CN114657130A

CN114657130A - Pluripotent stem cell expressing VEGF-A targeted inhibitory factor, derivative and application thereof

Info

Publication number: CN114657130A
Application number: CN202011525773.3A
Authority: CN
Inventors: 王淋立; 陈月花; 莫健; 杨建国
Original assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Current assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2022-06-24

Abstract

The invention discloses a pluripotent stem cell expressing a VEGF-A targeted inhibitory factor, a derivative and an application thereof. An expression sequence of a VEGF-A inhibitor is introduced into a genome of the pluripotent stem cell or a derivative thereof, wherein the VEGF-A inhibitor is at least one of shRNA and/or shRNA-miR of a target VEGF-A. After the VEGF-A inhibiting factor expressed by the VEGF-A pluripotent stem cells or the derivatives thereof is wrapped by exosomes, the exosomes carry the VEGF-A inhibiting factor, are combined with target cells, release the VEGF-A inhibiting factor contained in the exosomes, so that a VEGF-A channel is blocked, immunosuppression is relieved, the immune system is activated, and tumor cells can be effectively eliminated and macular degeneration diseases can be effectively treated.

Description

Pluripotent stem cell expressing VEGF-A targeted inhibitory factor, derivative and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell expressing a VEGF-A targeted inhibitory factor, a derivative thereof and application thereof.

Background

VEGF-A (vascular endothelial growth factor A) is a member of the PDGF/VEGF growth factor family. VEGF-A encodes a heparin binding protein that exists as a disulfide linked homodimer. In the prior art, VEGF-A has certain functions in angiogenesis, angiogenesis and endothelial cell growth, can induce endothelial cell proliferation, promote cell migration, inhibit apoptosis and induce vascular permeability, and is necessary for physiological and pathological angiogenesis. The VEGF-A gene is up-regulated in many known tumors and its expression is correlated with tumor stage and progression.

On the other hand, in the field of cell therapy, the problem of immunological compatibility of allogens remains a big problem. In recent years, a plurality of reports have been provided that the deletion expression of genes on the cell surfaces of HLA-I and HLA-II or the genes thereof is realized by knocking out genes such as B2M, CIITA and the like, so that the cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.

Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 HLA-C antigen species of high-frequency immunological match are very different, and the proportion of partial areas can only account for 70 percent through verification and calculation, and the HLA data of large sample size which is not authoritative currently in a plurality of large population countries in the world is displayed, so that the prepared universal PSCs are still subjected to huge match vacancy test; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible schemes are also a matter of convenience in the "transition period", and many problems remain that are not better solved.

In addition, inducing killing of the suicide gene after donor tissue and cell disease has been induced, which results in serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that proper donor cells, tissues and organs do not exist after the cell death of the design.

Disclosure of Invention

The present invention aims to provide a pluripotent stem cell or a derivative thereof;

the invention also aims to provide application of the pluripotent stem cells or the derivatives thereof and secreted exosomes thereof in preparation of a macular degeneration treatment preparation or a medicament.

It is another object of the invention to provide an exosome.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof comprises a VEGF-A targeted inhibitor, wherein the VEGF-A targeted inhibitor comprises at least one of shRNA and shRNA-miR expressing VEGF-A; the sequences of the shRNA and shRNA-miR for expressing VEGF-A are preferably inserted into the genome of the pluripotent stem cell or the derivative thereof.

The inventor finds that VEGF-A inhibiting factors which are secreted in the pluripotent stem cells or the derivatives thereof and target VEGF-A after the expression sequences of the VEGF-A inhibiting factors are introduced into the pluripotent stem cells or the derivatives thereof, and the inhibiting factors are combined with target cells, so that tumor cells can be effectively eliminated and macular degeneration can be effectively inhibited.

Further, the sequences of the shRNA and shRNA-miR of the target VEGF-A are shown in SEQ ID NO. 1-SEQ ID NO. 2.

In a second aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, comprising a VEGF-A targeted inhibitor, wherein the VEGF-A targeted inhibitor comprises at least one of shRNA and shRNA-miR expressing VEGF-A; the sequences of the shRNA and shRNA-miR for expressing VEGF-A are preferably inserted into the genome of the pluripotent stem cell or the derivative thereof;

the B2M gene and/or CIITA gene of the genome of the pluripotent stem cell or the derivative thereof is knocked out.

When B2M and CIITA genes are knocked out, the influence of HLA-I and HLA-II molecules is completely eliminated, so that the treatment effect of tumors and macular degeneration is optimal.

In a third aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof comprises a VEGF-A targeted inhibitor, wherein the VEGF-A targeted inhibitor comprises at least one of shRNA and shRNA-miR expressing VEGF-A; the sequences of the shRNA and shRNA-miR for expressing VEGF-A are preferably inserted into the genome of the pluripotent stem cell or the derivative thereof;

a first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or the derivative thereof; and the pluripotent stem cell or the derivative thereof has a second nucleic acid molecule introduced into the 3' UTR region of the immune response-related gene; the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

In the technical scheme, the small nucleic acid molecule coded by the first nucleic acid molecule can be specifically combined with a transcription product of a second nucleic acid molecule introduced from a 3' UTR region of an immune response related gene, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked, so that the cell has the immune compatibility characteristic, and the allogeneic immune rejection response can be eliminated or reduced. Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3 'UTR of the immune response-related gene only acts on the donor cells, without interfering with the genome of the recipient's cells.

Further, the small nucleic acid molecule includes short interfering nucleic acid, short interfering RNA, and double-stranded RNA, and preferably at least one of miRNA, shRNA, and shRNA-miR.

Further, the pluripotent stem cell or the derivative thereof is derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of a human.

The small nucleic acid molecule is preferably derived from caenorhabditis elegans. For example:

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.101)；

5’-TCACAACCTCCTAGAAAGAGTAGA-3’(SEQ ID NO.102)。

further, the second nucleic acid molecule comprises a reverse complement of at least 3 repeated small nucleic acid molecule sequences, preferably 6-10 repeated small nucleic acid molecule sequences.

Furthermore, an inducible gene expression system is introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating the expression of the first nucleic acid molecule.

In the technical scheme, the inducible gene expression system is regulated and controlled by an exogenous inducer, and the opening and closing of the inducible gene expression system are controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, so that the expression quantity of small nucleic acid molecules is controlled.

When the inducible gene expression system is started, the transcription product of the small nucleic acid molecule which is normally expressed and the second nucleic acid molecule which is introduced into the 3' UTR region of the immune response related gene is specifically combined, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response may be eliminated or reduced, and the immune compatibility between the transplant and the recipient may be improved.

When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules is closed, the interference effect of the small nucleic acid on mRNA of the immune response related gene is stopped, the normal expression of the immune response related gene is recovered, the antigen presenting capability of graft cells is recovered, and the receptor can remove the pathological graft, so that the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells in clinical application is greatly expanded.

Moreover, the RNA interference program only acts on such engineered pluripotent stem cells or derivatives thereof, and thus, when such cells or derivatives are transplanted into a recipient, RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3 'UTR of the immune response-related gene only acts on the donor cells, without interfering with the genome of the recipient's cells.

In a fourth aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, comprising a VEGF-A targeted inhibitor, wherein the VEGF-A targeted inhibitor comprises at least one of shRNA and shRNA-miR expressing VEGF-A; the sequences of the shRNA and shRNA-miR for expressing VEGF-A are preferably inserted into the genome of the pluripotent stem cell or the derivative thereof.

The genome of the pluripotent stem cell or the derivative thereof is further introduced with an expression sequence of at least one immune compatible molecule for regulating the expression of a gene associated with an immune response in the pluripotent stem cell or the derivative thereof.

In the technical scheme, the immune compatible molecules can regulate and control the expression of genes related to immune response in the pluripotent stem cells or the derivatives thereof, so that the immunogenicity of the pluripotent stem cells or the derivatives thereof is low, and when the pluripotent stem cells or the derivatives thereof are transplanted into a recipient, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the transplant and the recipient is improved. The transplant can continuously express shRNA/shRNA-miR of the targeted VEGF-A in a receptor endogenous source, after the inhibition factors are wrapped by the exosome, the exosome carries the inhibition factors to be combined with the target cell, and then the inhibition factors are released, so that a VEGF-A pathway is blocked, immunosuppression is relieved, the immune system is activated, and tumor cells can be effectively eliminated and macular degeneration can be effectively improved.

Furthermore, an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and is used for regulating and controlling the expression of the immune compatible molecules.

In the technical scheme, the inducible gene expression system is regulated by an exogenous inducer, the on and off of the inducible gene expression system are controlled by adjusting the addition amount, the duration action time and the type of the exogenous inducer, and the expression quantity of an immune compatible molecular expression sequence is further controlled, so that the reversible regulation of the immune compatibility of the pluripotent stem cells or derivatives thereof is realized. When the immune compatible molecule is normally expressed, the expression of the genes related to the immune response in the pluripotent stem cells or the derivatives thereof is suppressed or overexpressed, so that when allogeneic cell therapy is performed, the allogeneic immune rejection response can be eliminated or reduced, and the immune compatibility between the donor cells and the recipient can be improved. When the donor cell is diseased, the expression of the immune compatible molecules can be closed by induction of an exogenous inducer, so that the HLA class I molecules can be reversibly re-expressed on the surface of the donor cell, the antigen presenting capability of the donor cell is recovered, and then the receptor immune system enables the receptor to eliminate the diseased cell by identifying unmatched HLA class I molecules or by cross HLA class I molecule antigen presenting (antigen presenting/identifying between classical incompatible HLA) mutated molecules, so that the clinical safety of the general pluripotent stem cell or the derivative thereof is improved, and the value of the general pluripotent stem cell in clinical application is greatly expanded.

With respect to the third and fourth aspects of the present invention, further, the genes associated with immune response include:

(1) major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(2) major histocompatibility complex-associated genes including at least one of B2M and CIITA.

With respect to the fourth aspect of the present invention, further, the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;

(3) shRNA and/or shRNA-miR targeting major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(4) shRNA and/or shRNA-miR targeting major histocompatibility complex-associated genes including at least one of B2M and CIITA.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 9-SEQ ID NO. 11;

the target sequence of the shRNA and/or shRNA-miR of the targeting CIITA is selected from one of SEQ ID NO. 12-SEQ ID NO. 14;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-A is selected from one of SEQ ID NO. 15-SEQ ID NO. 17;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-B is selected from one of SEQ ID NO. 18-SEQ ID NO. 20;

the target sequence of the target HLA-C shRNA and/or shRNA-miR is selected from one of SEQ ID NO. 21-SEQ ID NO. 23;

the target sequence of the shRNA and/or shRNA-miR of the targeted HLA-DRA is selected from one of SEQ ID NO. 24-SEQ ID NO. 26;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-DRB1 is selected from one of SEQ ID NO. 27-SEQ ID NO. 29;

the target sequence of the shRNA and/or shRNA-miR targeting HLA-DRB3 is selected from one of SEQ ID NO. 30-SEQ ID NO. 31;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB4 is selected from one of SEQ ID NO. 32-SEQ ID NO. 34;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB5 is selected from one of SEQ ID NO. 35-SEQ ID NO. 37;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQA1 is selected from one of SEQ ID NO. 38-SEQ ID NO. 40;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQB1 is selected from one of SEQ ID NO. 41-SEQ ID NO. 43;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPA1 is selected from one of SEQ ID NO. 44-SEQ ID NO. 46;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPB1 is selected from one of SEQ ID NO. 47-SEQ ID NO. 49.

In the first to fourth aspects of the present invention, further, the genome of the pluripotent stem cell or the derivative thereof further comprises an shRNA and/or miRNA processing complex-associated gene and/or an anti-interferon effector molecule, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of target PKR, 2-5As, IRF-3 and IRF-7.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting the PKR is selected from one of SEQ ID NO. 50-SEQ ID NO. 52;

the target sequence of the shRNA and/or shRNA-miR targeting 2-5As is selected from one of SEQ ID NO. 53-SEQ ID NO. 61;

the target sequence of the shRNA and/or shRNA-miR of the targeted IRF-3 is selected from one of SEQ ID NO. 62-SEQ ID NO. 64;

the target sequence of the shRNA and/or shRNA-miR of the target IRF-7 is selected from one of SEQ ID NO. 65-SEQ ID NO. 67.

With regard to the third and fourth aspects of the present invention, the inducible gene expression system includes at least one of a Tet-Off system, a dimer inducible expression system.

When the inducible gene expression system used is the Tet-Off system, the expression of small nucleic acid molecules in cells or their derivatives can be controlled by the addition of the exogenous inducer tetracycline (Doxycyline, Dox). After the pluripotent stem cells or the derivatives thereof are transplanted into a donor, the expression level of the small nucleic acid molecules can be gradually reduced even by adjusting the addition amount of Dox, so that the cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to the transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In general, Dox is added in an amount of 0 to 100 uM.

In the first to fourth aspects of the present invention, further, the genome of the pluripotent stem cell or the derivative thereof further introduces an exosome-processing synthetic gene comprising at least one of STEAP3, Syndevan-4, an L-aspartate oxidase fragment, CD63-L7Ae and Cx 43S 368A.

The secretion efficiency of the exosome and the encapsulation efficiency of the exosome on shRNA, shRNA-miR and mature siRNA can be improved by introducing the exosome processing synthetic gene into the genome of the stem cell or the stem cell derivative.

The dimer inducible expression system specifically refers to: dimerized inducers or dimers are used to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP (FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin)), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

In the first to fourth aspects of the present invention, further, the expression frameworks of the VEGF-a targeting shRNA and/or shRNA-miR, major histocompatibility complex gene, major histocompatibility complex-related gene, and anti-interferon effector molecule are as follows:

the shRNA expression framework is as follows: the gene sequence sequentially comprises an shRNA sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA sequence and Poly T from 5 'to 3';

wherein the shRNA sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA sequence form a hairpin structure; poly T is a transcription terminator of RNA polymerase III;

shRNA-miR expression framework: and replacing the shRNA target sequence in the shRNA expression frame by using a shRNA-miR sequence.

In the first to fourth aspects of the present invention, further, the VEGF-a inhibitory factor expression sequence, the first nucleic acid molecule, the immune-compatible molecule expression sequence, the shRNA and/or miRNA processing complex-related gene, the anti-interferon effector molecule, the inducible gene expression system, and the exosome processing synthetic gene are introduced by a method of viral vector interference, non-viral vector transfection, or gene editing, preferably by gene knock-in.

In the first to fourth aspects of the present invention, further, the VEGF-a inhibitory factor expression sequence, the immune-compatible molecule expression sequence, the shRNA and/or miRNA processing complex-related gene, the anti-interferon effector molecule, the inducible gene expression system, and the exosome processing synthetic gene are introduced at a genome-safe site, preferably at one or more of an AAVS 1-safe site, an eGSH-safe site, and an H11-safe site.

With respect to the first to fourth aspects of the present invention, further, the pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, or induced pluripotent stem cells;

the pluripotent stem cell derivative comprises an adult stem cell, each germ layer cell or a tissue or organ into which the pluripotent stem cell is differentiated;

the adult stem cells include mesenchymal stem cells or neural stem cells.

In a fifth aspect of the present invention, there is provided:

the application of the pluripotent stem cells or the derivatives thereof and the exosomes secreted by the pluripotent stem cells in preparing macular degeneration treatment preparations or medicines.

In a sixth aspect of the present invention, there is provided:

an exosome is secreted by the pluripotent stem cell or a derivative thereof.

The invention has the beneficial effects that:

1. the pluripotent stem cells or the derivatives thereof provided by the first aspect of the invention can be applied to autologous cell-induced iPSCs or MSCs low-immunogenicity cells. After an expression sequence of shRNA/shRNA-miR of a VEGF-A inhibiting factor targeting VEGF-A is introduced into an iPSCs genome induced by autologous cells, the iPSCs can express a large amount of shRNA/shRNA-miR of the VEGF-A and are wrapped by exosomes secreted by the cells. Exosomes carry these inhibitory factors to bind to target cells and then release them, thereby blocking the VEGF-a pathway, relieving immunosuppression, activating the immune system, and restoring T cell activity, enabling them to effectively eliminate tumor cells.

2. The pluripotent stem cells or derivatives thereof provided by the second aspect of the invention may also be used in allogeneic cell therapy. Because the B2M and CIITA genes in the pluripotent stem cells or the derivatives thereof are knocked out, the pluripotent stem cells or the derivatives thereof have low immunogenicity, and when the pluripotent stem cells or the derivatives thereof are transplanted into a recipient, RNA interference of the genes related to the immune response, which is mediated by transcription products of the small nucleic acid molecules and the second nucleic acid molecules, coded by the first nucleic acid molecules only acts on donor cells, and cannot interfere with the genome of the recipient cells. Improving the immune compatibility between the graft and the recipient. The transplant can continuously express shRNA/shRNA-miR of the targeted VEGF-A in a receptor endogenous source, after the inhibition factors are wrapped by the exosome, the exosome carries the inhibition factors to be combined with the target cell, and then the inhibition factors are released, so that a VEGF-A pathway is blocked, immunosuppression is relieved, the immune system is activated, and tumor cells can be effectively eliminated and macular degeneration can be effectively improved.

3. The pluripotent stem cells or derivatives thereof provided by the third aspect of the invention have immune compatibility, and can eliminate or reduce allogeneic immune rejection response. Furthermore, the RNA interference program of the pluripotent stem cell or the derivative thereof acts only on such an engineered pluripotent stem cell or the derivative thereof. Thus, when such cells or derivatives are transplanted into a recipient, RNA interference directed to a gene associated with an immune response mediated by the transcript of the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule acts only on the donor cell and does not interfere with the genome of the recipient cell. An inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and used for regulating the expression of the first nucleic acid molecule, so that the immune compatibility and reversibility of the pluripotent stem cell or the derivative thereof are realized.

4. The pluripotent stem cell or the derivative thereof provided by the fourth aspect of the invention has an immune-compatible molecule expression sequence introduced into its genome, so that the pluripotent stem cell or the derivative thereof has low immunogenicity, and when the pluripotent stem cell or the derivative thereof is transplanted into a recipient, RNA interference directed to an immune response-related gene mediated by a transcription product of a small nucleic acid molecule encoded by a first nucleic acid molecule and a second nucleic acid molecule only acts on a donor cell, and does not interfere with the genome of the recipient cell. Improving the immune compatibility between the graft and the recipient. The transplant can continuously express shRNA/shRNA-miR of the targeted VEGF-A in a receptor endogenous source, after the inhibition factors are wrapped by the exosome, the exosome carries the inhibition factors to be combined with the target cell, and then the inhibition factors are released, so that a VEGF-A pathway is blocked, immunosuppression is relieved, the immune system is activated, and tumor cells can be effectively eliminated and macular degeneration can be effectively improved.

Furthermore, the genome of the pluripotent stem cell or the derivative thereof provided by the fourth aspect of the invention is also introduced with an inducible gene expression system, the inducible gene expression system can regulate and control the expression of the immune compatible molecules, and the inducible gene expression system is regulated and controlled by an exogenous inducer, so that the on and off of the inducible gene expression system are controlled by adjusting the addition amount, the sustained action time and the type of the exogenous inducer, and the expression quantity of the expression sequence of the immune compatible molecules is further controlled, thereby realizing the reversible regulation and control of the immune compatibility of the pluripotent stem cell or the derivative thereof. When the inducible gene expression system is started, the transcription product of the small molecule nucleic acid which is normally expressed and a second nucleic acid molecule which is introduced into the 3' UTR region of the immune response related gene is specifically combined, so that an RNA interference program is started, mRNA of the immune response related gene is degraded or silenced, and the expression of the immune response related gene is blocked. Thus, when such cells or derivatives are transplanted into a recipient, the allogeneic immune rejection response may be eliminated or reduced, and the immune compatibility between the transplant and the recipient may be improved. When the graft suffers from pathological changes, the inducible gene expression system can be closed by adding an exogenous inducer, so that the expression of small nucleic acid molecules and the interference effect of the small nucleic acid molecules on mRNA of immune response related genes are stopped, the normal expression of the immune related genes is recovered, the antigen presenting capability of graft cells is further recovered, the receptor can remove the pathological graft, the clinical safety of the pluripotent stem cells or the derivatives thereof is improved, and the value of the pluripotent stem cells or the derivatives thereof in clinical application is greatly expanded.

5. The pluripotent stem cells or the derivatives thereof can gradually reduce the expression amount of small nucleic acid molecules in the pluripotent stem cells or the derivatives thereof by adjusting the addition amount and the sustained action time of the exogenous inducer, so that the donor cells can gradually express low-concentration immune-related genes to stimulate the donor, and the donor can gradually generate tolerance to transplanted cells or the derivatives thereof, and finally stable tolerance is achieved. In this case, even though mismatched HLA class I molecules are expressed on the surface of the graft cells, they are compatible with the recipient immune system.

Drawings

Figure 1 is a plasmid map of Cas9 (D10A).

FIG. 2 is a plasmid map of sgRNA Clone AAVS 1-1.

FIG. 3 is a plasmid map of sgRNA Clone AAVS 1-2.

FIG. 4 is a plasmid map of sgRNA clone B2M-1.

FIG. 5 is a plasmid map of sgRNA clone B2M-2.

FIG. 6 is a plasmid map of sgRNA clone B2M-3.

FIG. 7 is a plasmid map of sgRNA clone B2M-4.

FIG. 8 is a plasmid map of sgRNA clone CIITA-1.

FIG. 9 is a plasmid map of sgRNA clone CIITA-2.

FIG. 10 is a plasmid map of sgRNA clone CIITA-3.

FIG. 11 is a plasmid map of sgRNA clone CIITA-4.

FIG. 12 is a plasmid map of AAVS1 KI Vector (shRNA, constitutive).

FIG. 13 is a plasmid map of AAVS1 KI Vector (shRNA, inducible).

FIG. 14 is a plasmid map of AAVS1 KI Vector (shRNA-miR, constitutive).

FIG. 15 is a plasmid map of AAVS1 KI Vector (shRNA-miR, inducible).

FIG. 16 is a plasmid map of B2M KI Vector.

FIG. 17 is a plasmid map of CIITA KI Vector.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Experimental materials:

selection of VEGF-A Targeted inhibitors

VEGF-a targeted inhibitor: shRNA or shRNA-miR of target VEGF-A.

The target sequences of the shRNA or shRNA-miR sequences targeting VEGF-A used in the embodiment of the invention are shown in Table 1.

TABLE 1 target sequences for shRNA or shRNA-miR sequences targeting VEGF-A

2. Construction of Small nucleic acid molecules

The sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of a human, preferably derived from caenorhabditis elegans.

The sequence of the small nucleic acid molecule used in this example was

5’-TTGTACTACACAAAAGTACTG-3’(SEQ ID NO.101)；

Designing a first nucleic acid molecule and a second nucleic acid molecule according to the small nucleic acid molecules, wherein the first nucleic acid molecule and the second nucleic acid molecule are respectively as follows:

a first nucleic acid molecule (i.e., the shRNA expression framework or shRNA-miR expression framework of a small nucleic acid molecule):

(1) the sequence composition of the shRNA expression framework of the small nucleic acid molecule is as follows:

5’-CCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.3)N₁...N₂₁TTCAAGAGA(SEQ ID NO.4)N₂₂...N₄₂TTTTTT-3’。

wherein the content of the first and second substances,

a)N₁...N₂₁is the sequence of the small nucleic acid molecule, N₂₂...N₄₂The reverse complementary sequence of the small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;

c) constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d) n represents A or T or G or C base.

(2) shRNA-miR expression framework of small nucleic acid molecules: the small nucleic acid molecule sequence is used for replacing a target sequence in microRNA-30 or microRNA-155 to obtain the target sequence. The specific sequence is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.5)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.6)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT-3’(SEQ ID NO.7)。

wherein the content of the first and second substances,

a)N₁...N₂₁is a small nucleic acid molecule sequence, N₂₂...N₄₂Is a reverse complement of a small nucleic acid molecule sequence;

b) if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;

c) constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d) n represents A or T or G or C base, M base represents A or C base;

e) if N is present₁Is a G base, then M₁Is A base; otherwise M₁Is a C base;

f)M₁base and M₂And (3) base complementation.

A second nucleic acid molecule: comprises a reverse complementary sequence of at least 3 repeated small nucleic acid molecule sequences, preferably a reverse complementary sequence of 6-10 repeated small nucleic acid molecule sequences. The reverse complement of the small nucleic acid molecule sequence can be linked by a random Linker sequence.

As an embodiment of the invention, the second nucleic acid molecule is formed by connecting the random sequence of the first 10nt and the reverse complement of the sequence of 8 repeated small nucleic acid molecules through a random linker sequence (CGTA):

5’-atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTA-3’(SEQ ID NO.8)。

3. selection of immune compatible molecules

The types and sequences of the immune-compatible molecules used in the examples of the present invention are shown in tables 2 and 3.

TABLE 2 types and roles of immune-compatible molecules

TABLE 3 target sequences for immune-compatible molecules

shRNA or shRNA-miR immune compatible molecule sequences of each experimental group in the following tables 8-9 are shRNA or shRNA-miR immune compatible molecules constructed by adopting target sequences in the table 3. Those skilled in the art will understand that: the shRNA or shRNA-miR immune compatible molecule constructed by other target sequences can also realize the technical effect of the invention and all fall into the protection scope of the claims of the invention.

Selection of shRNA/miRNA processing Complex genes and anti-Interferon Effector molecules

(1) selection of shRNA/miRNA processing Complex genes

shRNA/miRNA processing complex genes used in the present invention include shRNA and/or miRNA processing machinery that can induce off-expression. The shRNA and/or miRNA processor capable of inducing closed expression specifically comprises: drosha (Access number: NM-001100412), Ago1(Access number: NM-012199), Ago2(Access number: NM-001164623), Dicer1(Access number: NM-001195573), export-5 (Access number: NM-020750), TRBP (Access number: NM-134323), PACT (Access number: NM-003690) and DGCR8(Access number: NM-022720).

(2) Selection of anti-Interferon Effector molecules

The anti-interferon effector molecules used in the invention comprise shRNA and/or shRNA-miR expression sequences which can induce closed expression and aim at inhibiting PKR, 2-5As, IRF-3 and IRF-7 genes so As to reduce the interferon reaction induced by dsRNA and avoid generating cytotoxicity.

Wherein the target sequences of the anti-interferon effector molecules are shown in Table 4.

TABLE 4 target sequences for anti-interferon effector molecules

The anti-interferon effector molecule sequences of the experimental groups in the following tables 8-9 are all shRNA or shRNA-miR constructed by adopting the target sequences in the table 4. Those skilled in the art will understand that: the technical effect of the invention can be realized by shRNA or shRNA-miR anti-interferon effector molecules constructed by other target sequences, and the shRNA or shRNA-miR anti-interferon effector molecules fall into the protection scope of the claims of the invention.

5. Selection of exosome processing synthetic genes

The exosome processing synthetic gene is selected from at least one of STEAP3(NM _182915), Syndecano-4 (NM _002999), L-aspartate oxidase fragment (SEQ ID NO.68), CD63-L7Ae (SEQ ID NO.69) and Cx 43S 368A. Wherein Cx 43S 368A is obtained by mutating S (serine) to A (alanine)) at position 368 of Cx43 (NM-000165).

6. Selection of Stem cell vectors

The stem cell carrier in the embodiment of the invention is a pluripotent stem cell, and the pluripotent stem cell can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs and EBs cells.

Wherein the preparation method of the pluripotent stem cells comprises the following steps:

ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.

And (3) iPSCs: using an episomal-iPSCs induction system (6F/BM1-4C), pE3.1-OG- -KS and pE3.1-L-Myc- -hmiR302 cluster were electrotransferred into somatic cells, RM1 medium was cultured for 2 days, 2 days with 2uM Parnate-containing BioCISO-BM1 medium, 2 days with 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD 03254901-containing BioCISO-BM1 medium, and then cultured continuously with BioCISO medium without other substances for about 17 days, iPSCs clonal cells were picked, and the picked iPSCs clonal cells were purified, digested, and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

hPSCs-MSCs: iPSCs were cultured for 25 days in BioCISO medium containing 10uM TGF beta inhibitor SB431542 until confluency of 80-90 cells was digested (2mg/mL Dispase), 1:3 passaged into Matrigel-coated plates, followed by ESC-MSC medium (knockkout DMEM medium containing 10% KSR, NEAA, diabody, glutamine, beta-mercaptoethanol, 10ng/mL bFGF and SB-431542), liquid was changed every day, and continuously cultured for 20 days until confluency of 80-90 cells was passaged (1:3 passages), and the specific construction method was as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.

NSCs: iPSCs are cultured for 14 days in an induction medium (knockout DMEM medium containing 10% KSR and TGF-beta inhibitor and BMP4 inhibitor), and rose annular nerve cells are picked and cultured in a low-adhesion culture plate. The medium in the low adhesion plates included DMEM/F12 (containing 1% N2, Invitrogen) and Neurobasal medium (containing 2% B27, Invitrogen) in a ratio of 1:1, along with 20ng/ml bFGF and 20ng/ml EGF. Digestion passages were performed using Accutase. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.

EBs cells: the iPSCs with cell confluency of 95% were digested with BioC-PDE1 for 6min, and the cells were scraped into clumps by mechanical scraping, and the clumps were settled. The settled cell pellet was transferred to a low adhesion culture plate and cultured for 7 days using BioCISO-EB1, with fluid changes every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and subjected to adherent culture using a BioCISO medium for 7 days, thereby obtaining Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

The pluripotent stem cell derivative also includes adult stem cells, each germ layer cell or tissue, organ into which the pluripotent stem cells are differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

Constructing a plasmid vector:

plasmid vectors used in the examples of the present invention include: cas9(D10A) plasmid, sgRNA plasmid, Donor fragment.

The CRISPR-Cas9 gene editing system is adopted for gene editing in the plasmids, the used Cas9 protein is Cas9(D10A), Cas9(D10A) is combined with sgRNAs which are responsible for specifically recognizing a target sequence (genome DNA of a cell vector), and then the Cas9(D10A) performs single-strand cutting on the target sequence. Double Strand breaks in genomic DNA (DSB) must occur, and two Cas 9(D10A)/sgRNA groups must cleave both strands of genomic DNA of the cell vector separately, and not too far apart. The Cas 9(D10A)/sgRNA protocol has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA protocol.

Wherein, the specific sequence of the sgRNA is as follows:

sgRNA-AAVS1-1：5’-TATAAGGTGGTCCCAGCTCG-3’(SEQ ID NO.70)；

sgRNA-AAVS1-2：5’-AGGGCCGGTTAATGTGGCTC-3’(SEQ ID NO.71)；

sgRNA-B2M-1：5’-CTCCTGTTATATTCTAGAAC-3’(SEQ ID NO.72)；

sgRNA-B2M-2：5’-TTTCAGCATCAATGTACCCT-3’(SEQ ID NO.73)；

sgRNA-B2M-3：5’-CGCGAGCACAGCTAAGGCCA-3’(SEQ ID NO.74)；

sgRNA-B2M-4：5’–ACTCTCTCTTTCTGGCCTGG-3’(SEQ ID NO.75)；

sgRNA-CIITA-1：5’-GGCACTCAGAAGACACTGAT-3’(SEQ ID NO.76)；

sgRNA-CIITA-2：5’–AAGGTGTCTGGTCGGAGAGC-3’(SEQ ID NO.77)；

sgRNA-CIITA-3：5’–ACCCAGCAGGGCGTGGAGCC-3’(SEQ ID NO.78)；

sgRNA-CIITA-4：5’–GTCAGAGCCCCAAGGTAAAA-3’(SEQ ID NO.79)。

the specific method for constructing the plasmid vector comprises the following steps:

(1) cas9(D10A) plasmid: obtained directly from an Addgene (plasma 41816, Addgene) subscription.

(2) sgRNA plasmid: the Plasmid was constructed by putting different target sequences into original blank plasmids (Plasmid 41824, Addgene).

Wherein the target sequence put into the sgRNA plasmid comprises the sequence of the immune compatible molecule, the sequence of shRNA/miRNA processing complex gene, the sequence of anti-interferon effector molecule and the sequence of exosome processing synthetic gene.

(3) Donor fragment (KI plasmid):

a) designing a PCR primer, and amplifying by using a pUC18 plasmid (Takara, Code No.3218) as a template and a high fidelity enzyme (Nanjing Nozan organism, P505-d1) through a PCR method to obtain an Amp (R) -pUC origin fragment;

b) extracting genome DNA of human cells and designing corresponding primers, and then amplifying by using high-fidelity enzyme through a PCR method by taking the genome DNA of human as a template to obtain a recombinant arm;

c) designing PCR amplification primers of KI (Knock-in) plasmid elements, and then carrying out high-fidelity enzyme amplification by using plasmids containing the KI plasmid elements as templates to obtain KI plasmid elements (subclones);

d) and (3) connecting the amplified Amp (R) -pUC origin fragment, the recombination arm and the KI plasmid element by using multi-fragment recombinase (Nanjing Nonakai biology, C113-02) or overlap PCR to form a complete circular plasmid.

Wherein the recombination arms comprise a B2M recombination arm, a CIITA recombination arm and an AAVS1 recombination arm.

The sequence of the B2M recombinant arm is shown as B2M-HR-L (SEQ ID NO.80) and B2M-HR-R (SEQ ID NO. 81).

The sequence of the CIITA recombination arm is shown as CIITA-HR-L (SEQ ID NO.82) and CIITA-HR-R (SEQ ID NO. 83).

The sequence of the AAVS1 recombination arm is shown as AAVS1-HR-L (SEQ ID NO.84) and AAVS1-HR-R (SEQ ID NO. 85).

The plasmids prepared by the embodiment of the invention can be divided into constitutive plasmids and inducible plasmids according to the expression frame type in the plasmids.

The expression frame in the constitutive plasmid comprises shRNA constitutive expression frame and shRNAMIR constitutive expression frame. The expression function of the Donor fragment obtained by enzyme digestion of the constitutive plasmid cannot be regulated after knocking in the stem cell vector genome DNA.

The expression frames in the inducible plasmid comprise shRNA inducible expression frames and shRNAMIR inducible expression frames. After the Donor fragment obtained from the inducible plasmid is digested by enzyme and the stem cell vector genome DNA is knocked in, the expression function of the fragment can be regulated and controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.

The specific sequence requirements and structural composition of the expression frameworks described above are as follows.

(1) The sequence composition of the shRNA constitutive expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACgctagcgccacc(SEQ ID NO.86)N₁...N₂₁TTCAAGAGAN₂₂...N₄₂TTTTTT-3’；

wherein the content of the first and second substances,

a)N₁...N₂₁shRNA target sequence which is the above-mentioned target sequence, N₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence of the target sequence;

b) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame respectively and then is connected seamlessly;

c) when the shRNA constitutive expression frame needs to carry different resistance genes, only the resistance gene sequences in the shRNA constitutive expression frame are different, and other sequences are the same;

d) n represents A or T or G or C base.

(2) The sequence composition of the shRNAmiR constitutive expression framework is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCGM₁N₁...N₂₁TAGTGAAGCCACAGATGTAN₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT-3’；

wherein the content of the first and second substances,

g)N₁...N₂₁shRNAMIR target sequence, N, being the above target sequence₂₂...N₄₂The reverse complement of the shrnmanir target sequence of the above target sequence;

h) when a plasmid constructed by using the shRNAMIR constitutive expression framework needs to express shRNAMIR of a plurality of genes, each gene corresponds to one shRNAMIR expression framework respectively and then is connected seamlessly;

i) when the shRNAMIR constitutive expression framework needs to carry different resistance genes, only the resistance gene sequences in the shRNAMIR constitutive expression framework are different, and other sequences are the same;

j) n represents A or T or G or C base, M base represents A or C base;

k) if N is present₁Is a G base, then M₁Is A base; otherwise M₁Is a C base;

l)M₁base and M₂And (3) base complementation.

(3) The sequence composition of the shRNA inducible expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagctcggtacccgggtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctgctagcgccacc(SEQ ID NO.87)N₁...N₂₁TTCAAGAGAN₂₂...N₄₂TTTTTT-3’；

wherein the content of the first and second substances,

e)N₁...N₂₁the shRNA target sequence corresponding to the target sequence, N₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence and/or the small nucleic acid molecule corresponding to the target sequence;

f) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame respectively and then is connected seamlessly;

g) when the shRNA constitutive expression frame needs to carry different resistance genes, only the resistance gene sequences in the shRNA constitutive expression frame are different, and other sequences are the same;

h) n represents A or T or G or C base.

(4) The sequence composition of the shRNAmiR inducible expression framework is shown in the sequence composition of the shRNAmiR constitutive expression framework.

The plasmid map of Cas9(D10A) constructed by the method is shown in figure 1, the plasmid map of sgRNA of AAVS1 safety site is shown in figure 2-3, the plasmid map of sgRNA of B2M gene is shown in figure 4-7, the plasmid map of sgRNA of CIITA gene is shown in figure 8-11, the plasmid map (constitutive and inducible) of constructed AAVS1 KI is shown in figure 12-15, the plasmid map of B2M KI is shown in figure 16, and the plasmid map of CIITA KI is shown in figure 17.

Constructing a stem cell vector:

in the technical scheme of the invention, the safety sites knocked in the genome of the stem cell vector comprise an AAVS1 safety site, an eGSH safety site and an H11 safety site.

The single-cell cloning operation of the knock-in of the AAVS1 gene comprises the following steps:

a) electric transfer program:

preparation of donor cells: human pluripotent stem cells;

the kit comprises: human Stem Cell

Kit 1；

The instrument comprises the following steps: an electrotransfer instrument;

culture medium: BioCISO;

induction of plasmid: the corresponding plasmids constructed in the above examples.

b) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.

c) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.

d) The obtained single-cell clone was cultured.

Wherein, the culture reagent of the single cell clone strain comprises:

the culture medium is as follows: BioCISO medium, 300. mu.g/ml G418 and 0.5. mu.g/ml puro. The culture medium needs to be placed at room temperature in advance, placed for 30-60 minutes in a dark condition until the room temperature is recovered, but not placed at 37 ℃ for preheating, so that the activity of the biological molecules is prevented from being reduced.

Matrix glue: hESC grade Matrigel. Before passage or cell recovery, adding the Matrigel working solution into a cell culture bottle dish and shaking up to ensure that the Matrigel completely submerges the bottom of the culture bottle dish and any Matrigel cannot be dried off before use. To ensure that cells adhere better and survive, Matrigel was placed in a 37 ℃ incubator for a period of time: 1:100 Xmatrigel can not be less than 0.5 hour; the 1:200 Xmatrigel cannot be less than 2 hours.

Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH 7.4. The EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure.

Freezing and storing liquid: 60% BioCISO, 30% ESCS grade FBS, and 10% DMSO.

The culture step of the single-cell clone adopts the conventional subculture maintaining process in the field.

Wherein, the optimal passage time is that the overall confluency of the cells reaches 80-90%.

The optimal ratio of passage is 1: 4-1: 7, and the optimal confluency of the next day after passage is maintained at 20-30%.

The specific passage operation steps in the invention are as follows:

a) discarding the Matrigel from the coated cell culture flask, adding appropriate amount of the above culture medium, and adding 5% CO at 37 deg.C₂Incubation in an incubator;

b) when the cells meet the passage requirement, removing culture medium supernatant, and adding a proper amount of 0.5mM EDTA digestive juice into a cell bottle dish;

c) the cells were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float), blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;

d) centrifuging, discarding supernatant, suspending the cells with culture medium, repeatedly blowing the cells until uniformly mixing, transferring the cells to a petrigel-coated bottle dish, shaking, observing under a mirror without abnormality, shaking, and standing at 37 deg.C and 5% CO₂Culturing in an incubator;

e) observing the adherent survival state of the cells the next day, sucking off the culture medium, and changing the culture medium on time every day.

The gene knock-in detection method comprises the following steps:

1. single cell clone AAVS1 gene knock-in assay.

(1) AAVS1 gene knock-in assays.

The detection principle is as follows:

the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.

The detection method comprises the following steps:

one primer was designed inside (non-recombinant arm portion) the Donor plasmid (KI plasmid), and then the other primer was designed in the genome of the cell (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the band of interest will appear, otherwise no band of interest will appear.

The specific sequences of the primers and amplification conditions are shown in the following table.

TABLE 5 detailed sequences and amplification conditions of the AAVS1 Gene knock-in detection primers

(2) B2M and CIITA gene knock-in test.

The detection method of the knock-in of the second nucleic acid molecule at the 3' UTR of B2M and CIITA gene was the same as the detection principle of AAVS1, and the PCR detection conditions used were as shown in tables 6 and 7.

TABLE 6 detailed sequences of knock-in detection primers for the B2M Gene and amplification conditions

TABLE 7 specific sequences of CIITA Gene knock-in detection primers and amplification conditions

Selected plasmids were knocked into the stem cell vector genome using techniques conventional in the art:

according to the grouping in the following tables 8 and 9, a VEGF-A targeted inhibitory factor sequence, an immune compatible molecule sequence, a shRNA/miRNA processing complex gene sequence, an anti-interferon effector molecule sequence and an exosome processing synthetic gene are knocked into the safe locus of the stem cell vector by adopting the conventional technology in the field, so that different types of constitutive stem cell expression vectors and inducible stem cell expression vectors are obtained to detect the expression feasibility of the constitutive stem cell expression vectors and the inducible stem cell expression vectors.

TABLE 8 constitutive knock-in expression experiment grouping

Wherein a "+" symbol indicates a knock-in of a gene or nucleic acid sequence and a "-" symbol indicates a knock-out of a gene.

General principle: shRNA (or shRNA-miR) of the targeted inhibition factor is put into a shRNA (or shRNA-miR) expression frame 2 of the corresponding plasmid, shRNA (or shRNA-miR) of the other inhibition factors are put into a shRNA (or shRNA-miR) expression frame 1 of the corresponding plasmid, and the gene sequence is put into an MCS.

B2M-3 ' UTR-miRNA-focus or CIITA-3 ' UTR-miRNA-focus, i.e. the second nucleic acid molecule (SEQ ID No.8), knocks into the 3 ' UTR region of the B2M and CIITA genes, respectively.

The B2M/CIITA-3 'UTR-shRNA is an shRNA expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, specifically targets a transcription product of a second nucleic acid molecule in a B2M gene and a CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

B2M/CIITA-3 'UTR-shRNA-miR is an shRNA-miR expression framework of a small nucleic acid molecule, namely a first nucleic acid molecule, a transcription product of a second nucleic acid molecule in a targeting B2M gene and CIITA gene 3' UTR region, and a knock-in site is a genome safety site AAVS 1.

CD47 represents the CD47 expression sequence with the knock-in site being the genomic safety site AAVS 1.

If multiple fragments are to be inserted into the expression cassette or MCS, they can be ligated together using EMCV IRESWT (SEQ ID NO.100) and then inserted.

The sgRNA plasmid for gene knock-in was: sgRNA clone B2M-1, sgRNA clone B2M-2, sgRNA clone CIITA-1 and sgRNA clone CIITA-2.

sgRNA plasmids used for gene knockout were: sgRNA clone B2M-3, sgRNA clone B2M-4, sgRNA clone CIITA-3 and sgRNA clone CIITA-4.

(1) Aa1 grouping:

shRNA expression frame 2 of AAVS1 KI Vector (shRNA, constitutive) plasmid was put into the VEGF-A targeting shRNA sequence.

(2) Aa2 grouping:

shRNA expression frame 2 of AAVS1 KI Vector (shRNA, constitutive) plasmid is provided with shRNA sequence targeting VEGF-A, shRNA expression frame 1 is provided with the rest shRNA sequence (including target sequence of B2M/CIITA-3' UTR-shRNA), and MCS is provided with gene sequence.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(3) Aa3 grouping:

and (3) placing an shRNA sequence targeting VEGF-A into an shRNA expression frame 2 of an AAVS1 KI Vector (shRNA, constitutive) plasmid, placing the rest shRNA target sequences into an shRNA expression frame 1, knocking out B2M and CIITA, and placing MCS into a gene sequence.

(4) Aa4 grouping:

shRNA expression frame 2 of AAVS1 KI Vector (shRNA, constitutive) plasmid is placed into shRNA sequence of target VEGF-A, shRNA expression frame 1 is placed into other shRNA target sequence, and MCS is placed into gene sequence.

(5) Ab1 groups:

shRNA-miR expression frame 2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid is provided with a shRNA-miR sequence targeting VEGF-A.

(6) Ab2 groups:

shRNA-miR expression frame 2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid is placed into a shRNA-miR sequence targeting VEGF-A, shRNA-miR expression frame 1 is placed into the rest shRNA-miR target sequence (including target sequences of B2M/CIITA-3' UTR-shRNA-miR), and MCS is placed into a gene sequence.

B2M KI Vector was placed in B2M-3' UTR-miRNA-focus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(7) Ab3 groups:

shRNA-miR sequence of targeting VEGF-A is placed in shRNA-miR expression frame 2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid, the rest shRNA-miR target sequence is placed in shRNA-miR expression frame 1, B2M and CIITA are knocked out, and MCS is placed in gene sequence.

(8) Ab4 groups:

shRNA-miR expression frame 2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid is placed into a shRNA-miR sequence targeting VEGF-A, shRNA-miR expression frame 1 is placed into the rest shRNA-miR target sequences, and MCS is placed into a gene sequence.

TABLE 9 inducible knock-in expression assay grouping

The general principle is shown above in the constitutive knock-in expression experimental group.

(1) B1 grouping:

shRNA expression frame 2 of AAVS1 KI Vector (shRNA, inducible) plasmid is placed into a shRNA sequence targeting VEGF-A, shRNA expression frame 1 is placed into the rest shRNA target sequence (including the target sequence of B2M/CIITA-3' UTR-shRNA), and MCS is placed into a gene sequence. Adding a Tet-Off system induction system.

B2M KI Vector was placed in B2M-3' UTR-miRNA-locus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(2) B2 grouping:

shRNA-miR expression frame 2 of AAVS1 KI Vector (shRNA-miR, inducible) plasmid is placed into a shRNA-miR sequence targeting VEGF-A, shRNA-miR expression frame 1 is placed into the rest shRNA-miR target sequence (including target sequences of B2M/CIITA-3' UTR-shRNA-miR), and MCS is placed into a gene sequence. Adding a Tet-Off system induction system.

B2M KI Vector was placed in B2M-3' UTR-miRNA-locus.

CIITA KI Vector was placed into CIITA-3' UTR-miRNA-focus.

(3) B3 grouping:

(4) B4 grouping:

Wherein, when the constitutive knock-in and the inducible knock-in are used for immune compatible reconstruction, the constitutive knock-in and the inducible knock-in can be firstly reconstructed on hPSCs and then differentiated into derivatives of pluripotent stem cells for application after the reconstruction is finished; the immune compatibility can also be modified after differentiation of hPSCs into derivatives of pluripotent stem cells.

The Tet-Off system in the invention specifically comprises the following steps:

in the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of the gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

The sequence of the Tet-Off system and one or more immune compatible molecules is knocked into a genome safety site of the pluripotent stem cell, and the expression of the immune compatible molecules is accurately turned on or Off through the addition of tetracycline, so that the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof can be reversibly regulated and controlled.

Detecting the inhibition effect of the pluripotent stem cells or the derivatives thereof expressing the VEGF-A targeted inhibitor on VEGF-A:

the experimental group protocols in tables 8 and 9 were knocked into the genome safety sites of iPSCs, MSCs, NSCs, and EBs cells at 37 ℃ with 0.5% CO₂Culturing in an incubator, collecting culture medium supernatant, and extracting exosomes in the culture supernatant by using an exosome extraction kit (BestBio, lot # BB-3901) for cells containing a knock-in exosome processing synthetic gene sequence. Centrifuging culture supernatant at 37 deg.C for 15min at 3000g, collecting supernatant, centrifuging at 37 deg.C for 20min at 10000g, collecting supernatant, adding extractive solution A at a ratio of 4:1, reversing the upper and lower parts for 1min, and standing at 37 deg.C overnight. Centrifuging at 4 deg.C for 60min at 10000g, and collecting precipitate.

And testing the blocking effect of the VEGF-A inhibitory factor expressed by the pluripotent stem cells by using a flow cytometry method. The exosomes containing the VEGF-A inhibitor were added to the culture medium of CHO cells, and the CHO cells expressing VEGF-A were cultured for 72 hours. After digesting into single cells and washing the cells 2 times with PBS, FITC-labeled VEGF-A antibody fusion protein was added to the tube and incubated at 37 ℃ for 30 minutes. Flow cytometric analysis was performed using a flow cytometer. According to the Mean Fluorescence Intensity (MFI) of the staining, the effect of the VEGF-A inhibitor expressed by the pluripotent stem cells on inhibiting the expression of VEGF-A by CHO cells can be measured.

The N (control) group refers to VEGF-A expressing CHO cells cultured without the addition of VEGF-A inhibitor or VEGF-A inhibitor-containing exosomes.

The results of the tests of the respective experimental groups are shown in Table 10.

TABLE 10 flow cytometric assay of VEGF-A expression results in VEGF-A expressing cells

Independent samples were tested for T (./p < 0.01).

As can be seen from the above table, the exosome-encapsulated VEGF-A inhibitor expressed by the pluripotent stem cells or derivatives thereof of the invention can effectively inhibit the expression of VEGF-A of target cells. And the inhibition degree is relatively constant in each group, so the VEGF-A inhibitor expressed by the pluripotent stem cell derivative is not influenced by cell differentiation morphology and other exogenous genes (immune compatibility modification).

Detecting the anti-tumor cell migration effect of the pluripotent stem cells or the derivatives thereof expressing the VEGF-A targeted inhibitory factor:

extracting exosome containing VEGF-A targeted inhibitory factor from culture supernatant of the pluripotent stem cells or the derivatives thereof expressing the VEGF-A targeted inhibitory factor, adding the exosome into a serum-free basic culture medium to perform starvation culture on the tumor cell hepG2 for 12 hours, digesting the tumor cell hepG2, performing resuspension counting on the exosome containing VEGF-A targeted inhibitory factor in the serum-free basic culture medium, and adjusting the cell number to 1X10⁶cells/mL. mu.L of the cells were seeded in the upper chamber of a 24-well 8.0 μm Transwell chamber, 500. mu.L of 15% FBS-containing basal medium was added to the lower chamber, and the mixture was incubated at 37 ℃ and 5% CO₂Culturing for 24h under the condition. The control group was cultured using a culture supernatant of pluripotent stem cells or derivatives thereof that do not express VEGF-A antibody, and the rest of the procedure was the same as the experimental group. The cells on the upper layer of the filters in the test and control groups were removed with a cotton swab, fixed in methanol for 5min, and stained with Giemsa dye for 15 min. The number of the transmembrane cells in 5 different visual fields, i.e., the upper, lower, left, and right fields, was counted under a 10-fold objective lens, and the average value was calculated.

The results of the measurements of each group are shown in Table 11.

TABLE 11 Effect of VEGF-A-targeted inhibitors expressed in groups on tumor cell migration

Independent samples were tested for T (/ p < 0.01).

Through the experiment, the VEGF-A inhibitor which is expressed by the pluripotent stem cell or the derivative thereof and is wrapped by an exosome can effectively block the migration of tumor cells.

The application of the pluripotent stem cells expressing VEGF-A targeted inhibitory factor in the treatment of various tumors:

immune compatible cells (MSCs) from both B2M and CIITA gene knockout regimens (Aa3) were selected for testing.

In the humanized NSG mouse tumor model, each group of experimental cells was injected and the effect on the treatment of RCC kidney cancer, MC colon cancer, and NIC lung cancer was observed. To avoid the problem of immune compatibility, the immune cells used are derived from the same person as the derivative of hPSCs.

The method comprises the following specific steps:

in humanized NSG mice (The Jackson Laboratory (JAX)), The right axilla was injected subcutaneously with 5X 10⁶Tumor (RCC renal carcinoma, MC colon carcinoma, NIC lung carcinoma) cells until the tumor grows to 60mm³In size, tail vein injection of 200uL PBS (containing human immune cells and 1X 10)⁶A pluripotent stem cell derivative expressing VEGF-a inhibitor encapsulated by exosome) is subjected to tumor treatment, in which only a group containing human immune cells is injected as a control group. Mice were sacrificed after 20 days and tumor sizes were compared between groups and statistical analysis of differences was performed.

The results are shown in Table 12.

TABLE 12 antitumor Effect of pluripotent Stem cells or derivatives thereof on various tumors in each test group

Independent samples were tested for T (/ p < 0.01).

Through the experiments, the stem cells expressing the VEGF-A inhibitory factor or the derivatives thereof prepared by the invention can be proved to be capable of effectively blocking VEGF-A to play an anti-tumor role.

Immune compatibility testing of pluripotent stem cells expressing targeted VEGF-a inhibitors in tumor models:

by utilizing the characteristic of low immunogenicity of the MSCs, hPSCs (human platelet-derived proteins) capable of expressing VEGF-A inhibitory factors (shRNA targeting VEGF-A) are injected into a humanized NSG mouse tumor model to achieve immune compatibility with the MSCs, and the effect of treating tumors (NIC lung cancer) is observed. Wherein the immunocyte and the MSCs derived from hPSCs are derived from non-identical persons.

The control group is an NSG mouse tumor model without MSCs cell injection;

the Dox group is: the mice were continuously fed with 0.5mg/mL of Dox in the mouse diet starting from the injection of the inhibitor-expressing cells until the end of the experiment.

The results are shown in Table 13.

TABLE 13 reversible expression test results for immune-compatible molecule inducible expression panels

Independent samples were tested for T (/ p < 0.01).

The above experiment shows that: MSCs that express only suppressive factors (group 2), which have low immunogenicity and can exist in foreign body for a certain time, can exert a certain tumor therapeutic effect, while those that are immunologically compatibly engineered (groups 3-7, including constitutive and reversible inducible immunocompatibilities), which have better immuno-compatibility effects, are present in vivo for a longer time (or can achieve long-term co-existence) than MSCs that are not immunologically compatibly engineered, which exert better tumor therapeutic effects, whereas group 4, which is a B2M and CIITA gene knock-out group, completely eliminates the influence of HLA-I and HLA-II molecules, and thus, has the best tumor therapeutic effects. However, there are groups 6-9 protocol settings because of their constitutive immune compatible modifications (knock-in/knock-out) and their inability to clear when a graft becomes mutated or otherwise undesirable. In groups 8-9, the mice injected with the suppressor cells were shown to have abolished the immune compatibility effect by administering Dox inducer (always administered) to the mice at the same time as the injection of the suppressor cells into the mice, which was found in vivo for a time period comparable to that of the MSCs without immune compatibility modification, and the tumor therapy effect was comparable to that of the MSCs without immune compatibility modification.

The therapeutic effect of pluripotent stem cells expressing targeted VEGF-a inhibitors on macular degeneration was tested:

immune compatible cells from both the B2M and CIITA gene knockout schedule group (Aa3) were selected for testing.

Constructing a macular degeneration mouse model:

in humanized NSG mice (The Jackson Laboratory (JAX)), human immune cells from The same donor are injected to reconstitute The immune system of The mice. After 2 weeks, macular degeneration mice were established by laser retinal injury to Choroidal Neovascularization (CNV).

The specific construction method comprises the following steps: the mouse model was anesthetized by intraperitoneal injection using 0.3% sodium pentobarbital, 45mg per kg injection, and mydriasis was instilled with 0.5% tolbicamide and 0.5% phenylephrine hydrochloride. Under a slit lamp, a 532nm time Nd: YAG laser (the spot diameter is 75lrm, the exposure time is 100ms, the energy is 180mW) is used for a front lens, the distance from the optic disc is about 1-1.5PD, the retina is shot around the optic papilla, each eye shoots 8-10 points, and the retinal blood vessels are prevented from being shot directly. Subsequently, 200uL of PBS (containing 10) was used⁶The pluripotent stem cell derivative expressing a VEGF-A inhibitory factor, the pluripotent stem cell derivative being derived from the same donor as the human immune cell) by tail vein injectionAnd inducing macular degeneration disease.

The detection method comprises the following steps: adopting fundus angiography (FFA), diluting 20% fluorescein sodium with water for injection into 2% fluorescein sodium, injecting into abdominal cavity with injection amount of 0.3mL, and recording angiography process with Heidelberg Fundus Fluoroangiography (FFA) instrument. The treatment effect was judged by the CNV formation rate.

In the present embodiment, the VEGF-A inhibitor-expressing pluripotent stem cell derivatives are hPSCs and hPSCs-derived derivatives (hPSCs-MSCs, hPSCs-NSCs, hPSCs-EBs) expressing shRNA targeting VEGF-A.

The rate of CNV formation was judged from the FFA fluorescence leakage intensity integral.

The formula is as follows:

the judgment of the leakage intensity of the fluorescein refers to a Takehana grading standard, namely:

level 0: no fluorescence leakage;

stage 1: slight fluorescence leakage;

and 2, stage: moderate fluorescence leakage;

and 3, level: strong fluorescence leakage.

Integral calculation of fluorescence leakage intensity:

the total integral of each laser spot is set to be 3 minutes, and 0 grade is calculated to be 0 minute; 1, 1 grade and 1 point; 2, 2 points are counted by a grade 2;

grade

3, 3 points.

The results are shown in Table 14.

TABLE 14 therapeutic effect of macular degeneration of pluripotent stem cells expressing VEGF-A inhibitory factor and derivatives thereof

Independent samples were tested for T (./p < 0.01).

The result shows that the stem cell or the derivative thereof expressing the VEGF-A inhibitory factor prepared by the invention can effectively block VEGF-A and has the effect of treating macular degeneration diseases.

Immune compatibility testing of pluripotent stem cells expressing targeted VEGF-a inhibitors in a macular degeneration model:

by utilizing the characteristic of low immunogenicity of the MSCs, the hPSCs source immune compatible MSCs capable of expressing VEGF-A inhibitory factors (shRNA targeting VEGF-A) are injected into a humanized NSG mouse macular degeneration model, and the effect of macular degeneration treatment is observed. Wherein the immunocyte and the MSCs derived from hPSCs are derived from non-identical persons.

The control group is an NSG mouse macular degeneration model without MSCs cell injection;

the Dox addition group is: the mice were continuously fed with 0.5mg/mL of Dox in the mouse diet starting from the injection of the inhibitor-expressing cells until the end of the experiment.

The results are shown in Table 15.

TABLE 15 reversible expression test results for immune-compatible molecule-inducible expression sets

Independent samples were tested for T (/ p < 0.01).

The above experiments show that: MSCs expressing only inhibitory factors (group 2), which have low immunogenicity and can exist in xenobiotics for a certain period of time, can exert a certain macular degeneration treatment effect, while those that have been immunocompatibly modified (groups 3-7, which include constitutive and reversible inducible immunocompatibilities), which have better immunocompatibility effects than MSCs that have not been immunocompatibly modified, exist in vivo for a longer time (or can coexist for a long period of time), which exert macular degeneration treatment effects better, whereas group 4, which is the B2M and CIITA gene knockout group, completely eliminates the effects of HLA-I and HLA-II class molecules, and thus, have the best macular degeneration treatment effects. However, there are groups 6-9 protocol settings because of their constitutive immune compatible modifications (knock-in/knock-out) and their inability to clear when a graft becomes mutated or otherwise undesirable. In groups 8-9, the mice injected with the suppressor cells were immune-compatible with the Dox inducer (used all the time) at the same time as the injection of the suppressor cells into the mice, and the mice were found to have an immune-compatible effect comparable to that of the MSCs without immune-compatibility improvement and a macular degeneration treatment effect comparable to that of the MSCs without immune-compatibility improvement.

The present invention is not limited to the above-described embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents and equivalents thereof, which are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> future Chile regenerative medicine institute (Guangzhou) Co., Ltd

Wang Linli

<120> pluripotent stem cell expressing VEGF-A targeted inhibitory factor, and derivative and application thereof

<130>

<160> 102

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> human

<400> 1

gagtacatct tcaagccatc c 21

<210> 2

<211> 21

<212> DNA

<213> human

<400> 2

gcagattatg cggatcaaac c 21

<210> 3

<211> 315

<212> DNA

<213> Artificial sequence

<400> 3

ccactcccta tcagtgatag agaaaagtga aagtcgagtt taccactccc tatcagtgat 60

agagaaaagt gaaagtcgag tttaccactc cctatcagtg atagagaaaa gtgaaagtcg 120

agtttaccac tccctatcag tgatagagaa aagtgaaagt cgagctcggt acccgggtcg 180

aggtaggcgt gtacggtggg aggcctatat aagcagagct cgtttagtga accgtcagat 240

cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag 300

cctgctagcg ccacc 315

<210> 4

<211> 9

<212> DNA

<213> Artificial sequence

<400> 4

ttcaagaga 9

<210> 5

<211> 119

<212> DNA

<213> Artificial sequence

<400> 5

gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60

cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

tagtgaagcc acagatgta 19

<210> 7

<211> 119

<212> DNA

<213> Artificial sequence

<400> 7

tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60

tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119

<210> 8

<211> 210

<212> DNA

<213> Artificial sequence

<400> 8

attctagata cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta 60

cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt 120

gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt gtgtagtaca 180

acgtacagta cttttgtgta gtacaacgta 210

<210> 9

<211> 21

<212> DNA

<213> human

<400> 9

gggagcagag aattctctta t 21

<210> 10

<211> 21

<212> DNA

<213> human

<400> 10

ggagcagaga attctcttat c 21

<210> 11

<211> 21

<212> DNA

<213> human

<400> 11

gagcagagaa ttctcttatc c 21

<210> 12

<211> 21

<212> DNA

<213> human

<400> 12

gctacctgga gcttcttaac a 21

<210> 13

<211> 21

<212> DNA

<213> human

<400> 13

ggagcttctt aacagcgatg c 21

<210> 14

<211> 21

<212> DNA

<213> human

<400> 14

gggtctccag tatattcatc t 21

<210> 15

<211> 21

<212> DNA

<213> human

<400> 15

gctcccactc catgaggtat t 21

<210> 16

<211> 21

<212> DNA

<213> human

<400> 16

ggtatttctt cacatccgtg t 21

<210> 17

<211> 21

<212> DNA

<213> human

<400> 17

aggagacacg gaatgtgaag g 21

<210> 18

<211> 21

<212> DNA

<213> human

<400> 18

gctcccactc catgaggtat t 21

<210> 19

<211> 21

<212> DNA

<213> human

<400> 19

ggtatttcta cacctccgtg t 21

<210> 20

<211> 21

<212> DNA

<213> human

<400> 20

ggaccggaac acacagatct a 21

<210> 21

<211> 21

<212> DNA

<213> human

<400> 21

ttcttacttc cctaatgaag t 21

<210> 22

<211> 21

<212> DNA

<213> human

<400> 22

aagttaagaa cctgaatata a 21

<210> 23

<211> 21

<212> DNA

<213> human

<400> 23

aacctgaata taaatttgtg t 21

<210> 24

<211> 21

<212> DNA

<213> human

<400> 24

gggtctggtg ggcatcatta t 21

<210> 25

<211> 21

<212> DNA

<213> human

<400> 25

ggtctggtgg gcatcattat t 21

<210> 26

<211> 21

<212> DNA

<213> human

<400> 26

gcatcattat tgggaccatc t 21

<210> 27

<211> 21

<212> DNA

<213> human

<400> 27

gatgaccaca ttcaaggaag a 21

<210> 28

<211> 21

<212> DNA

<213> human

<400> 28

gaccacattc aaggaagaac t 21

<210> 29

<211> 21

<212> DNA

<213> human

<400> 29

gctttcctgc ttggcagtta t 21

<210> 30

<211> 21

<212> DNA

<213> human

<400> 30

gcgtaagtct gagtgtcatt t 21

<210> 31

<211> 21

<212> DNA

<213> human

<400> 31

gacaatttaa ggaagaatct t 21

<210> 32

<211> 21

<212> DNA

<213> human

<400> 32

ggccatagtt ctccctgatt g 21

<210> 33

<211> 21

<212> DNA

<213> human

<400> 33

gccatagttc tccctgattg a 21

<210> 34

<211> 21

<212> DNA

<213> human

<400> 34

gcagatgacc acattcaagg a 21

<210> 35

<211> 21

<212> DNA

<213> human

<400> 35

gcagcaggat aagtatgagt g 21

<210> 36

<211> 21

<212> DNA

<213> human

<400> 36

gcaggataag tatgagtgtc a 21

<210> 37

<211> 21

<212> DNA

<213> human

<400> 37

ggttcctgca cagagacatc t 21

<210> 38

<211> 21

<212> DNA

<213> human

<400> 38

ggatgtggaa cccacagata c 21

<210> 39

<211> 21

<212> DNA

<213> human

<400> 39

gatgtggaac ccacagatac a 21

<210> 40

<211> 21

<212> DNA

<213> human

<400> 40

gtggaaccca cagatacaga g 21

<210> 41

<211> 21

<212> DNA

<213> human

<400> 41

gggtagcaac tgtcaccttg a 21

<210> 42

<211> 21

<212> DNA

<213> human

<400> 42

ggatttcgtg ttccagttta a 21

<210> 43

<211> 21

<212> DNA

<213> human

<400> 43

gcatgtgcta cttcaccaac g 21

<210> 44

<211> 21

<212> DNA

<213> human

<400> 44

gctcacagtc atcaattata g 21

<210> 45

<211> 21

<212> DNA

<213> human

<400> 45

gccctgaaga cagaatgttc c 21

<210> 46

<211> 21

<212> DNA

<213> human

<400> 46

gcggaccatg tgtcaactta t 21

<210> 47

<211> 21

<212> DNA

<213> human

<400> 47

gcctgatagg acccatattc c 21

<210> 48

<211> 21

<212> DNA

<213> human

<400> 48

gcatccaata gacgtcattt g 21

<210> 49

<211> 21

<212> DNA

<213> human

<400> 49

gcgtcactgg cacagatata a 21

<210> 50

<211> 21

<212> DNA

<213> human

<400> 50

ggatggattt gattatgatc c 21

<210> 51

<211> 21

<212> DNA

<213> human

<400> 51

ggaccttgga acaatggatt g 21

<210> 52

<211> 21

<212> DNA

<213> human

<400> 52

gctaattctt gctgaacttc t 21

<210> 53

<211> 21

<212> DNA

<213> human

<400> 53

gcagttctgt tgccactctc t 21

<210> 54

<211> 21

<212> DNA

<213> human

<400> 54

gggagagttc atccaggaaa t 21

<210> 55

<211> 21

<212> DNA

<213> human

<400> 55

ggagagttca tccaggaaat t 21

<210> 56

<211> 21

<212> DNA

<213> human

<400> 56

gggttggttt atccaggaat a 21

<210> 57

<211> 21

<212> DNA

<213> human

<400> 57

ggatcagaag agaagccaac g 21

<210> 58

<211> 21

<212> DNA

<213> human

<400> 58

ggttcaccat ccaggtgttc a 21

<210> 59

<211> 21

<212> DNA

<213> human

<400> 59

ggaggaactt tgtgaacatt c 21

<210> 60

<211> 21

<212> DNA

<213> human

<400> 60

gctgtaagaa ggatgctttc a 21

<210> 61

<211> 21

<212> DNA

<213> human

<400> 61

gctgcaggca ggattgtttc a 21

<210> 62

<211> 19

<212> DNA

<213> human

<400> 62

gcctcgagtt tgagagcta 19

<210> 63

<211> 19

<212> DNA

<213> human

<400> 63

agacattctg gatgagtta 19

<210> 64

<211> 19

<212> DNA

<213> human

<400> 64

gggtctgtta cccaaagaa 19

<210> 65

<211> 21

<212> DNA

<213> human

<400> 65

ggacactggt tcaacacctg t 21

<210> 66

<211> 21

<212> DNA

<213> human

<400> 66

ggttcaacac ctgtgacttc a 21

<210> 67

<211> 21

<212> DNA

<213> human

<400> 67

acctgtgact tcatgtgtgc g 21

<210> 68

<211> 1607

<212> DNA

<213> human

<400> 68

atgaatactc tccctgaaca ttcatgtgac gtgttgatta tcggtagcgg cgcagccgga 60

ctttcactgg cgctacgcct ggctgaccag catcaggtca tcgttctaag taaggccggt 120

aacgaggttc aacattttat gcccagggcg gtattgccgc cgtgtttgat aaactgacag 180

cattgactcg catgtggaag acacattgat tgccggggct ggtatttgcg atcgccatgc 240

agttgaattt gtcgccagca atgcacgatc ctgtgtgcaa tggctaatcg accagggggt 300

gttgtttgat acccacattc aaccgaatgg cgaagaaagt taccatctga cccgtgaagg 360

tggacatagt caccgtcgta ttcttcatgc cgccgacgcc accggtagag aagtagaaac 420

cacgctggtg agcaaggcgc tgaaccatcc gaatattcgc gtgctggagc gcagcaacgc 480

ggttgatctg attgtttctg acaaaattgg cctgccgggc acgcgacggg ttgttggcgc 540

gtgggtatgg aaccgtaata aagaaacggt ggaaacctgc cacgcaaaag cggtggtgct 600

ggcaaccggc ggtgcgtcga aggtttatca gtacaccacc aatccggata tttcttctgg 660

cgatggcatt gctatggcgt ggcgcgcagg ctgccggttg ccaatctcga tttaatcagt 720

tccaccctac cgcgctatat cacccacagg cacgcaattt cctgttaaca gaagcactgc 780

gcggcgaggc gcttatctca agcgcccgga tggtacgcgt ttatccgatt ttgatgagcg 840

cggcgaactg ccccgcgcga tattgtcgcc cgcgccattg accatgaaat gaaacgcctc 900

ggcgcagatt gtatgttcct tgatatcagc cataagcccg ccgattttat tcgccagcat 960

ttcccgatga tttatgaaaa gctgctcggg ctgggattga tctcacacaa gaaccggtac 1020

cgattgtgcc tgctgcacat tatacctgcg gtggtgtaat ggttgatgat catgggcgta 1080

cggacgtcga gggcttgtat gccattggcg aggtgagtta taccggctta cacggcgcta 1140

accgcatggc ctcgaattca ttgctggagt gtctggtcta tggctggtcg gcggcggaag 1200

atatcaccag acgtatgcct tatgcccacg acatcagtac gttaccgccg tgggatgaaa 1260

gccgcgttga gaaccctgac gaacggtagt aattcagcat aactggcacg agctacgtct 1320

gtttatgtgg gattacgttg gcattgtgcg cacaacgaag cgcctggaac gcgccctgcg 1380

gcggataacc atgctccaac aagaaataga cgaatattac gcccatttcc gcgtctcaaa 1440

taatttgctg gagctgcgta atctggtaca ggttgccgag ttgattgttc gctgtgcaat 1500

gatgcgtaaa gagagtcggg gttgcatttc acgctggatt atccggaact gctcacccat 1560

tccggtccgt cgatccttcc cccggcaatc attacataaa cagataa 1607

<210> 69

<211> 411

<212> DNA

<213> human

<400> 69

ggaagtggtg ccggcaccgg cggcatgtac gtgcgcttcg aggtgcccga ggacatgcag 60

aacgaggccc tgagcctgct ggaaaaagtg cgcgagagcg gcaaagtgaa gaagggcacc 120

aacgaaacca ccaaggccgt ggaacggggc ctggccaagc tggtgtatat cgccgaggac 180

gtggaccccc ccgagattgt ggcccatctg cccctgctgt gcgaagagaa gaacgtgccc 240

tacatctacg tgaagtccaa gaacgacctg ggcagagccg tgggcatcga ggtgccatgt 300

gcctctgccg ccatcatcaa cgagggcgag ctgcggaaag aactgggcag cctggtggaa 360

aagatcaagg gcctgcagaa gggttccggt ggatccggtt ccggacgggc t 411

<210> 70

<211> 20

<212> DNA

<213> Artificial sequence

<400> 70

tataaggtgg tcccagctcg 20

<210> 71

<211> 20

<212> DNA

<213> Artificial sequence

<400> 71

agggccggtt aatgtggctc 20

<210> 72

<211> 20

<212> DNA

<213> Artificial sequence

<400> 72

ctcctgttat attctagaac 20

<210> 73

<211> 20

<212> DNA

<213> Artificial sequence

<400> 73

tttcagcatc aatgtaccct 20

<210> 74

<211> 20

<212> DNA

<213> Artificial sequence

<400> 74

cgcgagcaca gctaaggcca 20

<210> 75

<211> 20

<212> DNA

<213> Artificial sequence

<400> 75

actctctctt tctggcctgg 20

<210> 76

<211> 20

<212> DNA

<213> Artificial sequence

<400> 76

ggcactcaga agacactgat 20

<210> 77

<211> 20

<212> DNA

<213> Artificial sequence

<400> 77

aaggtgtctg gtcggagagc 20

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence

<400> 78

acccagcagg gcgtggagcc 20

<210> 79

<211> 20

<212> DNA

<213> Artificial sequence

<400> 79

gtcagagccc caaggtaaaa 20

<210> 80

<211> 900

<212> DNA

<213> Artificial sequence

<400> 80

cctggacttc tccagtactt tctggctgga ttggtatctg aggctagtag gaagggcttg 60

ttcctgctgg gtagctctaa acaatgtatt catgggtagg aacagcagcc tattctgcca 120

gccttatttc taaccatttt agacatttgt tagtacatgg tattttaaaa gtaaaactta 180

atgtcttcct tttttttctc cactgtcttt ttcatagatc gagacatgta agcagcatca 240

tggaggtaag tttttgacct tgagaaaatg tttttgtttc actgtcctga ggactattta 300

tagacagctc taacatgata accctcacta tgtggagaac attgacagag taacatttta 360

gcagggaaag aagaatccta cagggtcatg ttcccttctc ctgtggagtg gcatgaagaa 420

ggtgtatggc cccaggtatg gccatattac tgaccctcta cagagagggc aaaggaactg 480

ccagtatggt attgcaggat aaaggcaggt ggttacccac attacctgca aggctttgat 540

ctttcttctg ccatttccac attggacatc tctgctgagg agagaaaatg aaccactctt 600

ttcctttgta taatgttgtt ttattcttca gacagaagag aggagttata cagctctgca 660

gacatcccat tcctgtatgg ggactgtgtt tgcctcttag aggttcccag gccactagag 720

gagataaagg gaaacagatt gttataactt gatataatga tactataata gatgtaacta 780

caaggagctc cagaagcaag agagagggag gaacttggac ttctctgcat ctttagttgg 840

agtccaaagg cttttcaatg aaattctact gcccagggta cattgatgct gaaaccccat 900

<210> 81

<211> 900

<212> DNA

<213> Artificial sequence

<400> 81

tcaaatctcc tgttatattc tagaacaggg aattgatttg ggagagcatc aggaaggtgg 60

atgatctgcc cagtcacact gttagtaaat tgtagagcca ggacctgaac tctaatatag 120

tcatgtgtta cttaatgacg gggacatgtt ctgagaaatg cttacacaaa cctaggtgtt 180

gtagcctact acacgcatag gctacatggt atagcctatt gctcctagac tacaaacctg 240

tacagcctgt tactgtactg aatactgtgg gcagttgtaa cacaatggta agtatttgtg 300

tatctaaaca tagaagttgc agtaaaaata tgctatttta atcttatgag accactgtca 360

tatatacagt ccatcattga ccaaaacatc atatcagcat tttttcttct aagattttgg 420

gagcaccaaa gggatacact aacaggatat actctttata atgggtttgg agaactgtct 480

gcagctactt cttttaaaaa ggtgatctac acagtagaaa ttagacaagt ttggtaatga 540

gatctgcaat ccaaataaaa taaattcatt gctaaccttt ttcttttctt ttcaggtttg 600

aagatgccgc atttggattg gatgaattcc aaattctgct tgcttgcttt ttaatattga 660

tatgcttata cacttacact ttatgcacaa aatgtagggt tataataatg ttaacatgga 720

catgatcttc tttataattc tactttgagt gctgtctcca tgtttgatgt atctgagcag 780

gttgctccac aggtagctct aggagggctg gcaacttaga ggtggggagc agagaattct 840

cttatccaac atcaacatct tggtcagatt tgaactcttc aatctcttgc actcaaagct 900

<210> 82

<211> 900

<212> DNA

<213> Artificial sequence

<400> 82

cttgacaagt ctcctgctcc tcactatgaa gatcactgtc ccccagccct gtgctccccg 60

cactgtgctg cacgtccacc tccattccac tgcccctccc atccccccat cttgatagca 120

cccttcccag gtgtcaagct gcccctccta gagtgtcctg cctaaacccc ctctcctggc 180

tcctcccgct acagcatgtt ctctgaggac actaaccacg ctggaccttg aactgggtac 240

ttgtggacac agctcttctc caggctgtat cccatgagcc tcagcatcct ggcacccggc 300

ccctgctggt tcagggttgg cccctgcccg gctgcggaat gaaccacatc ttgctctgct 360

gacagacaca ggcccggctc caggctcctt tagcgcccag ttgggtggat gcctggtggc 420

agctgcggtc cacccaggag ccccgaggcc ttctctgaag gacattgcgg acagccacgg 480

ccaggccaga gggagtgaca gaggcagccc cattctgcct gcccaggccc ctgccaccct 540

ggggagaaag tacttctttt tttttatttt tagacagagt ctcactgttg cccaggctgg 600

cgtgcagtgg tgcgatctgg gttcactgca acctccgcct cttgggttca agcgattctt 660

ctgcttcagc ctcccgagta gctgggacta caggcaccca ccatcatgtc tggctaattt 720

ttcattttta gtagagacag ggttttgcca tgttggccag gctggtctca aactcttgac 780

ctcaggtgat ccacccacct cagcctccca aagtgctggg attacaagcg tgagccactg 840

caccgggcca cagagaaagt acttctccac cctgctctcc gaccagacac cttgacaggg 900

<210> 83

<211> 900

<212> DNA

<213> Artificial sequence

<400> 83

cacaccgggc actcagaaga cactgatggg caacccccag cctgctaatt ccccagattg 60

caacaggctg ggcttcagtg gcagctgctt ttgtctatgg gactcaatgc actgacattg 120

ttggccaaag ccaaagctag gcctggccag atgcaccagc ccttagcagg gaaacagcta 180

atgggacact aatggggcgg tgagagggga acagactgga agcacagctt catttcctgt 240

gtcttttttc actacattat aaatgtctct ttaatgtcac aggcaggtcc agggtttgag 300

ttcataccct gttaccattt tggggtaccc actgctctgg ttatctaata tgtaacaagc 360

caccccaaat catagtggct taaaacaaca ctcacattta ttctgctcac atatctgtca 420

tttgagcagg gctcagcggg gacagctcct tctgtcctac tctgtgtcag gtggggcagc 480

ttgagggttg ggctggtgtc acctgaagac tcattcttct gtacgtctga caggcaatgc 540

tggctgttgg ctgggggcct cagtgccact acggaatagt tggctaggac ccctccatgt 600

gggctagttg ggcttcctca tagtatggtg gctgggttgg agggtgtccc aaaaagaaag 660

gaggggatag agagagacca cttttcataa cctagcctta gaagtcacac agtattactt 720

ctgctacata tatatgtttt aagaggcagg gtctcactct gtcgcccagt ctggaatgca 780

gtggtatgat cacggctcac tgcagcctca acctcctggg ctaagtgatc ctcccacctc 840

agcctcccga atagctggga ctacaggtgt gagtcaccaa gcccagttaa tctttagttt 900

<210> 84

<211> 804

<212> DNA

<213> Artificial sequence

<400> 84

tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360

tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

gtcccctcca ccccacagtg gggc 804

<210> 85

<211> 837

<212> DNA

<213> Artificial sequence

<400> 85

actagggaca ggattggtga cagaaaagcc ccatccttag gcctcctcct tcctagtctc 60

ctgatattgg gtctaacccc cacctcctgt taggcagatt ccttatctgg tgacacaccc 120

ccatttcctg gagccatctc tctccttgcc agaacctcta aggtttgctt acgatggagc 180

cagagaggat cctgggaggg agagcttggc agggggtggg agggaagggg gggatgcgtg 240

acctgcccgg ttctcagtgg ccaccctgcg ctaccctctc ccagaacctg agctgctctg 300

acgcggccgt ctggtgcgtt tcactgatcc tggtgctgca gcttccttac acttcccaag 360

aggagaagca gtttggaaaa acaaaatcag aataagttgg tcctgagttc taactttggc 420

tcttcacctt tctagtcccc aatttatatt gttcctccgt gcgtcagttt tacctgtgag 480

ataaggccag tagccagccc cgtcctggca gggctgtggt gaggaggggg gtgtccgtgt 540

ggaaaactcc ctttgtgaga atggtgcgtc ctaggtgttc accaggtcgt ggccgcctct 600

actccctttc tctttctcca tccttctttc cttaaagagt ccccagtgct atctgggaca 660

tattcctccg cccagagcag ggtcccgctt ccctaaggcc ctgctctggg cttctgggtt 720

tgagtccttg gcaagcccag gagaggcgct caggcttccc tgtccccctt cctcgtccac 780

catctcatgc ccctggctct cctgcccctt ccctacaggg gttcctggct ctgctct 837

<210> 86

<211> 253

<212> DNA

<213> Artificial sequence

<400> 86

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgctagcgcc acc 253

<210> 87

<211> 686

<212> DNA

<213> Artificial sequence

<400> 87

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660

gaccgatcca gcctgctagc gccacc 686

<210> 88

<211> 22

<212> DNA

<213> Artificial sequence

<400> 88

ccatagctca gtctggtcta tc 22

<210> 89

<211> 22

<212> DNA

<213> Artificial sequence

<400> 89

ctcttcgtcc agatcatcct ga 22

<210> 90

<211> 22

<212> DNA

<213> Artificial sequence

<400> 90

ccatagctca gtctggtcta tc 22

<210> 91

<211> 20

<212> DNA

<213> Artificial sequence

<400> 91

cacaccttgc cgatgtcgag 20

<210> 92

<211> 24

<212> DNA

<213> Artificial sequence

<400> 92

gcactgaacg aacatctcaa gaag 24

<210> 93

<211> 22

<212> DNA

<213> Artificial sequence

<400> 93

ctcttcgtcc agatcatcct ga 22

<210> 94

<211> 24

<212> DNA

<213> Artificial sequence

<400> 94

gcactgaacg aacatctcaa gaag 24

<210> 95

<211> 20

<212> DNA

<213> Artificial sequence

<400> 95

cacaccttgc cgatgtcgag 20

<210> 96

<211> 22

<212> DNA

<213> Artificial sequence

<400> 96

tgctccgggt ttgtctcaga tg 22

<210> 97

<211> 22

<212> DNA

<213> Artificial sequence

<400> 97

ctcttcgtcc agatcatcct ga 22

<210> 98

<211> 22

<212> DNA

<213> Artificial sequence

<400> 98

tgctccgggt ttgtctcaga tg 22

<210> 99

<211> 20

<212> DNA

<213> Artificial sequence

<400> 99

cacaccttgc cgatgtcgag 20

<210> 100

<211> 590

<212> DNA

<213> Artificial sequence

<400> 100

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590

<210> 101

<211> 21

<212> DNA

<213> Caenorhabditis elegans

<400> 101

ttgtactaca caaaagtact g 21

<210> 102

<211> 24

<212> DNA

<213> Caenorhabditis elegans

<400> 102

tcacaacctc ctagaaagag taga 24

Claims

1. A pluripotent stem cell or a derivative thereof, comprising a VEGF-A targeted inhibitor, wherein the VEGF-A targeted inhibitor comprises at least one of shRNA and shRNA-miR expressing VEGF-A; the sequences of the shRNA and shRNA-miR expressing VEGF-A are preferably inserted into the genome of the pluripotent stem cell or the derivative thereof.

2. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the sequences of the shRNA and shRNA-miR targeting VEGF-A are shown in SEQ ID No. 1-SEQ ID No. 2.

3. The pluripotent stem cell or derivative thereof according to claim 1, wherein the B2M gene and/or the CIITA gene of the genome of the pluripotent stem cell or derivative thereof is knocked out.

4. The pluripotent stem cell or the derivative thereof according to claim 1, wherein: the genome of the pluripotent stem cell or the derivative thereof is also introduced with a first nucleic acid molecule;

and, a second nucleic acid molecule is further introduced into the 3' UTR region of the immune response-associated gene in the pluripotent stem cell or a derivative thereof;

the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, which small nucleic acid molecule specifically targets the transcript of the second nucleic acid molecule, and which small nucleic acid molecule does not target any other mRNA or incrna of the pluripotent stem cell or a derivative thereof.

5. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the small nucleic acid molecule comprises at least one of a short interfering nucleic acid, a short interfering RNA, a double-stranded RNA, preferably miRNA, shRNA-miR.

6. The pluripotent stem cells or the derivatives thereof according to claim 5, wherein the pluripotent stem cells or the derivatives thereof are derived from a human; the sequence of the small nucleic acid molecule is a random sequence of a non-human species that does not target any mRNA or incrna of a human.

7. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the second nucleic acid molecule comprises the reverse complement of at least 3 repeats of the sequence of the small nucleic acid molecule, preferably 6 to 10 repeats of the sequence of the small nucleic acid molecule.

8. The pluripotent stem cells or the derivatives thereof according to claim 1, wherein the genome of the pluripotent stem cells or the derivatives thereof further comprises an expression sequence of at least one immune-compatible molecule for regulating the expression of genes associated with an immune response in the pluripotent stem cells or the derivatives thereof.

9. The pluripotent stem cell or the derivative thereof according to claim 4 or 8, wherein the genes associated with the immune response comprise:

10. The pluripotent stem cell or derivative thereof of claim 8, wherein the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(4) shRNA and/or shRNA-miR targeting a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.

11. The pluripotent stem cell or derivative thereof of claim 10, wherein:

the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 9-SEQ ID NO. 11;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB3 is selected from one of SEQ ID NO. 30-SEQ ID NO. 31;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPA1 is selected from one of SEQ ID NO. 44-SEQ ID NO. 46; the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPB1 is selected from one of SEQ ID NO. 47-SEQ ID NO. 49.

12. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 11, wherein a shRNA and/or miRNA processing complex-associated gene and/or an anti-interferon effector molecule is further introduced into the genome of the pluripotent stem cell or the derivative thereof, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of target PKR, 2-5As, IRF-3 and IRF-7.

13. The pluripotent stem cell or the derivative thereof according to claim 12, wherein the target sequence of the shRNA and/or shRNA-miR targeting the PKR is selected from one of SEQ ID No.50 to SEQ ID No. 52;

14. The pluripotent stem cells or derivatives thereof of claim 2, 11 or 13, wherein the expression frameworks of the VEGF-a targeting shRNA and/or shRNA-miR, major histocompatibility complex gene, major histocompatibility complex-related gene, anti-interferon effector molecule are as follows:

the shRNA expression framework is as follows: the gene sequence sequentially comprises an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3';

wherein the shRNA target sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA target sequence form a hairpin structure; poly T is a transcription terminator of RNA polymerase III;

shRNA-miR expression framework: and replacing the shRNA target sequence in the shRNA expression frame by using the shRNA-miR target sequence.

15. The pluripotent stem cell or the derivative thereof according to claim 4, 8 or 12, wherein an inducible gene expression system is further introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating the expression of the first nucleic acid molecule and/or the immune-compatible molecule and/or the shRNA and/or the miRNA processing complex-associated gene and/or the anti-interferon effector molecule.

16. The pluripotent stem cells or derivatives thereof according to claim 15, wherein the inducible gene expression system comprises at least one of a Tet-Off system, a dimer inducible expression system.

17. The pluripotent stem cell or derivative thereof according to any one of claims 1 to 16, wherein the genome of the pluripotent stem cell or derivative thereof further comprises an exosome-processing synthetic gene comprising at least one of STEAP3, Syndevan-4, an L-aspartate oxidase fragment, CD63-L7Ae and Cx 43S 368A.

18. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 17, wherein the VEGF-a inhibitory factor expression sequence, the first nucleic acid molecule, the immune-compatible molecule expression sequence, the shRNA and/or miRNA processing complex-associated gene, the anti-interferon effector molecule, the inducible gene expression system, the exosome processing synthetic gene are introduced by viral vector interference, non-viral vector transfection or gene editing, preferably by knock-in.

19. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 17, wherein the VEGF-a inhibitory factor expression sequence, the immune-compatible molecule expression sequence, the shRNA and/or miRNA processing complex-associated gene, the anti-interferon effector molecule, the inducible gene expression system, the exosome processing synthetic gene are introduced at a genome-safe site, preferably at one or more of an AAVS 1-safe site, an eGSH-safe site, and an H11-safe site.

20. The pluripotent stem cell or derivative thereof of any one of claims 1 to 19, wherein:

the pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic cancer cells, or induced pluripotent stem cells;

the pluripotent stem cell derivative comprises adult stem cells differentiated by the pluripotent stem cells, cells of each germ layer or tissues and organs;

the adult stem cells include mesenchymal stem cells or neural stem cells.

21. Use of the pluripotent stem cells or derivatives thereof and exosomes secreted therefrom of claim 20 for the preparation of a macular degeneration therapeutic agent or medicament.

22. An exosome secreted from the pluripotent stem cell or derivative thereof of any one of claims 1 to 20.