CN114703212B - Method for modifying laccase by using specific segment random mutation method and laccase strain LAC123 - Google Patents

Abstract

The invention discloses a method for modifying laccase by using a specific segment random mutation method and a laccase strain lac123. According to the invention, through analysis, an important functional section, which is close to laccase active sites, of a second structural domain and a third structural domain of LAC1 is selected as a target sequence, when DNA of the sequence is chemically synthesized, a degenerate primer method is adopted to introduce random mutation at specific base sites, the synthesized random fragment is replaced by a homologous recombination method, the same fragment of wild enzyme is replaced, a random mutation library containing DNA sequences of specific sites of the specific sections is constructed, library capacity is detected through second generation sequencing, and batch screening of laccase activity is carried out on E.coli clones in the random mutation library, 5 laccase with improved enzyme activity is obtained through initial screening, and a mutant laccase strain LAC123 with 2.3 times of improved enzyme activity is obtained through shake flask rescreening, and the expressed protein sequence is shown as SEQ ID NO. 3.

Description

Method for modifying laccase by using specific segment random mutation method and laccase strain LAC123

Technical Field

The invention relates to a method for modifying laccase by using a specific segment random mutation method and a laccase strain LAC123, belonging to the technical fields of molecular biology and enzyme engineering.

Background

Laccase (EC 1.10.3.2) is a biocatalyst capable of reducing oxygen into water without producing harmful byproducts, has very wide action substrates, is considered as an enzyme of environment-friendly, is greatly concerned in the fields of environment, industry and biotechnology at present, but the existing laccase has the defects of low enzyme activity, poor thermal stability and the like, and has special reaction systems such as high temperature, strong acid, strong base, high salt, toxic medium and the like in industrial production, the traditional wild laccase is extremely easy to inactivate, and the production requirements cannot be met. Molecular transformation is used as an important means for improving the enzyme yield and the enzyme properties, and is widely applied increasingly, so that great economic benefit and profound scientific significance are brought.

Enzyme molecular engineering is a technology for obtaining a novel enzyme which is hoped by people and not found in nature by directionally engineering enzyme molecules aiming at the defects of the enzyme in the nature. Along with the deep understanding of enzymes, through analyzing the information such as enzyme gene sequences, spatial structures, catalytic modes and the like, the ideas and means for modifying enzyme molecules are more and more combined with advanced molecular biology means. The current methods applicable to modification of enzyme molecules are mainly divided into two methods, namely a chemical modification method and a biological enzyme engineering method. The chemical modification of the enzyme changes the catalytic property of the enzyme by attaching or removing some chemical groups on the side chain groups of the enzyme, and the method is simpler, but is easy to change the physicochemical property. The ideal mode is to adjust the amino acid of the key part of the enzyme molecule so as to generate a satisfactory effect, and along with the development of genetic engineering technology and proteomics, people can analyze the amino acid sequence and the protein structure of the enzyme, manually simulate the enzyme by using a bioinformatics method, and design and reform the enzyme based on the existing laccase sequence so as to have expected excellent performance, thereby achieving the aim of better and wider utilization.

The current methods for introducing mutation into protein genes include site-directed mutagenesis, error-prone PCR, DNA rearrangement, N-terminal fusion signal peptide and the like, and although specific operation methods are different, the design concept is to construct a mutation library based on the DNA sequence of the existing enzyme, and then select mutants with specific properties by using a proper batch screening method, so as to finally obtain the enzyme with more excellent properties in certain aspects.

Searching domestic and foreign documents and patents, no related report of a technology for constructing a mutation library by connecting random mutation sequences through homologous recombination is found at present.

Disclosure of Invention

The technical problems to be solved by the invention are as follows: how to obtain laccase with higher enzyme activity by a specific segment random mutation method.

In order to solve the technical problems, the invention provides a method for modifying laccase by using a specific segment random mutation method, which comprises the following steps:

step 1: extracting a DNA sequence of a white rot fungus laccase LAC1 gene, comparing the DNA sequence with laccase domains and active center sequences in a database, and selecting important functional sections, close to laccase active sites, of a second domain and a third domain of LAC1 as target sequences;

step 2: when the target sequence is chemically synthesized, introducing random mutation into a specific plurality of base sites by adopting a degenerate primer method to obtain a random mutation sequence;

step 3: synthesizing a DNA fragment of a random mutation sequence, obtaining a pET-32a (+) -LAC1 vector with a target sequence removed from a LAC1 gene sequence in an inverse PCR mode, connecting the DNA fragment of the random mutation sequence with the vector pET-32a (+) -LAC1 through a homologous recombination reaction, and transferring the DNA fragment into escherichia coli DH5 alpha to obtain a LAC1 mutation library;

step 4: combining bacterial colonies in the mutant library to extract plasmids, using the plasmids for second-generation sequencing library construction and transferring the plasmids into E.coli BL21 (DE 3) cells for activity screening, and screening by a 96-well plate high-throughput fungus shaking method to obtain laccase strains with improved enzyme activity.

Preferably, the random mutation sequence in step 2 comprises a sequence as set forth in SEQ ID NO:1 and SEQ ID NO:2, a sequence shown in seq id no; the SEQ ID NO:1 and SEQ ID NO:2, wherein N is A, T, C or G.

Preferably, in the step 3, the sequence shown in SEQ ID NO:1 comprises the following forward sequence and reverse sequence:

forward sequence: CACTCCTTCCTCTACGACTT;

reverse sequence: CGCAGGCCGTCACAGTACTGGG.

Preferably, in the step 3, the sequence shown in SEQ ID NO:2 comprises the following forward sequence and reverse sequence:

forward sequence: TTCGCCATCGTCTTCGCCGA;

reverse sequence: GCAGCTTGTCGTAGATGGGA.

Preferably, the substrate for the homologous recombination reaction in step 3 comprises:

140ng of carrier;

20ng of DNA fragment of random mutation sequence;

2×ClonExpress Mix 5μL；

ddH ₂ o was filled to 10. Mu.L;

the homologous recombination reaction is carried out by the following steps: the reaction was carried out at 50℃for 15min.

The invention also provides a laccase strain LAC123 with improved enzyme activity, which is obtained by the method for reforming laccase by using the random mutation method of the specific section, wherein the laccase strain LAC123 contains an expression protein with an amino acid sequence shown as SEQ ID NO. 3.

Compared with the prior art, the invention has the beneficial effects that:

1. the method for modifying laccase by using specific segment random mutation method has convenient operation, strong mutation purpose, 1 mutation site or n mutation sites, random base doping, random mutation library capacity up to 4n in principle, recombination of A and T, G, C to form codon diversity, strong pertinence and high beneficial mutation rate, can be successfully applied to various performance screening, such as improving protease activity, enhancing protein stability, changing protein to substrate specificity selection, protein enantioselectivity, enhancing protein solubility and protein affinity, and the like, and has wide application;

2. the method provided by the invention screens and obtains a strain with 2.3 times of enzyme activity improved than that of wild laccase, and has a good application prospect in industry.

Drawings

FIG. 1 is a schematic diagram of the construction of a random mutant sequence recombinant vector pET-32a (+) -LAC 1;

FIG. 2 is a schematic representation of a homologous recombination linked random mutant sequence;

FIG. 3 is a schematic representation of the visual analysis of random mutant sequence 1 by IGV;

FIG. 4 is a schematic representation of IGV visual analysis of random mutant sequence 2;

FIG. 5 is a diagram showing an alignment of the LAC123 and LAC1 modified laccase strains;

FIG. 6 is a three-dimensional structural model of an engineered laccase LAC123.

Detailed Description

In order to make the invention more comprehensible, preferred embodiments accompanied with figures are described in detail below.

The invention compares the DNA sequence (SEQ ID NO: 4) of white rot fungus laccase LAC1 gene with laccase structural domain and active center sequence in database, selects important functional sections near laccase active site of LAC1 second structural domain and third structural domain as target sequence, adopts degenerate primer method to introduce random mutation at specific several base sites when synthesizing the sequence DNA, replaces the same segment of wild enzyme by homologous recombination method, constructs random mutation library containing specific section specific site DNA sequence, detects library capacity by second generation sequencing, performs batch screening of laccase activity on E.coli clone in random mutation library, screens to obtain 5 strains with obviously improved enzyme activity, and performs shake flask re-screening to obtain mutant laccase with 2.3 times of enzyme activity improvement.

The invention designs a DNA segment containing upstream and downstream sequences aiming at a DNA segment needing to introduce random mutation at a plurality of bases, wherein the length is about 50 bases, when the DNA segment is chemically synthesized, the random bases are introduced at the target sites through a degenerate primer synthesis method, the upstream and downstream primers containing homologous arms are designed, the DNA segment is subjected to PCR amplification, a pET-32a (+) -LAC1 vector with the segment removed from the LAC1 gene sequence is obtained through an inverse PCR method, the random mutation sequence is constructed into the vector through a homologous recombination method by the mutation segment and the vector segment, and is transferred into E.coli DH5 alpha to obtain a LAC1 mutation library, colonies in the mutation library are combined to extract plasmids for secondary sequencing and library construction and transfer into E.coli BL21 (DE 3) cells for activity screening.

According to the invention, with reference to 96-well plate high-throughput shaking bacteria of Ouyang Fengju et al, BL21 (DE 3) transformation plate clones are respectively inoculated into 96-well plates into which 150 mu L of LB medium containing Amp has been previously added into each well, and placed in a constant temperature incubator at 37 ℃ overnight. The rear holes are sucked 20Mu L of bacterial liquid cultured overnight is transferred into another pore plate containing 130 mu L of liquid culture medium for culturing for 2-3 hours until OD600 reaches about 0.6-0.8, 2 mu L of 100 mu M IPTG is added into each pore, induced expression is carried out at 16 ℃, and the bacterial liquid is collected by centrifugation of 96 pore plates every other day, and the culture medium is poured out. And adding lysozyme into each hole to lyse cells, repeatedly blowing by using a gun head to form uniform suspension, centrifuging and collecting supernatant. Another 96-well plate was prepared, 50. Mu. LpH 4.0.0 disodium hydrogen phosphate-citric acid buffer was added to each well, incubated in a microplate reader at 37℃for 3min, 50. Mu.L of supernatant was added to each well by a row gun, and the reaction was measured at OD ₄₂₀ The enzyme activity of each clone was measured at the change in absorbance within 1 min.

In the examples below, all chemical reagents are commercially available and used without further purification, except as specifically indicated. The SanPrep column type plasmid DNA small extraction kit, the SanPrep column type DNA gel recovery kit and the SanPrep column type PCR product recovery kit are all purchased from Shanghai biological engineering, 2X Specific Taq Master Mix is purchased from offshore protein, P520 high-fidelity enzyme and C115 homologous recombination kit is purchased from Norvezan, and 2,2' -azino-bis (3-ethylbenzothiazole-6-sulfonic Acid) (ABTS) is purchased from Biyunnanensis.

Example 1

More than 30 laccase genes from different sources are downloaded on NCBI, laccase LAC1 gene sequences are compared with laccase genes from different sources by utilizing analysis software ClustalX, structural domains and active centers of the sequences are analyzed, sections affecting enzyme activity and substrate specificity are found out, random bases are respectively added to specific positions of key areas of a second structural domain and a third structural domain when DNA fragments are chemically synthesized, and the synthesis of two random mutant sequences is entrusted to a biological organism. The random mutation sequence is shown in Table 1, and the laccase LAC1 gene sequence is shown in SEQ ID NO. 4.

TABLE 1 random mutant sequences

The underlined in table 1 indicates the random mutation incorporation sites.

Example 2

Primers were designed for random mutant sequences, reverse PCR primers were designed for the vector, PCR procedures for pET-32a (+) -LAC linearized expression vector were as shown in Table 2, related primers were as shown in Table 3, and PCR procedures for random mutant sequences were as shown in Table 4.

TABLE 2 PCR reaction procedure for LAC1 Gene expression vectors

TABLE 3 random mutant Gene expression library-related primers

Primer name	Primer sequence (5 '. Fwdarw.3')
		Random mutant sequence 1-F	CACTCCTTCCTCTACGACTT
Random mutant sequence 1-R	CGCAGGCCGTCACAGTACTGGG
		Random mutant sequence 2-F	TTCGCCATCGTCTTCGCCGA
Random mutant sequence 2-R	GCAGCTTGTCGTAGATGGGA
		pET32a-1-F	CCCAGTACTGTGACGGCCTGCG
pET32a-1-R	GTAGAGGAAGGAGTGGCCGG
		pET32a-2-F	TCTACGACAAGCTGCCCGAG
pET32a-2-R	GAAGACGATGGCGAAGCCGG

TABLE 4 random mutant sequence PCR reaction procedure

After the PCR reaction procedure was completed, the pET-32a (+) -LAC1 linearized vector was electrophoretically detected with 1% agarose gel and the random mutation sequence was electrophoretically detected with 2.5% agarose gel.

Linearized vectors and random mutation sequences were recovered by using a SanPrep column gel recovery kit according to the instructions, and the concentrations and purities were determined and stored at-20 ℃.

Example 3

The construction schematic diagram of the random mutant sequence recombinant vector pET-32a (+) -LAC1 is shown in figure 1, and the method is utilizedUltra One Step Cloning Kit the two mutant sequences and the expression vector were connected in sequence, as shown in FIG. 2, and a homologous recombination reaction system was prepared according to Table 5, and the homologous recombination reaction procedure is shown in Table 6.

TABLE 5 homologous recombination reaction System

System composition	Dosage of
		Linearization carrier	140ng
Insertion fragment	20ng
		2×ClonExpress Mix	5μL
ddH 2 O	Supplement 10 mu L

In Table 5, the optimum cloning vector was used in an amount= [0.02×cloning vector base pair number ] ng (0.03 pmol), and the optimum insert was used in an amount= [0.04×insert base pair number ] ng (0.06 pmol).

TABLE 6 homologous recombination reaction procedure

Step (a)	Temperature (. Degree. C.)	Reaction time (min)
			1	50	15

In Table 6, the recombination time was prolonged to 30min, and the recombination efficiency was improved, but not more than 1h at maximum.

Example 4

Immediately after the homologous recombination reaction was completed, the ligation product was transformed into DH 5. Alpha. Competent cells as follows:

(1) 50ul E.coli DH5α for cloning was thawed on ice.

(2) 10. Mu.L of the recombinant product was added to 100. Mu.L of competent cells, and the mixture was stirred well against the walls of the flick tube and allowed to stand on ice for 30min.

(3) After heat shock in a water bath at 42 ℃ for 90sec, the mixture was immediately placed on ice and cooled for 3min.

(4) 900. Mu.L of LB liquid medium (without antibiotics) was added, and the mixture was shaken at 37℃and 220rpm for 1 hour, and the solid LB medium plate was sterilized under an ultra-clean bench by an ultraviolet lamp.

(5) The bacterial solution was centrifuged at 5000rpm for 5min, the bacterial solution was resuspended in the remaining medium and gently spread on plates containing the correct resistance.

(6) After plating, the plate is transferred to a constant temperature incubator at 37 ℃ for culturing for 10min on the front surface, and then the plate is reversely cultured until the plate is harvested every noon.

Transforming competent cells E.coli DH5 alpha, constructing a random mutant gene expression library, randomly picking a monoclonal from the obtained random mutant gene library, and sequencing and analyzing about 2-6 amino acids of each mutant. On the basis, the mixed plasmid of the random mutant gene library is extracted and transferred into E.coli BL21 (DE 3) competent cells.

Example 5

(1) mu.L of sterilized ddH was added sequentially to the PCR well plate ₂ O; randomly picking single bacterial colony with good growth state by using a 10uL gun head, blowing the gun head in a hole, imprinting on a new LB flat plate containing Amp, designing and synthesizing colony PCR primer of pET-32a (+) -LAC1 random mutation sequence expression vector, and detecting whether a target fragment is correctly inserted or notEntering; the primer sequences are shown in Table 7.

(2) Plates were incubated with single colonies in an incubator at 37℃overnight in an inverted position.

(3) A residual colony PCR reaction system was added to each well of the PCR well plate in sequence according to Table 8, and a drop of paraffin oil was added dropwise to the well plate with a yellow gun head to seal the liquid surface, and the colony PCR reaction procedure was as shown in Table 9.

TABLE 7 colony PCR primer for pET-32a (+) -LAC1 random mutant sequence expression vector

Primer name	Primer sequence (5 '. Fwdarw.3')
		RD primer1	CATCCACTGGCACGGCTTCT
Random mutant sequence 1-R	CGCAGGCCGTCACAGTACTGGG
		Random mutant sequence 2-R	GCAGCTTGTCGTAGATGGGA

Note that: colony PCR upstream primers of all pET-32a (+) -LAC1 random mutant sequence expression vectors are used as a universal primer RD primer1 on the vector, and downstream primers are used as downstream primers of random mutant sequences.

TABLE 8 colony PCR reaction System

System composition	Dosage of
		Stencil (Single colony DNA)	Gun head picking
Colony PCR primer (2 mu M)	2.5μL
		2×Taq Master Mix	5μL
ddH 2 O	5 mu L (added in advance)

TABLE 9 colony PCR reaction procedure

mu.L of colony PCR products were taken from each well and electrophoretically detected on a 2.5% agarose gel.

Sequencing and identification: the positive bands in the control electrophoresis results were compared, the corresponding monoclonal colonies were picked up on the plate, the monoclonal colonies were picked up with a 10. Mu.L tip in a tube containing 5mL of liquid LB medium, and 5. Mu.LAMP was added and incubated overnight at 37℃with a constant temperature shaker at 220 rpm. 500mL of added glycerol was aspirated in an ultra clean bench and stored at-80℃and the remaining plasmid was extracted using the SanPrep column plasmid DNA miniprep extraction kit and sent to Sangon for sequencing and identification.

Example 6

The filter paper which is not unsealed is cut into flat plates, the flat plates are sterilized under high pressure, the flat plates are placed in an ultra-clean bench for ultraviolet irradiation, colonies of the flat plates which are successfully sequenced are dipped and picked up by the filter paper, pressed on a new solid culture medium containing Amp lightly, and the flat plates are placed in a constant temperature incubator at 37 ℃ for overnight. All plasmids on the plates were gently scraped off with a gun head, inoculated into tubes containing 5mL of LB medium, and incubated overnight at 37℃on a constant temperature shaker at 220 rpm. The mixed plasmid of random mutant gene library is extracted by using SanPrep column type plasmid DNA small extraction kit, and the mixed plasmid is transferred into E.coli BL21 (DE 3) competent cells.

Example 7

The overnight plate was removed, 150. Mu.L of LB medium containing Amp was added to each well of the 96-well plate, the single clone was randomly picked with a white gun head, inoculated into the 96-well plate, sealed with a sealing film, and placed in a 37℃incubator overnight. mu.L of overnight culture broth was pipetted into another well plate containing 130. Mu.L of liquid medium to culture until OD ₆₀₀ Reaching about 0.6 to 0.8; the original 96-well plate bacteria liquid is stored in a sealing way and is stored at 4 ℃. mu.L of 100. Mu.M IPTG was added to each well and induced expression at 16 ℃. The cells were collected by centrifugation at 5000rpm for 15min in 96-well plates every other day, and the medium was discarded. Referring to the one-step bacterial active protein extraction kit, 500. Mu.L of Lysozyme (1. Mu.L of DTT and 10. Mu.L of PMSF are added to each 1mL of extraction reagent) is added to each well, and the mixture is repeatedly blown with a gun head to form a uniform suspension, and the uniform suspension is placed on a constant temperature shaking table and is oscillated at 220rpm for about 30min at room temperature. Centrifuge at 10000rpm for 15min at 4℃and collect the supernatant. 50 μ LpH 4.0.0 disodium hydrogen phosphate-citrate buffer was added to each well of the new 96-well plate, incubated in a microplate reader at 37℃for 3min, 50 μl of soluble supernatant was added to each well using a row gun, and the change in absorbance at OD420 was measured within 1 min. And shaking bacteria and re-screening by using a 5mL test tube.

Example 8

The sequencing result is analyzed by using a bioinformatics method, a laboratory self-built script is used for converting the sequencing result FASTA file into a FASTQ file, BWA samse is used for comparing with an original sequence, and finally an IGV is used for visualization, and then a sequence meeting the requirement is manually selected. IGV visualization is shown in fig. 3, 4.

Example 9

After a mutation library is obtained by using a homologous recombination method, 5 strains with improved enzyme activity are obtained by adopting a 96-well plate high-throughput screening method, and a strain with 2.3 times of the wild type enzyme activity is finally obtained by shaking and rescreening, and is named as LAC123. Sequencing shows that the strain LAC123 has 5 bases mutated compared with the wild type, and the base mutation site is: the base at position 1521 is synonymous mutation GAA-GAG, the base mutation GCC-GGC at position 1493, the base mutation AUC-CUC at position 1483, the base mutation AAC-CAC at position 1477, the base mutation GTC-GGC at position 1475, and the corresponding amino acid mutation sites are: V490G, N491H, I493L and a496G, which are located in the surface loop region of laccase globular three-dimensional structure, namely: valine at position 490 is mutated to glycine, asparagine at position 491 is mutated to histidine, isoleucine at position 493 is mutated to leucine, alanine at position 496 is mutated to glycine, and the amino acid sequence of LAC123 is as shown in SEQ ID NO:3, and LAC23 and LAC1 sequence pairs such as shown in FIG. 5.

And analyzing the three-dimensional structure of laccase by utilizing SWISS-MODEL molecular simulation software homologous modeling and downloading a PDB file. The mutation sites were labeled with the Pymol software and a three-dimensional structural model of laccase was obtained based on predicted structural information, as shown in fig. 6.

These results preliminarily indicate that amino acid mutants can be screened to improve enzyme activity by constructing random mutation libraries by the experimental technique.

The above-described embodiments are only preferred embodiments of the present invention, and are not intended to be limiting in any way and in nature, and it should be noted that several modifications and additions may be made to those skilled in the art without departing from the invention, which modifications and additions are also intended to be construed as within the scope of the invention.

Sequence listing

<110> university of east China

<120> method for modifying laccase by specific segment random mutation method and laccase strain LAC123

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 92

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

cactccttcc tctacgactt ccacgtcccc gaccaggccg gcacctnctg gnatcactcc 60

cacntcngcn cccagtactg tgacggcctg cg 92

<210> 2

<211> 97

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ttcgccatcg tcttcgccga ggacgncnac gacntcaagt ncgncaaccc cgtccccccc 60

agctgggagg anctttgtcc catctacgac aagctgc 97

<210> 3

<211> 518

<212> PRT

<213> Artificial sequence (LAC 123)

<400> 3

Met Gly Ser Gly Leu Phe Ser Leu Phe Val Ala Ile Ala Ala Ile Ser

1 5 10 15

Gly Ser Leu Ala Ala Ile Gly Pro Lys Ala Asp Leu Val Ile Ser Asp

20 25 30

Ala Val Val Asn Pro Asp Gly Thr Pro Arg Ala Ala Val Val Val Asn

35 40 45

Gly Asp Phe Pro Gly Pro Leu Ile Ser Gly Lys Lys Gly Asp His Phe

50 55 60

Gln Leu Asn Val Ile Asn Lys Leu Thr Asn His Thr Met Leu Lys Thr

65 70 75 80

Thr Ser Ile His Trp His Gly Phe Phe Gln Glu His Thr Asn Trp Ala

85 90 95

Asp Gly Pro Ala Phe Val Asn Gln Cys Pro Ile Ala Ser Gly His Ser

100 105 110

Phe Leu Tyr Asp Phe His Val Pro Asp Gln Ala Gly Thr Tyr Trp Tyr

115 120 125

His Ser His Leu Ser Thr Gln Tyr Cys Asp Gly Leu Arg Gly Pro Leu

130 135 140

Val Val Tyr Asp Pro His Asp Pro Gln Ala His Leu Tyr Asp Val Asp

145 150 155 160

Asn Asp Asp Thr Val Ile Thr Leu Ala Asp Trp Tyr His Val Ala Ala

165 170 175

Lys Leu Gly Pro Gln Phe Pro Arg Gly Ala Asn Ser Thr Leu Ile Asn

180 185 190

Gly Leu Gly Arg Ala Ala Thr Asp Ser Thr Ser Asp Leu Thr Val Ile

195 200 205

Thr Val Glu His Gly Lys Arg Tyr Arg Phe Arg Leu Val Ser Ile Ser

210 215 220

Cys Asp Pro Asn His Thr Phe Ser Ile Asp Gly His Asn Met Thr Ile

225 230 235 240

Ile Glu Val Asp Gly Val Asn Ser Lys Pro Leu Thr Val Asp Ser Ile

245 250 255

Gln Ile Phe Ala Ala Gln Arg Tyr Ser Phe Val Leu Asn Ala Asn Gln

260 265 270

Pro Val Asp Asn Tyr Trp Ile Arg Ala Asn Pro Ser Gly Gly Thr Leu

275 280 285

Gly Phe Glu Gly Gly Ile Asn Ser Ala Ile Leu Arg Tyr Lys Gly Ala

290 295 300

Pro Asp Ala Glu Pro Thr Asn Thr Thr Ala Pro Thr Ser Val Ile Pro

305 310 315 320

Leu Val Glu Thr Asn Leu His Pro Leu Lys Pro Met Gln Val Pro Gly

325 330 335

Arg Ser Gly Val Gly Asn Val Asp Tyr Ala Lys Thr Leu Asn Phe Asn

340 345 350

Phe Asn Gly Thr Asn Phe Phe Ile Asn Asn Ala Thr Phe Thr Pro Pro

355 360 365

Thr Val Pro Val Leu Leu Gln Ile Leu Ser Gly Ala His Asn Ala Gln

370 375 380

Asp Leu Leu Pro Ala Gly Ser Val Tyr Thr Leu Pro Pro His Ser Ala

385 390 395 400

Ile Glu Ile Thr Met Pro Ala Thr Thr Met Ala Pro Gly Ser Pro His

405 410 415

Pro Phe His Leu His Gly His Val Phe Ala Val Val Arg Ser Ala Gly

420 425 430

Ser Ser Glu Tyr Asn Tyr His Asp Pro Ile Phe Arg Asp Val Val Ser

435 440 445

Thr Gly Gln Pro Gly Asp Ser Val Thr Ile Arg Phe Met Thr Asp Asn

450 455 460

Pro Gly Pro Trp Phe Leu His Cys His Ile Asp Phe His Leu Glu Ala

465 470 475 480

Gly Phe Ala Ile Val Phe Ala Glu Asp Gly His Asp Leu Lys Tyr Gly

485 490 495

Asn Pro Val Pro Pro Ser Trp Glu Glu Leu Cys Pro Ile Tyr Asp Lys

500 505 510

Leu Pro Glu Ser Asp His

515

Claims (1)

1. The laccase is characterized in that the amino acid sequence of the laccase is shown as SEQ ID NO. 3.