformation is finished; the immune compatibility can also be modified after differentiation of hPSCs into derivatives of pluripotent stem cells.

TABLE 9 Experimental protocol for inducible expression (immuno-compatible reversible)

(1) B1 grouping:

the shRNA expression frame 2 of AAVS1KI Vector (shRNA, inducible) plasmid is put into a shRNA target sequence of BTLA, the shRNA expression frame 1 is put into the rest shRNA target sequences (including target sequences of B2M/CIITA-3' UTR-shRNA), and MCS is put into a gene sequence;

B2M KI Vector was put into B2M-3' UTR-miRNA-focus;

CIITA KI Vector is put into CIITA-3' UTR-miRNA-locus;

(Note: knock-in (KI)) sgRNA plasmids were used: sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1, and sgRNA clone CIITA-2, and a Tet-Off system was used for induction.

(2) B2 grouping:

shRNA-miR target sequences of BTLA are placed in a shRNA-miR expression framework 2 of AAVS1KI Vector (shRNA-miR, inducible) plasmid, the rest shRNA-miR target sequences (including target sequences of B2M/CIITA-3' UTR-shRNA-miR) are placed in a shRNA-miR expression framework 1, and MCS is placed in a gene sequence;

B2M KI Vector was put into B2M-3' UTR-miRNA-focus;

CIITAKI Vector is put into CIITA-3' UTR-miRNA-focus;

(3) B3 grouping:

the shRNA expression frame 2 of AAVS1KI Vector (shRNA, inducible) plasmid is placed into a shRNA sequence of the target BTLA, the shRNA expression frame 1 is placed into the rest shRNA target sequence (including the target sequence of B2M/CIITA-3' UTR-shRNA), and MCS is placed into a gene sequence. Adding a Tet-Off system induction system.

(4) B4 grouping:

shRNA-miR expression frame 2 of AAVS1KI Vector (shRNA-miR, inducible) plasmid is placed into a shRNA-miR sequence of the target BTLA, shRNA-miR expression frame 1 is placed into the rest shRNA-miR target sequence (including target sequences of B2M/CIITA-3' UTR-shRNA-miR), and MCS is placed into a gene sequence. Adding a Tet-Off system induction system.

The Tet-Off system in the invention specifically comprises the following steps:

in the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of the gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

The sequence of the Tet-Off system and one or more immune compatible molecules is knocked into a genome safety site of the pluripotent stem cell, and the expression of the immune compatible molecules is accurately turned on or Off through the addition of tetracycline, so that the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof can be reversibly regulated and controlled.

3. Results of the experiment

3.1 detection of the blocking Effect of exosomes loaded with BTLA-targeted shRNA and/or shRNA-miR expressed by pluripotent stem cells or derivatives thereof on BTLA

The experimental groups in tables 8-9 were knocked into the genomic safety locus of MSCs cells at 37 deg.C with 0.5% CO₂Culturing in an incubator, collecting culture medium supernatant, and extracting and culturing exosomes in the culture supernatant after culturing and expressing the pluripotent stem cells and derivatives thereof of the shRNA and/or the shRNA-miR targeting BTLA wrapped by the exosomes by using an exosome extraction kit (BestBio, lot # BB-3901). Centrifuging culture supernatant at 4 deg.C for 15min at 3000g, collecting supernatant, centrifuging at 4 deg.C for 20min at 10000g, and collectingAdding the extractive solution A into the supernatant at a ratio of 4:1, turning upside down for 1min, and standing at 4 deg.C overnight. Centrifuging at 4 deg.C for 60min at 10000g, and collecting exosome precipitate. And testing the blocking effect of the target BTLA shRNA and/or shRNA-miR expressed by the pluripotent stem cells by using a flow cytometry method. And adding exosomes containing shRNA and/or shRNA-miR of the target BTLA into a culture medium of the CHO cell expressing the BTLA, and culturing the CHO cell expressing the BTLA for 72 h. After digesting into single cells and washing the cells 2 times with PBS, FITC-labeled BTLA antibody fusion protein was added to the tube and incubated at 37 ℃ for 30 minutes. Flow cytometric analysis was performed using a flow cytometer. According to the average fluorescence intensity (MFI) of staining, the effect of the target BTLA shRNA and/or shRNA-miR expressed by the pluripotent stem cells on inhibiting the expression of BTLA by CHO cells can be measured. The results of the tests of the respective experimental groups are shown in Table 10. The N (control) group refers to CHO cells expressing BTLA cultured without addition of exosomes containing shRNA and/or shRNA-miR targeting BTLA.

TABLE 10 inhibitory Effect of BTLA-targeting shRNA and/or shRNA-miR expressed in each experimental group on BTLA expression

Group of	Relative MFI	Deviation (+/-)	Independent sample T test (. p)<0.01)
				N (control)	1.000	0.027	-
Aa1	0.473	0.013	*
				Aa2	0.472	0.033	*
Aa3	0.495	0.016	*
				Aa4	0.487	0.041	*
Ab1	0.483	0.035	*
				Ab2	0.475	0.022	*
Ab3	0.499	0.008	*
				Ab4	0.442	0.010	*
B1	0.489	0.026	*
				B2	0.481	0.018	*
B3	0.465	0.017	*
				B4	0.451	0.035	*

From the above table, it can be seen that the shRNA and/or shRNA-miR of the target BTLA encapsulated by the exosome, which is expressed by the pluripotent stem cell or the derivative thereof, can effectively inhibit the BTLA expression of the target cell, thereby achieving the effect of blocking the BTLA.

3.2 antitumor Effect of pluripotent Stem cells expressing BTLA-targeting shRNA and/or shRNA-miR or derivatives thereof

And knocking each experimental group scheme in tables 8-9 into a genome safety site of the MSCs cell to obtain a cell for expressing the target shRNA and/or shRNA-miR of the BTLA. The CFSE test was used to test its anti-tumor effect. The results of the tests of the respective experimental groups are shown in Table 11.

TABLE 11 Effect of BTLA-targeting shRNA and/or shRNA-miR expressed in each experimental group on T cell killing of tumor cells

Group of	Average value of target cell death (%)	Deviation (+/-)	Independent sample T test (. p)<0.01)
				N (control)	34.434	0.154	-
Aa1	55.573	3.824	*
				Aa2	55.001	3.988	*
Aa3	54.525	4.573	*
				Aa4	55.516	4.154	*
Ab1	54.305	4.646	*
				Ab2	58.168	1.627	*
Ab3	51.683	2.342	*
				Ab4	53.182	2.764	*
B1	54.394	0.942	*
				B2	53.855	1.957	*
B3	57.714	1.361	*
				B4	54.462	2.708	*

Note: group N (control) refers to cells that were not treated with culture supernatant of pluripotent stem cells expressing shRNA and/or shRNA-miR targeting BTLA. Independent samples were tested for T (/ p < 0.01).

Through the experiment, the experiment proves that the shRNA and/or shRNA-miR of the target BTLA encapsulated by the exosome, expressed by the pluripotent stem cell or the derivative thereof, has the anti-tumor effect.

3.3 application of BTLA-targeted shRNA and/or shRNA-miR in treatment of various tumors

We selected cells (MSCs) from B2M and CIITA knock-out protocol groups (Aa3, Ab3) for testing.

In humanized NSG mouse tumor model, we injected each group of experimental cells to observe the effect on the treatment of MM melanoma, HCC liver cancer, CRC colorectal cancer. To avoid the problem of immune compatibility, we used immunocytes derived from the same human as hPSCs and hPSCs derived derivatives. The results of each experimental group are shown in table 12.

TABLE 12 antitumor Effect of BTLA-targeting shRNA and/or shRNA-miR-expressed in each experimental group or derivatives thereof

Note: the N (control) group refers to the NSG mouse tumor model without injection of experimental cells. Independent samples were tested for T (./p < 0.01).

Through the experiment, the experiment proves that the BTLA-targeting shRNA and/or shRNA-miR expressed by the pluripotent stem cell or the derivative thereof and wrapped by an exosome can play an anti-tumor role.

3.4 reversible expression assay for immune-compatible molecule-inducible expression sets

Through the embodiment, the hPSCs derived derivative for expressing the shRNA and/or shRNA-miR of the target BTLA can effectively block the BTLA to play an anti-tumor role. We must also consider the problem of immune compatibility of derivatives of hPSCs origin. Therefore we chose a suitable combination to test for immune compatibility.

By utilizing the characteristic of low immunogenicity of MSCs, hPSCs (human mesenchymal stem cells) which can express target BTLA shRNA/shRNA-miR are injected into a humanized NSG mouse tumor model to achieve immune compatibility with the MSCs, and the effect of tumor (MM melanoma) treatment is observed. Note that the immunocytes used were derived from a non-identical human as the hPSCs-derived MSCs.

The control group refers to the NSG mouse tumor model without MSCs cell injection.

The process of adding the Dox group is: mice were fed with 0.5mg/mL Dox added to the mouse diet, starting with the injection of shRNA/shRNA-miR cells expressing the target BTLA and used until the end of the experiment. The results are shown in Table 13.

TABLE 13 reversible expression test results for immune-compatible molecule-inducible expression sets

The above experiments show that: MSCs that express only BTLA-targeting shRNA (group 2) have low immunogenicity and can exist in foreign body for a certain time, so that they can exert a certain tumor treatment effect, whereas those that are subject to immune compatibility modification (groups 3-7, including constitutive and reversible inducible immune compatibility) have better immune compatibility effects than those that exist in vivo for a longer time (or can achieve long-term coexistence) than MSCs that are not subject to immune compatibility modification, and thus exert a better tumor treatment effect, whereas group 4 is a B2M and CIITA gene knock-out group, which completely eliminates the influence of HLA-I and HLA-II molecules, so that they have the best tumor treatment effect. However, there are group 6-9 protocol settings because of their constitutive immune-compatible modifications (knock-in/knock-out) and their inability to clear the graft when it is mutated or otherwise not needed. In groups 8 and 9, while injecting cells expressing the target BTLA shRNA/shRNA-miR into the mice, a Dox inducer (used all the time) is used for the mice, the immune compatibility effect of the mice injecting the cells expressing the target BTLA shRNA/shRNA-miR is eliminated, the existing time in vivo is equivalent to that of the MSCs which are not subjected to immune compatibility modification, and the tumor treatment effect of the mice is also equivalent to that of the MSCs which are not subjected to immune compatibility modification.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> future Chile regenerative medicine institute (Guangzhou) Co., Ltd

Wang Linli

<120> pluripotent stem cell expressing BTLA-targeted shRNA and/or shRNA-miR or derivative thereof

<130>

<160> 103

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> human

<400> 1

ggacatctgg aacatccatg g 21

<210> 2

<211> 21

<212> DNA

<213> human

<400> 2

ggaaattaac ctggttgatg c 21

<210> 3

<211> 21

<212> DNA

<213> human

<400> 3

gcaccaacag aatatgcatc c 21

<210> 4

<211> 21

<212> DNA

<213> Caenorhabditis elegans

<400> 4

ttgtactaca caaaagtact g 21

<210> 5

<211> 315

<212> DNA

<213> Artificial sequence

<400> 5

ccactcccta tcagtgatag agaaaagtga aagtcgagtt taccactccc tatcagtgat 60

agagaaaagt gaaagtcgag tttaccactc cctatcagtg atagagaaaa gtgaaagtcg 120

agtttaccac tccctatcag tgatagagaa aagtgaaagt cgagctcggt acccgggtcg 180

aggtaggcgt gtacggtggg aggcctatat aagcagagct cgtttagtga accgtcagat 240

cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag 300

cctgctagcg ccacc 315

<210> 6

<211> 9

<212> DNA

<213> Artificial sequence

<400> 6

ttcaagaga 9

<210> 7

<211> 119

<212> DNA

<213> Artificial sequence

<400> 7

gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60

cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence

<400> 8

tagtgaagcc acagatgta 19

<210> 9

<211> 119

<212> DNA

<213> Artificial sequence

<400> 9

tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60

tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119

<210> 10

<211> 210

<212> DNA

<213> Artificial sequence

<400> 10

attctagata cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta 60

cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt 120

gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt gtgtagtaca 180

acgtacagta cttttgtgta gtacaacgta 210

<210> 11

<211> 21

<212> DNA

<213> human

<400> 11

gggagcagag aattctctta t 21

<210> 12

<211> 21

<212> DNA

<213> human

<400> 12

ggagcagaga attctcttat c 21

<210> 13

<211> 21

<212> DNA

<213> human

<400> 13

gagcagagaa ttctcttatc c 21

<210> 14

<211> 21

<212> DNA

<213> human

<400> 14

gctacctgga gcttcttaac a 21

<210> 15

<211> 21

<212> DNA

<213> human

<400> 15

ggagcttctt aacagcgatg c 21

<210> 16

<211> 21

<212> DNA

<213> human

<400> 16

gggtctccag tatattcatc t 21

<210> 17

<211> 21

<212> DNA

<213> human

<400> 17

gctcccactc catgaggtat t 21

<210> 18

<211> 21

<212> DNA

<213> human

<400> 18

ggtatttctt cacatccgtg t 21

<210> 19

<211> 21

<212> DNA

<213> human

<400> 19

aggagacacg gaatgtgaag g 21

<210> 20

<211> 21

<212> DNA

<213> human

<400> 20

gctcccactc catgaggtat t 21

<210> 21

<211> 21

<212> DNA

<213> human

<400> 21

ggtatttcta cacctccgtg t 21

<210> 22

<211> 21

<212> DNA

<213> human

<400> 22

ggaccggaac acacagatct a 21

<210> 23

<211> 21

<212> DNA

<213> human

<400> 23

ttcttacttc cctaatgaag t 21

<210> 24

<211> 21

<212> DNA

<213> human

<400> 24

aagttaagaa cctgaatata a 21

<210> 25

<211> 21

<212> DNA

<213> human

<400> 25

aacctgaata taaatttgtg t 21

<210> 26

<211> 21

<212> DNA

<213> human

<400> 26

gggtctggtg ggcatcatta t 21

<210> 27

<211> 21

<212> DNA

<213> human

<400> 27

ggtctggtgg gcatcattat t 21

<210> 28

<211> 21

<212> DNA

<213> human

<400> 28

gcatcattat tgggaccatc t 21

<210> 29

<211> 21

<212> DNA

<213> human

<400> 29

gatgaccaca ttcaaggaag a 21

<210> 30

<211> 21

<212> DNA

<213> human

<400> 30

gaccacattc aaggaagaac t 21

<210> 31

<211> 21

<212> DNA

<213> human

<400> 31

gctttcctgc ttggcagtta t 21

<210> 32

<211> 21

<212> DNA

<213> human

<400> 32

gcgtaagtct gagtgtcatt t 21

<210> 33

<211> 21

<212> DNA

<213> human

<400> 33

gacaatttaa ggaagaatct t 21

<210> 34

<211> 21

<212> DNA

<213> human

<400> 34

ggccatagtt ctccctgatt g 21

<210> 35

<211> 21

<212> DNA

<213> human

<400> 35

gccatagttc tccctgattg a 21

<210> 36

<211> 21

<212> DNA

<213> human

<400> 36

gcagatgacc acattcaagg a 21

<210> 37

<211> 21

<212> DNA

<213> human

<400> 37

gcagcaggat aagtatgagt g 21

<210> 38

<211> 21

<212> DNA

<213> human

<400> 38

gcaggataag tatgagtgtc a 21

<210> 39

<211> 21

<212> DNA

<213> human

<400> 39

ggttcctgca cagagacatc t 21

<210> 40

<211> 21

<212> DNA

<213> human

<400> 40

ggatgtggaa cccacagata c 21

<210> 41

<211> 21

<212> DNA

<213> human

<400> 41

gatgtggaac ccacagatac a 21

<210> 42

<211> 21

<212> DNA

<213> human

<400> 42

gtggaaccca cagatacaga g 21

<210> 43

<211> 21

<212> DNA

<213> human

<400> 43

gggtagcaac tgtcaccttg a 21

<210> 44

<211> 21

<212> DNA

<213> human

<400> 44

ggatttcgtg ttccagttta a 21

<210> 45

<211> 21

<212> DNA

<213> human

<400> 45

gcatgtgcta cttcaccaac g 21

<210> 46

<211> 21

<212> DNA

<213> human

<400> 46

gctcacagtc atcaattata g 21

<210> 47

<211> 21

<212> DNA

<213> human

<400> 47

gccctgaaga cagaatgttc c 21

<210> 48

<211> 21

<212> DNA

<213> human

<400> 48

gcggaccatg tgtcaactta t 21

<210> 49

<211> 21

<212> DNA

<213> human

<400> 49

gcctgatagg acccatattc c 21

<210> 50

<211> 21

<212> DNA

<213> human

<400> 50

gcatccaata gacgtcattt g 21

<210> 51

<211> 21

<212> DNA

<213> human

<400> 51

gcgtcactgg cacagatata a 21

<210> 52

<211> 21

<212> DNA

<213> human

<400> 52

ggatggattt gattatgatc c 21

<210> 53

<211> 21

<212> DNA

<213> human

<400> 53

ggaccttgga acaatggatt g 21

<210> 54

<211> 21

<212> DNA

<213> human

<400> 54

gctaattctt gctgaacttc t 21

<210> 55

<211> 21

<212> DNA

<213> human

<400> 55

gcagttctgt tgccactctc t 21

<210> 56

<211> 21

<212> DNA

<213> human

<400> 56

gggagagttc atccaggaaa t 21

<210> 57

<211> 21

<212> DNA

<213> human

<400> 57

ggagagttca tccaggaaat t 21

<210> 58

<211> 21

<212> DNA

<213> human

<400> 58

gggttggttt atccaggaat a 21

<210> 59

<211> 21

<212> DNA

<213> human

<400> 59

ggatcagaag agaagccaac g 21

<210> 60

<211> 21

<212> DNA

<213> human

<400> 60

ggttcaccat ccaggtgttc a 21

<210> 61

<211> 21

<212> DNA

<213> human

<400> 61

ggaggaactt tgtgaacatt c 21

<210> 62

<211> 21

<212> DNA

<213> human

<400> 62

gctgtaagaa ggatgctttc a 21

<210> 63

<211> 21

<212> DNA

<213> human

<400> 63

gctgcaggca ggattgtttc a 21

<210> 64

<211> 19

<212> DNA

<213> human

<400> 64

gcctcgagtt tgagagcta 19

<210> 65

<211> 19

<212> DNA

<213> human

<400> 65

agacattctg gatgagtta 19

<210> 66

<211> 19

<212> DNA

<213> human

<400> 66

gggtctgtta cccaaagaa 19

<210> 67

<211> 21

<212> DNA

<213> human

<400> 67

ggacactggt tcaacacctg t 21

<210> 68

<211> 21

<212> DNA

<213> human

<400> 68

ggttcaacac ctgtgacttc a 21

<210> 69

<211> 21

<212> DNA

<213> human

<400> 69

acctgtgact tcatgtgtgc g 21

<210> 70

<211> 253

<212> DNA

<213> Artificial sequence

<400> 70

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgctagcgcc acc 253

<210> 71

<211> 686

<212> DNA

<213> Artificial sequence

<400> 71

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660

gaccgatcca gcctgctagc gccacc 686

<210> 72

<211> 1607

<212> DNA

<213> human

<400> 72

atgaatactc tccctgaaca ttcatgtgac gtgttgatta tcggtagcgg cgcagccgga 60

ctttcactgg cgctacgcct ggctgaccag catcaggtca tcgttctaag taaggccggt 120

aacgaggttc aacattttat gcccagggcg gtattgccgc cgtgtttgat aaactgacag 180

cattgactcg catgtggaag acacattgat tgccggggct ggtatttgcg atcgccatgc 240

agttgaattt gtcgccagca atgcacgatc ctgtgtgcaa tggctaatcg accagggggt 300

gttgtttgat acccacattc aaccgaatgg cgaagaaagt taccatctga cccgtgaagg 360

tggacatagt caccgtcgta ttcttcatgc cgccgacgcc accggtagag aagtagaaac 420

cacgctggtg agcaaggcgc tgaaccatcc gaatattcgc gtgctggagc gcagcaacgc 480

ggttgatctg attgtttctg acaaaattgg cctgccgggc acgcgacggg ttgttggcgc 540

gtgggtatgg aaccgtaata aagaaacggt ggaaacctgc cacgcaaaag cggtggtgct 600

ggcaaccggc ggtgcgtcga aggtttatca gtacaccacc aatccggata tttcttctgg 660

cgatggcatt gctatggcgt ggcgcgcagg ctgccggttg ccaatctcga tttaatcagt 720

tccaccctac cgcgctatat cacccacagg cacgcaattt cctgttaaca gaagcactgc 780

gcggcgaggc gcttatctca agcgcccgga tggtacgcgt ttatccgatt ttgatgagcg 840

cggcgaactg ccccgcgcga tattgtcgcc cgcgccattg accatgaaat gaaacgcctc 900

ggcgcagatt gtatgttcct tgatatcagc cataagcccg ccgattttat tcgccagcat 960

ttcccgatga tttatgaaaa gctgctcggg ctgggattga tctcacacaa gaaccggtac 1020

cgattgtgcc tgctgcacat tatacctgcg gtggtgtaat ggttgatgat catgggcgta 1080

cggacgtcga gggcttgtat gccattggcg aggtgagtta taccggctta cacggcgcta 1140

accgcatggc ctcgaattca ttgctggagt gtctggtcta tggctggtcg gcggcggaag 1200

atatcaccag acgtatgcct tatgcccacg acatcagtac gttaccgccg tgggatgaaa 1260

gccgcgttga gaaccctgac gaacggtagt aattcagcat aactggcacg agctacgtct 1320

gtttatgtgg gattacgttg gcattgtgcg cacaacgaag cgcctggaac gcgccctgcg 1380

gcggataacc atgctccaac aagaaataga cgaatattac gcccatttcc gcgtctcaaa 1440

taatttgctg gagctgcgta atctggtaca ggttgccgag ttgattgttc gctgtgcaat 1500

gatgcgtaaa gagagtcggg gttgcatttc acgctggatt atccggaact gctcacccat 1560

tccggtccgt cgatccttcc cccggcaatc attacataaa cagataa 1607

<210> 73

<211> 411

<212> DNA

<213> human

<400> 73

ggaagtggtg ccggcaccgg cggcatgtac gtgcgcttcg aggtgcccga ggacatgcag 60

aacgaggccc tgagcctgct ggaaaaagtg cgcgagagcg gcaaagtgaa gaagggcacc 120

aacgaaacca ccaaggccgt ggaacggggc ctggccaagc tggtgtatat cgccgaggac 180

gtggaccccc ccgagattgt ggcccatctg cccctgctgt gcgaagagaa gaacgtgccc 240

tacatctacg tgaagtccaa gaacgacctg ggcagagccg tgggcatcga ggtgccatgt 300

gcctctgccg ccatcatcaa cgagggcgag ctgcggaaag aactgggcag cctggtggaa 360

aagatcaagg gcctgcagaa gggttccggt ggatccggtt ccggacgggc t 411

<210> 74

<211> 23

<212> DNA

<213> Artificial sequence

<400> 74

tataaggtgg tcccagctcg ggg 23

<210> 75

<211> 23

<212> DNA

<213> Artificial sequence

<400> 75

agggccggtt aatgtggctc tgg 23

<210> 76

<211> 23

<212> DNA

<213> Artificial sequence

<400> 76

ctcctgttat attctagaac agg 23

<210> 77

<211> 23

<212> DNA

<213> Artificial sequence

<400> 77

tttcagcatc aatgtaccct ggg 23

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence

<400> 78

cgcgagcaca gctaaggcca 20

<210> 79

<211> 20

<212> DNA

<213> Artificial sequence

<400> 79

actctctctt tctggcctgg 20

<210> 80

<211> 23

<212> DNA

<213> Artificial sequence

<400> 80

ggcactcaga agacactgat ggg 23

<210> 81

<211> 23

<212> DNA

<213> Artificial sequence

<400> 81

aaggtgtctg gtcggagagc agg 23

<210> 82

<211> 20

<212> DNA

<213> Artificial sequence

<400> 82

acccagcagg gcgtggagcc 20

<210> 83

<211> 20

<212> DNA

<213> Artificial sequence

<400> 83

gtcagagccc caaggtaaaa 20

<210> 84

<211> 804

<212> DNA

<213> Artificial sequence

<400> 84

tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360

tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

gtcccctcca ccccacagtg gggc 804

<210> 85

<211> 837

<212> DNA

<213> Artificial sequence

<400> 85

actagggaca ggattggtga cagaaaagcc ccatccttag gcctcctcct tcctagtctc 60

ctgatattgg gtctaacccc cacctcctgt taggcagatt ccttatctgg tgacacaccc 120

ccatttcctg gagccatctc tctccttgcc agaacctcta aggtttgctt acgatggagc 180

cagagaggat cctgggaggg agagcttggc agggggtggg agggaagggg gggatgcgtg 240

acctgcccgg ttctcagtgg ccaccctgcg ctaccctctc ccagaacctg agctgctctg 300

acgcggccgt ctggtgcgtt tcactgatcc tggtgctgca gcttccttac acttcccaag 360

aggagaagca gtttggaaaa acaaaatcag aataagttgg tcctgagttc taactttggc 420

tcttcacctt tctagtcccc aatttatatt gttcctccgt gcgtcagttt tacctgtgag 480

ataaggccag tagccagccc cgtcctggca gggctgtggt gaggaggggg gtgtccgtgt 540

ggaaaactcc ctttgtgaga atggtgcgtc ctaggtgttc accaggtcgt ggccgcctct 600

actccctttc tctttctcca tccttctttc cttaaagagt ccccagtgct atctgggaca 660

tattcctccg cccagagcag ggtcccgctt ccctaaggcc ctgctctggg cttctgggtt 720

tgagtccttg gcaagcccag gagaggcgct caggcttccc tgtccccctt cctcgtccac 780

catctcatgc ccctggctct cctgcccctt ccctacaggg gttcctggct ctgctct 837

<210> 86

<211> 900

<212> DNA

<213> Artificial sequence

<400> 86

cctggacttc tccagtactt tctggctgga ttggtatctg aggctagtag gaagggcttg 60

ttcctgctgg gtagctctaa acaatgtatt catgggtagg aacagcagcc tattctgcca 120

gccttatttc taaccatttt agacatttgt tagtacatgg tattttaaaa gtaaaactta 180

atgtcttcct tttttttctc cactgtcttt ttcatagatc gagacatgta agcagcatca 240

tggaggtaag tttttgacct tgagaaaatg tttttgtttc actgtcctga ggactattta 300

tagacagctc taacatgata accctcacta tgtggagaac attgacagag taacatttta 360

gcagggaaag aagaatccta cagggtcatg ttcccttctc ctgtggagtg gcatgaagaa 420

ggtgtatggc cccaggtatg gccatattac tgaccctcta cagagagggc aaaggaactg 480

ccagtatggt attgcaggat aaaggcaggt ggttacccac attacctgca aggctttgat 540

ctttcttctg ccatttccac attggacatc tctgctgagg agagaaaatg aaccactctt 600

ttcctttgta taatgttgtt ttattcttca gacagaagag aggagttata cagctctgca 660

gacatcccat tcctgtatgg ggactgtgtt tgcctcttag aggttcccag gccactagag 720

gagataaagg gaaacagatt gttataactt gatataatga tactataata gatgtaacta 780

caaggagctc cagaagcaag agagagggag gaacttggac ttctctgcat ctttagttgg 840

agtccaaagg cttttcaatg aaattctact gcccagggta cattgatgct gaaaccccat 900

<210> 87

<211> 900

<212> DNA

<213> Artificial sequence

<400> 87

tcaaatctcc tgttatattc tagaacaggg aattgatttg ggagagcatc aggaaggtgg 60

atgatctgcc cagtcacact gttagtaaat tgtagagcca ggacctgaac tctaatatag 120

tcatgtgtta cttaatgacg gggacatgtt ctgagaaatg cttacacaaa cctaggtgtt 180

gtagcctact acacgcatag gctacatggt atagcctatt gctcctagac tacaaacctg 240

tacagcctgt tactgtactg aatactgtgg gcagttgtaa cacaatggta agtatttgtg 300

tatctaaaca tagaagttgc agtaaaaata tgctatttta atcttatgag accactgtca 360

tatatacagt ccatcattga ccaaaacatc atatcagcat tttttcttct aagattttgg 420

gagcaccaaa gggatacact aacaggatat actctttata atgggtttgg agaactgtct 480

gcagctactt cttttaaaaa ggtgatctac acagtagaaa ttagacaagt ttggtaatga 540

gatctgcaat ccaaataaaa taaattcatt gctaaccttt ttcttttctt ttcaggtttg 600

aagatgccgc atttggattg gatgaattcc aaattctgct tgcttgcttt ttaatattga 660

tatgcttata cacttacact ttatgcacaa aatgtagggt tataataatg ttaacatgga 720

catgatcttc tttataattc tactttgagt gctgtctcca tgtttgatgt atctgagcag 780

gttgctccac aggtagctct aggagggctg gcaacttaga ggtggggagc agagaattct 840

cttatccaac atcaacatct tggtcagatt tgaactcttc aatctcttgc actcaaagct 900

<210> 88

<211> 900

<212> DNA

<213> Artificial sequence

<400> 88

cttgacaagt ctcctgctcc tcactatgaa gatcactgtc ccccagccct gtgctccccg 60

cactgtgctg cacgtccacc tccattccac tgcccctccc atccccccat cttgatagca 120

cccttcccag gtgtcaagct gcccctccta gagtgtcctg cctaaacccc ctctcctggc 180

tcctcccgct acagcatgtt ctctgaggac actaaccacg ctggaccttg aactgggtac 240

ttgtggacac agctcttctc caggctgtat cccatgagcc tcagcatcct ggcacccggc 300

ccctgctggt tcagggttgg cccctgcccg gctgcggaat gaaccacatc ttgctctgct 360

gacagacaca ggcccggctc caggctcctt tagcgcccag ttgggtggat gcctggtggc 420

agctgcggtc cacccaggag ccccgaggcc ttctctgaag gacattgcgg acagccacgg 480

ccaggccaga gggagtgaca gaggcagccc cattctgcct gcccaggccc ctgccaccct 540

ggggagaaag tacttctttt tttttatttt tagacagagt ctcactgttg cccaggctgg 600

cgtgcagtgg tgcgatctgg gttcactgca acctccgcct cttgggttca agcgattctt 660

ctgcttcagc ctcccgagta gctgggacta caggcaccca ccatcatgtc tggctaattt 720

ttcattttta gtagagacag ggttttgcca tgttggccag gctggtctca aactcttgac 780

ctcaggtgat ccacccacct cagcctccca aagtgctggg attacaagcg tgagccactg 840

caccgggcca cagagaaagt acttctccac cctgctctcc gaccagacac cttgacaggg 900

<210> 89

<211> 900

<212> DNA

<213> Artificial sequence

<400> 89

cacaccgggc actcagaaga cactgatggg caacccccag cctgctaatt ccccagattg 60

caacaggctg ggcttcagtg gcagctgctt ttgtctatgg gactcaatgc actgacattg 120

ttggccaaag ccaaagctag gcctggccag atgcaccagc ccttagcagg gaaacagcta 180

atgggacact aatggggcgg tgagagggga acagactgga agcacagctt catttcctgt 240

gtcttttttc actacattat aaatgtctct ttaatgtcac aggcaggtcc agggtttgag 300

ttcataccct gttaccattt tggggtaccc actgctctgg ttatctaata tgtaacaagc 360

caccccaaat catagtggct taaaacaaca ctcacattta ttctgctcac atatctgtca 420

tttgagcagg gctcagcggg gacagctcct tctgtcctac tctgtgtcag gtggggcagc 480

ttgagggttg ggctggtgtc acctgaagac tcattcttct gtacgtctga caggcaatgc 540

tggctgttgg ctgggggcct cagtgccact acggaatagt tggctaggac ccctccatgt 600

gggctagttg ggcttcctca tagtatggtg gctgggttgg agggtgtccc aaaaagaaag 660

gaggggatag agagagacca cttttcataa cctagcctta gaagtcacac agtattactt 720

ctgctacata tatatgtttt aagaggcagg gtctcactct gtcgcccagt ctggaatgca 780

gtggtatgat cacggctcac tgcagcctca acctcctggg ctaagtgatc ctcccacctc 840

agcctcccga atagctggga ctacaggtgt gagtcaccaa gcccagttaa tctttagttt 900

<210> 90

<211> 22

<212> DNA

<213> Artificial sequence

<400> 90

ccatagctca gtctggtcta tc 22

<210> 91

<211> 22

<212> DNA

<213> Artificial sequence

<400> 91

ctcttcgtcc agatcatcct ga 22

<210> 92

<211> 22

<212> DNA

<213> Artificial sequence

<400> 92

ccatagctca gtctggtcta tc 22

<210> 93

<211> 20

<212> DNA

<213> Artificial sequence

<400> 93

cacaccttgc cgatgtcgag 20

<210> 94

<211> 24

<212> DNA

<213> Artificial sequence

<400> 94

gcactgaacg aacatctcaa gaag 24

<210> 95

<211> 22

<212> DNA

<213> Artificial sequence

<400> 95

ctcttcgtcc agatcatcct ga 22

<210> 96

<211> 24

<212> DNA

<213> Artificial sequence

<400> 96

gcactgaacg aacatctcaa gaag 24

<210> 97

<211> 20

<212> DNA

<213> Artificial sequence

<400> 97

cacaccttgc cgatgtcgag 20

<210> 98

<211> 22

<212> DNA

<213> Artificial sequence

<400> 98

tgctccgggt ttgtctcaga tg 22

<210> 99

<211> 22

<212> DNA

<213> Artificial sequence

<400> 99

ctcttcgtcc agatcatcct ga 22

<210> 100

<211> 22

<212> DNA

<213> Artificial sequence

<400> 100

tgctccgggt ttgtctcaga tg 22

<210> 101

<211> 20

<212> DNA

<213> Artificial sequence

<400> 101

cacaccttgc cgatgtcgag 20

<210> 102

<211> 590

<212> DNA

<213> Artificial sequence

<400> 102

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590

<210> 103

<211> 24

<212> DNA

<213> Caenorhabditis elegans

<400> 103

tcacaacctc ctagaaagag taga 24

Claims

1. A pluripotent stem cell or derivative thereof, wherein: the genome of the pluripotent stem cell or the derivative thereof is introduced with an expression sequence of shRNA and/or shRNA-miR of the target BTLA.

2. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the target sequence of the target BTLA-targeting shRNA and/or shRNA-miR is shown in SEQ ID NO. 1-SEQ ID NO. 3.

3. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the B2M and/or CIITA gene of the pluripotent stem cell or the derivative thereof is knocked out.

4. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the genome of the pluripotent stem cell or the derivative thereof is also introduced with a first nucleic acid molecule;

and the pluripotent stem cell or the derivative thereof has a second nucleic acid molecule introduced into the 3' UTR region of the immune response-associated gene; the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, which small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and which small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

5. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the small nucleic acid molecule comprises at least one of a short interfering nucleic acid, a short interfering RNA, a double-stranded RNA, preferably miRNA, shRNA-miR.

6. The pluripotent stem cells or derivatives thereof according to claim 5, wherein the pluripotent stem cells or derivatives thereof are derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of humans.

7. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the second nucleic acid molecule comprises the reverse complement of at least 3 repeats of the small nucleic acid molecule sequence, preferably 6-10 repeats of the small nucleic acid molecule sequence.

8. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the genome of the pluripotent stem cell or the derivative thereof is also introduced with one or more immune compatible molecule expression sequences for regulating the expression of genes associated with an immune response in the pluripotent stem cell or the derivative thereof.

9. The pluripotent stem cell or the derivative thereof according to claim 4 or 8, wherein: the genes associated with the immune response include:

(2) major histocompatibility complex-associated genes including at least one of B2M and CIITA.

10. The pluripotent stem cell or the derivative thereof according to claim 8, wherein: the immune-compatible molecule comprises any one or more of:

(1) immune tolerance related genes including CD47 or HLA-G;

(4) shRNA and/or shRNA-miR targeting a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.

11. The pluripotent stem cell or the derivative thereof according to claim 10, wherein:

the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 11-SEQ ID NO. 13;

the target sequence of the target HLA-A shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 17-SEQ ID NO. 19;

the target sequence of the target HLA-B shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 20-SEQ ID NO. 22;

the target sequence of the target HLA-C shRNA and/or shRNA-miR is selected from one of SEQ ID No. 23-SEQ ID No. 25;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRA is selected from one of SEQ ID NO. 26-SEQ ID NO. 28;

12. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 11, wherein: shRNA and/or miRNA processing complex related genes and/or anti-interferon effector molecules are also introduced into the genome of the pluripotent stem cell or the derivative thereof.

13. The pluripotent stem cell or derivative thereof of claim 12, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8;

the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of PKR, 2-5As, IRF-3 and IRF-7.

14. The pluripotent stem cell or the derivative thereof of claim 13, wherein:

the target sequence of the target PKR-targeting shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 52-SEQ ID NO. 54;

the target sequence of the IRF-3-targeting shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 64-SEQ ID NO 66;

the target sequence of the shRNA and/or shRNA-miR of the targeted IRF-7 is selected from one of SEQ ID NO. 67-SEQ ID NO. 69.

15. The pluripotent stem cell or derivative thereof of claim 2, 11 or 14, wherein: the expression framework of the shRNA and/or shRNA-miR of the target BTLA, the major histocompatibility complex gene, the major histocompatibility complex related gene, the PKR, the 2-5As, the IRF-3 or the IRF-7 is As follows:

(1) shRNA expression framework: 5 'to 3' in turn comprising the shRNA target sequence of claim 2, 11 or 14, a stem-loop sequence, the reverse complement of the shRNA target sequence of claim 2, 7 or 10, Poly T; the two reverse complementary target sequences are separated by a middle stem-loop sequence to form a hairpin structure, and finally Poly T is connected to be used as a transcription terminator of RNA polymerase III;

(2) shRNA-miR expression framework: the shRNA-miR target sequence of claim 2, 11 or 14 is used for replacing a target sequence in microRNA-30 or microRNA-155.

16. The pluripotent stem cell or derivative thereof of claim 15, wherein: the length of a stem-loop sequence in the shRNA expression frame is 3-9 bases; the length of the Poly T is 5-6 bases.

17. The pluripotent stem cell or derivative thereof according to claim 4, 8 or 12, wherein: an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and is used for regulating and controlling the expression of the first nucleic acid molecule and/or the immune compatible molecule and/or the shRNA and/or the miRNA processing complex related gene and/or the anti-interferon effector molecule; preferably, the inducible gene expression system is at least one of a Tet-Off system and a dimer inducible expression system.

18. The pluripotent stem cell or derivative thereof according to any one of claims 1 to 17, wherein: the genome of the pluripotent stem cell or the derivative thereof is also introduced with an exosome processing synthetic gene;

preferably, the exosome processing synthetic gene comprises at least one of STEAP3, Syndevan-4, a fragment of L-aspartate oxidase (SEQ ID No.72), CD63-L7Ae (SEQ ID No.73) and Cx 43S 368A.

19. The pluripotent stem cell or derivative thereof of claim 18, wherein: the introduction of the expression sequence of the target BTLA shRNA and/or shRNA-miR, the expression sequence of the first nucleic acid molecule, the expression sequence of the immune compatible molecule, the shRNA and/or miRNA processing complex related gene, the anti-interferon effector molecule, the inducible gene expression system and the exosome processing synthetic gene adopts a method of viral vector interference, non-viral vector transfection or gene editing.

20. The pluripotent stem cell or derivative thereof of claim 18, wherein: the introduction site of the expression sequence of the target BTLA shRNA and/or shRNA-miR, the expression sequence of a first nucleic acid molecule, an immune compatible molecule, genes related to shRNA and/or miRNA processing complex, an anti-interferon effector molecule, an inducible gene expression system and an exosome processing synthetic gene is a genome safety site of the pluripotent stem cell or a derivative thereof;

preferably, the genome safe site comprises one or more of AAVS1 safe site, eGSH safe site, H11 safe site.

21. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 20, wherein:

the pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic cancer cells, or induced pluripotent stem cells;

the adult stem cells include mesenchymal stem cells or neural stem cells.

22. An exosome secreted from the pluripotent stem cell or derivative thereof according to any one of claims 1 to 21.

23. Use of the pluripotent stem cell or derivative thereof according to any one of claims 1 to 21 and/or the exosome according to claim 22 for the preparation of a medicament for the treatment of a tumor.