JP2014003970A - Highly active mutant of protein having laccase activity, nucleic acid molecule encoding the same and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a mutant having a substrate-oxidizing activity superior to that of the known proteins having laccase activity.SOLUTION: The protein is selected from the group consisting of: (a) proteins including an amino acid sequence in which methionine at position 308 of a specific amino acid sequence is replaced by another amino acid; and (b) proteins including an amino acid sequence in which one or more amino acids in a specific amino acid sequence are deleted or replaced or added, and the amino acid at position 308 of the specific amino acid sequence is not methionine, where the protein has an improved laccase activity in comparison to a protein having the specific amino acid sequence.

Description

  The present invention relates to a highly activating mutant of a protein having laccase activity, a nucleic acid molecule encoding the same, and use thereof. Specifically, a highly activated mutant of a protein having laccase activity, a gene encoding the highly activated mutant, a vector containing the gene, a host cell containing the vector, a method for producing the highly activated mutant, The present invention also relates to a biobattery, a biosensor, and a method for detecting a phenol compound using the highly activated mutant.

  An enzyme is a biocatalyst that promotes a chemical reaction (metabolism) in a living body, and has a protein composed of an amino acid chain as a basic structure. The enzyme has the following characteristics: (1) catalysis under mild conditions at room temperature and pressure, (2) substrate specificity acting only on specific substrates, and catalysis on specific chemical reactions And having reaction specificity that does not cause side reactions. Among enzymes, an enzyme that catalyzes redox in vivo is called an oxidoreductase. In particular, an enzyme that oxidizes a substrate is called an oxidase, and an enzyme that reduces a substrate is called a reductase. When a certain oxidoreductase is immobilized on the electrode surface, only a specific redox reaction proceeds selectively on the electrode due to the catalytic action of the enzyme, and the change of the substance due to the redox reaction is converted into an electrical signal by the electrode. Can do. Such an electrode is called an enzyme electrode and is used for an electrode of a bio battery.

In recent years, global issues such as global warming and depletion of fossil fuels due to the increase in carbon dioxide gas have surfaced, and the direction of the response is the use of renewable energy and the carbon cycle cycle by material conversion using CO ₂ as a raw material. Optimization is required. To realize such a low-carbon society in the future, it is necessary to improve the energy balance (local production for local consumption of energy) that relied on fossil fuels through the introduction of large amounts of renewable energy and smart grid technology. Among renewable energies, biomass power generation is a stable energy source and is suitable for local production for local consumption because large facilities are not required. As a biomass energy utilization technology, a bio-battery, which is a clean and inexpensive power generation technology utilizing an enzyme reaction of a living organism, is suitable for a highly efficient, low-cost, high safety and small mobile power source.

  Laccase is also one of the oxidoreductases. It is a multi-copper oxidase that has substrate oxidation activity and catalyzes a reaction that oxidizes phenolic compounds such as o-, p-diphenol, p-phenylenediamine, and ascorbic acid. Laccase has an active center to which a total of four copper ions are bound, and their function catalyzes a reaction of drawing electrons from the substrate (electron accepting site) and using the electrons to reduce oxygen to water. The reaction site with an electron donor (type I copper site) is different from the reaction site with an electron acceptor. Such a catalytic ability of laccase, which is a multi-copper oxidase, can be applied to various chemical reactions. For example, treatment of waste liquids containing highly toxic phenolic compounds and aromatic amines, removal of ligrin in pulp production treatment, etc., electrode catalyst, production of artificial lacquer, synthesis of organic compounds, browning treatment of tea, production of melanin for cosmetics, It is expected to be used in many industrial fields such as food gelling agents, clinical test reagents, and bleaching agents. In addition, laccase is known to use an electrode as an electron donor. By combining with an appropriate electrode substrate such as a carbon substrate, an electrode catalyst for an anode (oxygen reduction electrode) of a bio battery or a biosensor. Industrial use as an electrode catalyst is expected.

  Multi-copper oxidase including laccase is known to exist widely in microorganisms, fungi, plants and the like, and has been isolated from a wide variety of organisms (Non-patent Document 1, etc.). Non-Patent Document 1 is a patent review on laccase and discloses various characteristics of laccase. Among them, Escherichia coli (Non-patent document 2 etc.), Bacillus subtillis (Non-patent document 3 etc.), Mulberry cactus fungus Myrothecium verrucaria (Non-patent document 4 etc.), Thermus thermophilus Thermus thermophilus (Non-patent documents 5 and 6) Etc.), etc. are particularly advanced. Non-Patent Document 2 reports multi-copper oxidase (CueO) involved in the copper excretion system of Escherichia coli, and its characteristics are disclosed, such as CueO showing a substrate specificity different from other multi-copper oxidases. Yes. Non-Patent Document 3 reports that the spore coat protein (CotA) of Bacillus subtilis has laccase activity and exhibits very stable activity. Non-Patent Document 4 reports bilirubin oxidase derived from a mulberry dark spot fungus, and discloses its properties such as high thermal stability and pH stability. Non-Patent Documents 5 and 6 report laccase derived from the HB27 strain of Thermus thermophilus and disclose characteristics such as biological characteristics such as high thermal stability. In particular, Non-Patent Document 6 discloses its electrochemical characteristics. Further, a highly activated mutant of CueO derived from E. coli described in Non-Patent Document 2 has been reported (Non-Patent Document 7).

  Multi-copper oxidase has also been isolated from a metagenome prepared from environmental samples without using microorganisms for separation and culture (Patent Document 1, Patent Document 2, etc.). The laccase disclosed in Patent Document 1 was previously discovered by the present inventors, has a high optimum temperature, an optimum pH of 5.0 and an acidic region, and has excellent thermal stability and pH stability. Its characteristics have been reported. Patent Document 2 reports a metagenome-derived laccase prepared from activated sludge. The characteristics are disclosed, such as exhibiting a wide range of substrate specificity, heat stability, surfactant and chelating agent resistance, and an optimum pH being alkaline.

Japanese Unexamined Patent Publication No. 2011-87474 (Japanese Patent Application No. 2009-241586) Japanese Patent Application No. 2009-201481 (Japanese Patent Application 2008-50087)

Adinarayana Kunamneni et al., “Laccases and Their Applications: A Patent Review” Recent Patents on Biotechnology, 2008, Vol. 2, No. 1, pp. 10-24, ISSN: 1872 -2083 Kataoka K. et al., “Four-Electron Reduction of Dioxygen by a Multicopper Oxidase, CueO, and Roles of Asp112 and Glu506 Located Adjacent to the Trinuclear Copper Center (multi-copper oxidase, 4-electron reduction of oxygen molecules by CueO Roles of Asp112 and Glu506 located near the nuclear copper center) ”, J. Biol. Chem., 2009, 284, 21, 14405-14413 Ligia O. Martins et al., “Molecular and Biochemical Characterization of a Highly Stable Bacterial Laccase That Occurs as a Structural Component of the Bacillus subtilis Endospore Coat. And J Biol Chem., 2002, 277, 21, 18849-18859 Amiloenzyme Bilirubin Oxidase "Amano" 3 (Myrothecium sp.) Data sheet Miyazaki K. et al., "A hyperthermophilic laccase from Thermus thermophilus HB27." Extremophiles: life under extreme conditions. "Extremophiles, 2005, Vol. 9, No. 6, Pages 415-425 Liu X. et al., “Electrochemical properties and temperature dependence of a recombinant laccase from Thermus thermophilus.”, Anal. Bioanal. Chem., 2011 399, No.1, pp.361-366 Kataoka K. et al., Enhancement of laccase activity through the construction and breakdown of a hydrogen bond at the type I copper center in Escherichia coli CueO and the deletion mutant Δα5-7 CueO. Enhancement of laccase activity through bond construction and destruction, and deletion mutant Δα57 CueO) ”Biochemistry, 2011, 50, 4, 558-565

  However, as described above, proteins with laccase activity have been isolated from a wide variety of organisms. However, for practical application as biocatalysts and electrode sensors for biosensors, further improvement in catalytic activity is desired. It was rare. Improvement of the catalytic activity leads to an improvement in the output of the bio battery, an improvement in the sensitivity of the biosensor, and the like, and promotes technological development in this field. Therefore, an object of the present invention is to provide a highly activated mutant having a substrate catalytic activity superior to that of a protein having a known laccase activity. Another object of the present invention is to provide a highly activated mutant that has excellent direct electron transfer efficiency to the electrode and a stable catalytic function, and is suitable for use as an electrode catalyst.

  Therefore, as a result of intensive studies to achieve the above object, the present inventors have found that a specific amino acid residue in the amino acid constituting the three-dimensional structure of a known wild type laccase affects the specific activity. I found. And it discovered that the specific activity improved by substituting this with another amino acid residue, and the maximum processing capacity of laccase activity can be improved 3 to 4 times compared with the wild type. Furthermore, it has been found that the efficiency of direct electron transfer to the electrode and the stability of the catalytic function can be improved by deleting an amino acid group in a partial region on the N-terminal side. The present invention has been completed based on these findings.

That is, the invention shown in the following [1] to [15] is provided.
[1] A protein selected from the group consisting of:
(A) a protein comprising an amino acid sequence in which the 308th methionine of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid (b) one or several amino acids are deleted, substituted or substituted in the amino acid sequence of SEQ ID NO: 2 And an improved laccase activity as compared to a protein comprising the amino acid sequence of SEQ ID NO: 2 comprising an amino acid sequence other than methionine at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 2 [2] The other amino acid is arginine.
[3] The protein of the present invention selected from the group consisting of:
(A) a protein comprising the amino acid sequence of SEQ ID NO: 4 (b) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 4, and the 308th amino acid sequence of SEQ ID NO: 4 A protein comprising an amino acid sequence in which the corresponding amino acid residue is arginine and having improved laccase activity compared to a protein comprising the amino acid sequence of SEQ ID NO: 2 (c) a protein comprising the amino acid sequence of SEQ ID NO: 5 (d ) From the amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 5 and the amino acid residue at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 5 is arginine Improved laccase compared to the protein consisting of the amino acid sequence of SEQ ID NO: 2 Protein having sex

  According to the constitutions [1] to [3], a novel highly active mutant having improved laccase activity compared to the wild type is provided. The highly activated mutant has an excellent substrate catalytic ability such that the maximum throughput (Vmax value) in laccase activity is improved 3 to 4 times. Therefore, the highly activated mutant can be applied to a technique that requires a redox reaction of a phenol compound in various industrial fields such as medical, food, and environmental fields. In particular, it is expected to be used as an electrode catalyst for biocells and biosensors that require excellent substrate catalytic ability.

[4] A protein selected from the group consisting of:
(A) a protein comprising the amino acid sequence of SEQ ID NO: 25 (b) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 25, and the 241st amino acid sequence of SEQ ID NO: 25 The amino acid residue at the corresponding position consists of an amino acid sequence that is arginine, and has an improved laccase activity compared to the protein consisting of the amino acid sequence of SEQ ID NO: 2 and the protein consisting of the amino acid sequence of SEQ ID NO: 4 or 5. A protein having improved direct electron transfer activity (c) a protein comprising the amino acid sequence of SEQ ID NO: 27, (d) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 27, and the sequence The amino acid residue at the position corresponding to position 268 of the amino acid sequence of No. 27 is arginine To the amino acid sequence is a protein having a comparison with improved laccase activity, and SEQ ID NO: 4 or directly improved as compared to a protein consisting of five amino acid sequence electron transfer activity to the protein consisting of the amino acid sequence of SEQ ID NO: 2

  According to the configuration of [4] above, an N-terminal truncated high activation mutant having improved laccase activity and improved electron transfer efficiency and performance stability as compared with the wild type is provided. The highly activating mutant can improve the laccase activity 3-4 times compared to the wild type that is the basis of the modification, and the electron transfer function is 3-4 times more than the protein having the existing laccase activity. It has improved. And the electron transfer function can be improved 4 to 5 times or more compared to the highly activating mutant of the present invention before cleavage at the N-terminal side, for example, the protein comprising the amino acid sequence of SEQ ID NO: 4 or 5. Excellent electrocatalytic performance. Specifically, when the N-terminal truncated high activation mutant of the present invention is used as an electrode catalyst, direct electron transfer with the electrode is possible, and a high catalyst current can be obtained. Therefore, the N-terminal truncated high activation mutant can be applied to a technique that requires an oxidation-reduction reaction of a phenol compound in various industrial fields such as medical, food, and environmental fields. In particular, it is expected to be used as an electrode catalyst for biocells and biosensors that require excellent substrate catalyst ability and electrode catalyst ability.

[5] A nucleic acid molecule encoding the protein (high activation mutant).
[6] A recombinant vector containing the nucleic acid molecule.
[7] A transformant having the above recombinant vector.
[8] A method for producing the protein, comprising the steps of culturing the transformant at 10 to 20 ° C. and collecting a protein exhibiting laccase activity from the obtained culture.

  According to the configuration of [5] to [8], a nucleic acid molecule encoding a novel highly activating mutant having improved laccase activity compared to the wild type, recombinant vector, transformant, and the activating mutation A method of manufacturing a body is provided. In addition, since the base sequence encoding the highly activated mutant has been found, the highly activated mutant can be mass-produced at low cost and industrially by genetic engineering techniques. Thereby, the industrial utility value of the highly activated mutant can be further increased.

[9] A biobattery provided with an electrode on which the above protein (high activation mutant) is immobilized as a cathode side electrode.
[10] An electrode on which the above-described protein (N-terminal cleaved highly activated mutant) is immobilized via an electrically conductive porous material is provided as a cathode-side electrode.
[11] The porous material is porous carbon having pores having a diameter of 20 to 40 nm.

According to the configuration of [9], a biobattery using a novel highly activated mutant having improved laccase activity as compared with the wild type as a cathode side electrode is provided. In the biobattery, since the highly activated mutant used as a cathode-side electrode catalyst has an excellent substrate catalytic ability, the oxidation-reduction reaction on the cathode-side electrode is advanced with high efficiency. As a result, the electric energy generated increases, and high power and stable power generation becomes possible. As a result, a high-performance and highly practical biobattery can be constructed.
In particular, according to the constitutions [10] to [11], the N-terminal truncated high activation variant of the present invention [4] can be directly transferred to the electrode in the pores of the porous material. The electrode can be fixed in the form of an electrode having excellent catalytic current performance of a direct electron transfer type. Further, by filling in the pores, there is an advantage that the performance degradation such as the catalytic function of the N-terminally-cut highly activated mutant of the present invention on the electrode can be reduced and the stability of the electrode is improved. Thereby, further high output and stable power generation becomes possible, and a high-performance and highly practical bio battery can be constructed.

[12] A biosensor comprising an electrode on which the protein (high activation mutant) is immobilized as a substrate recognition site.
[13] An electrode in which the above-described protein (N-terminal cleavage type highly active mutant) is immobilized via an electrically conductive porous material is provided.
[14] The porous material is porous carbon having pores having a diameter of 20 to 40 nm.

According to the configuration of [12], a biosensor using a novel highly active mutant having improved laccase activity as compared with the wild type as a substrate recognition site is provided. Since the highly active mutant used as a substrate recognition site has excellent substrate catalytic ability, the oxidation-reduction reaction of the substrate that is the detection target substance proceeds with high efficiency on the working electrode that is the substrate recognition site. . As a result, the detection sensitivity can be improved by increasing the output of the electric signal. Thereby, a biosensor with high performance and high practicality can be constructed. Therefore, the biosensor can be used in various industrial fields such as medical, food, and environmental fields as a phenol sensor for detecting a phenol compound that is a substrate of the highly activated mutant.
In particular, according to the constitutions [13] to [14], the N-terminal truncated high activation variant of the present invention [4] can be directly transferred to the electrode in the pores of the porous material. The electrode can be fixed in the form of an electrode having excellent catalytic current performance of a direct electron transfer type. And there also exists an advantage that the performance fall of the N terminal side cutting | disconnection type highly activated variant of this invention on an electrode can be reduced. As a result, the detection sensitivity can be improved by further increasing the output of the electric signal, which contributes to the construction of a biosensor with high performance and high practicality.

[15] A method for detecting a phenolic compound, wherein the protein (highly activated mutant) is contacted with a test sample, and the change in laccase activity is measured to detect the phenolic compound.

  According to the structure of [15], the method of detecting a phenol compound is provided using the novel highly activated mutant which improved the laccase activity compared with the wild type. The phenolic compound is a substrate of the highly activated mutant, and the phenolic compound is detected by utilizing the excellent substrate catalytic ability of the highly activated mutant. Since the oxidation-reduction reaction of the substrate that is the detection target substance is performed with high efficiency, the detection sensitivity can be improved. Therefore, the detection method of the phenol compounds is highly accurate and highly practical, and can be used in various industrial fields such as medical, food, and environmental fields.

The figure which shows the base sequence of wild-type MELAC used as the foundation of construction of mutant No.3. The figure which shows the amino acid sequence of wild-type MELAC used as the foundation of construction of mutant No.3. The figure which shows the base sequence of variant No.3. The figure which shows the amino acid sequence of variant No.3. The figure which shows the result of having measured the laccase activity of the variant produced based on wild-type MELAC in Step 4 of Example 1. FIG. In Example 4, the electrophoretic diagram which shows the result of having confirmed the recombinant synthesis and purification of the variant (mutant No. 3) acquired at step 4 of Example 1. FIG. The graph which shows the result of Example 4 which compared the laccase activity of each variant acquired at Step 4 of Example 1. FIG. The graph which shows the result of Example 5 which confirmed PH dependence (pH 3.5-5.5) of the laccase activity of the mutant No. 3 confirmed to be a highly activating mutant in Example 4. The graph which shows the result of Example 5 which confirmed PH dependence (pH5.5-8.0) of the laccase activity of variant No.3. In Example 6, in order to examine the effect of the mutation introduction site on the laccase activity improvement, a mutant in which mutation was introduced only in one of the two mutation introduction sites of mutant No. 3 (mutant Q225R, mutant The electrophoretic diagram which shows the result of having confirmed the recombinant synthesis and purification of M308R). In mutant No. 3, the graph which shows the result of Example 6 which confirmed the influence with respect to the laccase activity improvement of a mutation introduction site | part. The graph which shows the result of Example 7 which confirmed the substrate concentration dependence (0-2000 micromol) of the laccase activity of mutant No.3, mutant M308R, and wild-type MELAC. The graph which shows the result of Example 7 which confirmed the substrate concentration dependence (1000-4500 micromol) of the laccase activity of mutant No.3, mutant M308R, wild-type MELAC. It is a figure which shows the three-dimensional structure model of the wild-type MELAC constructed | assembled in Example 9, and shows the position of M308 and the type I copper by Ball & Stick display. It is a figure which shows the three-dimensional structure model of the similar enzyme Mv.BO of the wild-type MELAC constructed | assembled in Example 9, and shows the amino acid group estimated to be involved in substrate binding by Ball & Stick display. The figure which piled up the three-dimensional structure model of FIG. 9A and FIG. 9B constructed | assembled in Example 9. FIG. The alignment figure which shows the result of Example 10 which performed the sequence specification of the wild type MELAC subspecies (the 1). The alignment figure which shows the result of Example 10 which performed the sequence specification of the wild type MELAC subspecies (the 2). The alignment figure which shows the result of Example 10 which performed the sequence specification of the wild type MELAC subspecies (the 3). The graph which shows the result of Example 11 which confirmed the laccase activity of the variant M308R as an electrocatalytic activity from the electrochemical measurement. It is a figure which shows the result of Example 12 which examined the enzyme modification, and shows the result of the amino acid sequence comparison with mutant M308R and thermostable laccase derived from Thermus thermophilus HB27 strain. It is a figure which shows the result of Example 12 which examined the enzyme modification | reformation, and represents the comparison of the structural model of variant M308R and variant M308R-Del68. In Example 13 in which the modified enzyme was prepared, the base sequence of the mutant M308R based on the mutant M308R-Del68 prepared, the mutant M308R-Del68 production, the mutant M308R-Del41, and the mutant M308R-Del77 The figure which shows the deletion site for In Example 13 where the modified enzyme was prepared, the amino acid sequence of the mutant M308R based on the prepared mutant M308R-Del68, and the mutant M308R-Del68 mutant M308R-Del41 and mutant M308R-Del77 were prepared. FIG. The figure which shows the base sequence of the produced variant M308R-Del68 in Example 13 which produced the modification enzyme. The figure which shows the amino acid sequence of the produced variant M308R-Del68 in Example 13 which produced the modification enzyme. It is an electrophoretic diagram which shows the result of Example 13 which performed preparation of a modification enzyme, and shows the confirmation result of the protein by electrophoresis. The graph which shows the result of Example 14 which performed activity confirmation of the variant by the measurement of laccase activity. The graph which shows the result of Example 15 which performed the activity confirmation of the variant by comparing the electrocatalytic activity of the variant produced in Example 13. FIG. The graph which shows the result of Example 16 which performed activity confirmation of variant M308R-Del68 by the comparison of the electrocatalytic activity with the existing enzyme. The graph which shows the result of Example 17 which examined optimization of the carbon gel pore diameter at the time of producing a porous carbon electrode by the amount of fixation. The graph which shows the result of Example 17 which examined optimization of the carbon gel pore diameter at the time of producing a porous carbon electrode by electrocatalytic activity. The graph which shows the result of Example 18 which performed activity confirmation of the variant M308R-Del68 by the comparison of the electrocatalytic activity with the existing enzyme. It is a graph which shows the result of Example 19 which performed activity confirmation of mutant M308R-Del68 by comparison with durability with the existing enzyme, and shows the result of having examined durability in the solvent of mutant M308R-Del68 . It is a graph which shows the result of Example 19 which performed activity confirmation of mutant M308R-Del68 by comparison with durability with the existing enzyme, and shows the result of having examined the durability in the solvent of the existing enzyme.

Hereinafter, the present invention will be described in detail.

1. Highly Activated Variant of Protein Having the Laccase Activity of the Present Invention The highly activated variant of the protein having the laccase activity of the present invention (hereinafter sometimes referred to as “highly activated variant” in the present specification). Deletion, substitution, or addition of an amino acid at at least one position in the amino acid sequence of a protein having a wild-type laccase activity that exists in nature (hereinafter sometimes referred to as “wild-type laccase” in the present specification) Alternatively, it is modified by insertion, and its catalytic activity is improved compared to wild type laccase. Here, “modified by deletion, substitution, addition or insertion of an amino acid at at least one position” means a known DNA recombination technique and a point mutation introduction for a gene encoding a protein that is the basis of the modification. It means that as many amino acids as can be deleted, substituted, added or inserted by a method or the like are deleted, substituted, added or inserted, and combinations thereof are also included. Therefore, the highly activating mutant may have one of these modifications, or may be a combination of two or more. Such modification may occur unintentionally in nature, but is preferably artificially introduced.

  Here, the laccase is an oxidase having a catalytic ability for a substrate oxidation reaction, and is a multi-copper oxidase in which four copper ions are bonded to the center of the catalyst. In other words, laccase activity is substrate oxidation activity, and specifically includes oxidation of phenolic compounds such as o-, p-diphenol, p-phenylenediamine, and ascorbic acid. It is exhibited by pulling out electrons from the electron (electron accepting site) and reducing oxygen to water using the electrons. It is known that the reaction site with the electron donor (type I copper site) is different from the reaction site with the electron acceptor. Examples of the substrate include 2,2′-azino-bis- (3-ethylbenzothiazoline-6-sulfonate (hereinafter referred to as “ABTS”). N-ethyl-N- (2-hydroxy-3-sulfopropyl) -3-methylaniline (hereinafter abbreviated as “TOOS”), dimethylaniline, diethylaniline, N, N-dimethyl-p -Phenylenediamine, catechol, resorcinol, hydroquinone, phenol, guaiacol, pyrogallol, p-hydroxybenzoic acid, caffeic acid, hydrocaffeic acid, o-cresol, p-toluidine, o-chlorophenol, m-chlorophenol, p -Chlorophenol, 2,4-dichlorophenol, 2,6-dichlorophenol, 2,4,6-trichlorophenol, 2,6-dimethoxyphenol, p-phenylenediamine, propyl gallate, etc. S can be preferably used.

  And, “highly activated” means that the laccase activity shows an activity that is improved over that of the wild type laccase, and means that the laccase activity is at least twice as high as that of the wild type laccase, preferably It means that the activity is 3 to 3.5 times or more. The activity can be confirmed by measuring the laccase activity by a known method and confirming whether the activity is improved as compared with a wild-type laccase having no modified site. Therefore, it can be carried out by measuring the oxidative activity for the phenolic compound as a substrate. For example, the improvement in activity can be confirmed by comparing the maximum reaction rate (Vmax value) indicating the maximum throughput of the enzyme. Specifically, any method known as a method for measuring the activity of an enzyme that catalyzes a redox reaction of a phenol compound can be performed using any method. For example, using ABTS as a substrate, the change in absorbance at 418 nm accompanying the oxidation reaction of the substrate can be measured, and the change in absorbance can be used as the activity of the enzyme. Therefore, the oxidation rate of ABTS can be calculated from the change in absorbance at 418 nm.

  Wild-type laccase is generally deliberately or unintentionally altered in the amino acid sequence of a protein having a laccase activity isolated from nature and the base sequence of a nucleic acid molecule encoding the protein. It means that there is no modification site. However, it is permissible to make modifications that do not change the function of proteins such as tag peptides such as His tags. The origin of wild type laccase is not particularly limited. As long as the organism has the ability to produce a protein having laccase activity, it may be derived from any organism. In particular, it is derived from bacteria. Preferably, it originates from organisms present in environmental samples such as compost. For example, it can be obtained by screening a protein having laccase activity from a protein expressed from metagenomic DNA prepared from an environmental sample. Particularly preferably, as the wild-type laccase, a protein shown in SEQ ID NO: 2 (FIG. 1B) derived from a metagenome from an environmental sample or a protein shown in SEQ ID NO: 22 obtained by adding a tag peptide to the protein can be used. In the present specification, this may be referred to as “MELAC”, and the nucleic acid molecule encoding “MELAC” may be referred to as “melac”. Wild-type “MELAC” is a laccase that is activated at room temperature and has excellent heat resistance. Therefore, it is particularly preferable to produce a highly activated mutant based on this, because it enables the construction of a highly active mutant having high activity and excellent heat resistance.

  The wild-type laccase may have different molecular weights depending on the difference in amino acid composition, but preferably has a relatively small molecular weight. Electrodes such as biocells and biosensors for which laccase is particularly expected to be applied are required to be configured by immobilizing a catalytic enzyme on a conductive member in high density and in large quantities from the viewpoint of improving output. Therefore, the low molecular weight substance can increase the amount of molecules supported per area of the conductive member and can improve the current density. Since the above MELAC has a relatively small molecular weight of about 47.5 kDa and laccase, it can be expected to improve the performance of biocells and biosensors. Therefore, it is particularly preferable to produce a highly activated mutant based on this, because it enables the construction of a mutant having high activity and a small molecular weight and high utility value.

  Here, the modification is preferably substitution with another amino acid. The other amino acids include any amino acid other than the amino acid before substitution. However, from the viewpoint of protein function modification, an amino acid having a property different from that of the amino acid before substitution in terms of polarity, charge, hydrophilicity, hydrophobicity and the like is preferable. For example, alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, and tryptophan are both classified as nonpolar amino acids and have similar properties to each other, but substitution with other amino acids has an effect on protein function. It is possible to give. Examples of the uncharged amino acid include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Examples of acidic amino acids include aspartic acid and glutamic acid. Examples of basic amino acids include lysine, arginine, and histidine. Amino acid substitutions other than within these groups are particularly expected to alter the function of the protein, but are not limited thereto. Preferably, substitution of methionine to another amino acid residue at a position corresponding to position 308 in the amino acid sequence of SEQ ID NO: 2 showing wild type MELAC is exemplified, and substitution to arginine is particularly preferred. Its amino acid sequence is shown in SEQ ID NO: 5. Such a protein has high heat resistance and pH stability, and is constructed with the aim of high activation based on wild-type MELAC having a small molecular weight. Therefore, the protein has high laccase activity and excellent wild-type MELAC. Has properties. This protein is 21% from the E. coli-derived laccase described in Non-Patent Document 2, 16% from the Bacillus subtilis-derived laccase described in Non-Patent Document 3, and the laccase derived from mulberry dark-spot fungus of Non-Patent Document 4. Is a protein having a novel laccase activity, showing only 13% amino acid sequence homology with the laccase derived from the metagenome of the environmental sample described in Patent Document 2.

  Here, the amino acid sequence shown in SEQ ID NO: 2 is the amino acid sequence of the wild-type laccase derived from the metagenome from the environmental sample, but the homologue of the enzyme derived from other organisms also has the same position modified Included in the highly activated variants of the invention.

  Moreover, as long as the property of the above-mentioned high activation mutant is hold | maintained, you may include the amino acid sequence which has the modification site | part in which modification | change has generate | occur | produced in the specific amino acid further. For example, in the case of wild-type MELAC, in the amino acid sequence of SEQ ID NO: 2, as long as the methionine at the position corresponding to position 308 is substituted with another amino acid, one or several amino acids at other positions are missing. Any loss, substitution or addition is included in the present invention as long as it retains the properties of a highly activating mutant. For example, methionine at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 2 is substituted with arginine, and is 70%, preferably 80%, particularly preferably 90% or more homologous to the amino acid sequence of SEQ ID NO: 2. The thing which has property is illustrated. Particularly preferably, a protein having the amino acid sequence shown in SEQ ID NO: 5 can be exemplified. Further, preferably, in addition to the substitution of the amino acid residue at the position corresponding to the 308th position of the amino acid sequence of SEQ ID NO: 2, the 255th glutamine is substituted with another amino acid, and particularly preferably arginine As an example, a protein having the amino acid sequence shown in SEQ ID NO: 4 (FIG. 1D) substituted in can be exemplified. Those skilled in the art can easily predict a modification that retains the highly activated laccase activity of the highly activated mutant of the present invention upon modification of the amino acid sequence. Specifically, for example, in the case of amino acid substitution, an amino acid having properties similar to the amino acid before substitution in terms of polarity, charge, hydrophilicity, hydrophobicity, etc. can be substituted from the viewpoint of maintaining the protein structure. . Such substitutions with amino acids of similar nature are well known to those skilled in the art as conservative substitutions and are accepted as maintaining the function of the protein. In addition, histidine tag (hereinafter abbreviated as “His tag”) peptide, FLAG tag peptide, etc. are added to the N- or C-terminus of the amino acid sequence for convenience such as subsequent purification and immobilization on a solid phase. Is also preferably exemplified. Such tag peptide can be introduced by a conventional method. Moreover, the cut | disconnected type which cut | disconnected the amino acid residue of the C terminal side or the N terminal side may be sufficient as long as it does not cause the loss of the enzyme activity of this invention. Furthermore, chemical modification such as glucosylation may be added.

  In particular, an N-terminal truncated high activation mutant in which 1 to 68 amino acids on the N-terminal side of the above highly activated mutant are deleted can be exemplified. For example, in the amino acid sequence of SEQ ID NO: 2, the methionine at the position corresponding to the 308th position is substituted with another amino acid sequence, and one or more amino acids from the 1st to 68th amino acids continuing from the N-terminus are missing. An N-terminal truncated high activation mutant having the lost amino acid sequence is also included in the present invention. Preferably, in the amino acid sequence of SEQ ID NO: 2, the methionine at the position corresponding to the 308th position is substituted with another amino acid sequence, and the 68th amino acid from the 1st to 68th positions is deleted. Illustrated. Preferably, the amino acid sequence of SEQ ID NO: 2 has an amino acid sequence in which the methionine at the position corresponding to the 308th position is substituted with another amino acid sequence, and 41 amino acids from the 1st to 41st positions are deleted. Those are preferably exemplified. Since the first amino acid methionine was added by the start codon, apparently, the 2nd to 68th consecutive amino acids or the 2nd to 41st consecutive amino acids were deleted from the N-terminus. It can also be expressed. Of course, the amino acid sequences of SEQ ID NOs: 4 and 5 having an amino acid sequence in which the amino acid corresponding to the above-mentioned site is deleted are also included in the present invention. Here, arginine is particularly preferably exemplified as the substitution with other amino acids. Specifically, the amino acid sequence of SEQ ID NO: 25 in which the first to 68th consecutive amino acids of the amino acid sequence of SEQ ID NO: 5 have been deleted (methionine added first), and the amino acid sequence of SEQ ID NO: 5 Those having the amino acid sequence shown in SEQ ID NO: 27 from which the first to 41st consecutive amino acids have been deleted (addition of methionine to the first) are particularly preferred.

  The N-terminal truncated high activation mutant of the present invention has improved laccase activity compared to the wild-type mutant as in the above-described high activation mutant that is not N-terminal truncated. Therefore, in the present specification, when simply referred to as “high activation mutant”, it includes both N-terminal truncated high activation mutants and non-N-terminal truncated mutants. Further, the N-terminally truncated high activation mutant has improved electron transfer efficiency to the electrode when used as an electrode catalyst. Here, the improvement of the electron transfer efficiency preferably means that the electron transfer efficiency is improved by about 3 to 4 times compared to an enzyme having an existing laccase activity. And even if compared with the highly activating mutant of the present invention before cleavage at the N-terminal side, for example, a protein comprising the amino acid sequence of SEQ ID NO: 4 or 5, the electron transfer function can be improved by about 4 to 5 times, etc. , Which means excellent electrocatalytic performance. Here, laccase has been found to use an electrode as an electron donor, and is expected to be industrially used as an electrode catalyst for biofuel cells and biosensors in combination with an appropriate carbon electrode. . The N-terminal truncated high activation mutant of the present invention can improve the electron transfer efficiency when it is fixed to a porous material such as carbon gel to constitute an electrode. In other words, the N-terminal truncated high activation mutant of the present invention can be fixed in the pores of the porous material in such a way that direct electron transfer with the electrode is possible, which makes it excellent in direct electron transfer type. It can be configured as an electrode having catalytic current performance. And there is also an advantage that the performance degradation of the N-terminal side cleavage type highly activated mutant of the present invention on the electrode can be reduced by filling the pores. Therefore, by applying the N-terminal truncated high activation mutant of the present invention to an electrode catalyst such as a biobattery or a biosensor, it is possible to contribute to the improvement of performance.

  An amino acid sequence in which the methionine at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, and one or more amino acids are deleted from 1 to 68 amino acids on the N-terminal side As long as it retains the properties of the above-mentioned N-terminal truncation type highly active mutant, one or several amino acids at other positions may be deleted, substituted or added. Good. That is, for an amino acid sequence in which methionine at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 2 is substituted with arginine and one or more amino acids of 1 to 68 amino acids on the N-terminal side are deleted And those having a homology of 70%, preferably 80%, particularly preferably 90% or more. Of course, those having homology of 70%, preferably 80%, particularly preferably 90% or more to the amino acid sequences shown in SEQ ID NOs: 25 and 27 are also included in the present invention. The modification of the amino acid sequence is as described above. Also in this case, the methionine at the position corresponding to the 308th position in SEQ ID NO: 2 is preferably substituted with arginine, the 241st position in SEQ ID NO: 25 and the 268th position in SEQ ID NO: 27.

  The highly activating mutant of the present invention can be obtained by a known method. For example, a gene encoding a wild-type laccase that is the basis of the modification is modified, a host cell is transformed using the obtained modified gene, and a protein having the above activity from the culture of the transformant Can be obtained by sampling.

  A gene encoding a wild-type laccase serving as a basis for modification can be obtained using a known gene cloning technique. For example, primers are designed based on gene information that can be obtained by searching known databases such as GenBank, and PCR is performed using genomic DNA extracted from an organism capable of producing a protein with laccase activity as a template. It can be obtained by doing. It can also be obtained by synthesis by a nucleic acid synthesis method such as a conventional phosphoramidite method based on known gene information. Here, as the gene sequence information of laccase suitable as the basis of the modified type of the present invention, the base sequence of wild-type MELAC is shown in SEQ ID NO: 1 in the sequence listing and FIG. 1A. This encodes the wild type MELAC shown in SEQ ID NO: 2 above. In addition, the base sequence of SEQ ID NO: 21 encoding the amino acid sequence of SEQ ID NO: 22 obtained by adding a tag sequence to SEQ ID NO: 2 can be suitably used.

  The method for modifying the gene encoding wild-type laccase is not particularly limited, and mutagenesis techniques for preparing modified proteins known to those skilled in the art can be used. For example, a known mutagenesis technique such as a site-directed mutagenesis method, a PCR abrupt induction method that introduces a mutation using a PCR method, or a transposon insertion mutagenesis method can be used. A commercially available mutation introduction kit (for example, QuikChange (registered trademark) Site-directed Mutagenesis Kit (manufactured by Stratagene)) may be used.

  In particular, preferably obtained by performing PCR using a DNA encoding wild-type laccase as a template and an oligonucleotide containing a sequence subjected to a desired modification as a primer. Here, in the preparation of the highly activating mutant of the present invention, the primer used in the case of using PCR includes a sequence complementary to a nucleic acid molecule encoding a wild type laccase so that a desired modification occurs. Designed and can be prepared based on conventional methods. For example, a chemical synthesis method based on the phosphoramidite method or the like can be used. When preparing a primer based on a chemical synthesis method, it is designed based on the sequence information of the target nucleic acid prior to synthesis. The primer can be designed using, for example, primer design support software so as to amplify a desired region. After synthesis, the primer is purified by means such as HPLC. Moreover, when performing chemical synthesis, it is also possible to use a commercially available automatic synthesizer. Examples of such primers include oligonucleotides composed of 10 or more, preferably 15 or more, and more preferably about 20 to 50 bases.

  In addition, once the amino acid sequence of the target highly active mutant is determined, an appropriate base sequence encoding the same can be determined, and the high activity of the present invention can be determined using a nucleic acid synthesis technique such as a conventional phosphoramidite method. DNA encoding the mutated mutant can be chemically synthesized.

  Further, such a highly activating mutant of the present invention can be obtained by screening the above-mentioned protein having improved laccase activity from mutants generated by natural or artificial mutation. It is preferable to introduce.

2. Nucleic Acid Molecules Encoding the Highly Activated Variant of the Present Invention Nucleic acid molecules encoding the highly activated variant of the present invention include those that encode all of the above highly activated variants with improved laccase activity. For example, all polynucleotides encoding a protein containing the amino acid sequence described in SEQ ID NOs: 4 and 5, and as one specific example, the base sequence shown in SEQ ID NO: 3 encoding the amino acid sequence of SEQ ID NO: 4, Examples include, but are not limited to, a nucleic acid molecule comprising SEQ ID NO: 23 encoding the amino acid sequence of SEQ ID NO: 5, SEQ ID NO: 24 encoding the amino acid sequence of SEQ ID NO: 25, and SEQ ID NO: 26 encoding the amino acid sequence of SEQ ID NO: 27. Not what you want. Here, the nucleic acid molecule in the present invention includes both DNA and RNA, and when it is DNA, it does not matter whether it is single-stranded or double-stranded.

  Since the nucleotide sequence of the nucleic acid molecule encoding the highly activating variant of the present invention has been clarified in the present specification, a DNA synthesis method such as a conventional phosphoramidite method is used based on such sequence information. It can be chemically synthesized. It can also be produced by modifying the DNA encoding wild-type MELAC that is the basis of modification. Details have been described above.

3. Recombinant Vector of the Present Invention The recombinant vector of the present invention can be constructed by incorporating a nucleic acid molecule encoding the highly activating mutant of the present invention into an appropriate vector. The vector that can be used is not particularly limited as long as it can incorporate foreign DNA and can replicate autonomously in a host cell. Accordingly, the vector contains a sequence of at least one restriction enzyme site into which a nucleic acid molecule encoding the highly activating variant of the present invention can be inserted. For example, plasmid vectors (pEX system, pUC system, pBR system, etc.), phage vectors (λgt10, λgt11, λZAP, etc.), cosmid vectors, virus vectors (vaccinia virus, baculovirus, etc.) and the like are included.

  The recombinant vector of the present invention is incorporated so that the nucleic acid molecule encoding the highly activated mutant of the present invention can express its function. Therefore, other known base sequences necessary for the functional expression of the nucleic acid molecule may be included. For example, a promoter sequence, a leader sequence, a signal sequence, a ribosome binding sequence and the like can be mentioned. As the promoter sequence, for example, when the host is Escherichia coli, lac promoter, trp promoter and the like are preferably exemplified. However, the present invention is not limited to this, and a known promoter sequence can be used. Furthermore, the recombinant vector of the present invention can also include a marking sequence that can confer phenotypic selection in the host. Examples of such marking sequences include sequences encoding genes such as drug resistance and auxotrophy. Specifically, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene and the like are exemplified.

  Insertion of a nucleic acid molecule or the like encoding a highly activating mutant of the present invention into a vector can be achieved by, for example, cleaving the nucleic acid molecule of the present invention with an appropriate restriction enzyme and inserting it into an appropriate vector restriction enzyme site or multiple cloning site A method of inserting and connecting can be used, but the method is not limited to this. For ligation, a known method such as a method using DNA ligase can be used. Commercially available ligation kits such as DNA Ligation Kit (Takara Bio Inc.) can also be used.

4). Transformant of the Present Invention The transformant of the present invention can be constructed by transforming an appropriate cell with a recombinant vector containing a nucleic acid molecule encoding the highly activating mutant of the present invention. Here, the host cell is not particularly limited as long as it can efficiently express the highly activating mutant of the present invention. Prokaryotes can be preferably used, and in particular, E. coli can be used. In addition, Bacillus subtilis, Bacillus bacteria, Pseudomonas bacteria, and the like can also be used. As E. coli, for example, E. coli DH5α, E. coli BL21, E. coli JM109 and the like can be used. Furthermore, eukaryotic cells can be used without being limited to prokaryotes. For example, yeasts such as Saccharomyces cerevisiae, insect cells such as Sf9 cells, animal cells such as CHO cells and COS-7 cells, and the like can be used. As the transformation method, a known method such as a calcium chloride method, an electroporation method, a liposome transfection method, or a microinjection method can be used.

5. Method for Producing Highly Activated Mutant of the Present Invention The method for producing the highly activated mutant of the present invention comprises culturing the transformant of the present invention described in the above section 4, and activating laccase activity from the obtained culture. It can carry out by extract | collecting the protein which has. That is, the method includes a culture step of culturing the transformant of the present invention described above and a recovery step of recovering the protein expressed in the culture step. Thus, by expressing in an appropriate host, mass production of the highly activating mutant of the present invention can be achieved at low cost.

  The culturing step is carried out by inoculating the transformant of the present invention in an appropriate medium and culturing according to a conventional method. For the culture of the transformant of the present invention, the culture conditions may be selected in consideration of the nutritional physiological properties of the host cells. The medium to be used is not particularly limited as long as it contains nutrients that can be assimilated by the host cell and can efficiently express the protein in the transformant. Therefore, a medium containing a carbon source, a nitrogen source and other essential nutrients necessary for the growth of the host cell is preferable, regardless of whether it is a natural medium or a synthetic medium.

  The culturing step is carried out by inoculating the transformant of the present invention in an appropriate medium and culturing according to a conventional method. For the culture of the transformant of the present invention, the culture conditions may be selected in consideration of the nutritional physiological properties of the host cells. The medium to be used is not particularly limited as long as it contains nutrients that can be assimilated by the host cell and can efficiently express the protein in the transformant. Therefore, a medium containing a carbon source, a nitrogen source and other essential nutrients necessary for the growth of the host cell is preferable, regardless of whether it is a natural medium or a synthetic medium. Examples of the carbon source include glucose, dextran, starch, and the like, and examples of the nitrogen source include ammonium salts, nitrates, amino acids, peptone, and casein. As other nutrients, inorganic salts, vitamins, antibiotics, and the like can be included as desired. When the host cell is Escherichia coli, LB medium, M9 medium and the like can be suitably used. Moreover, although there is no restriction | limiting in particular also about a culture | cultivation form, A liquid medium can be utilized suitably from a viewpoint of mass culture.

  When expressing the proteins shown in SEQ ID NOs: 4, 5, 25 and 27 shown as preferred examples of highly activating mutants in E. coli cells, it is preferable to carry out the culture conditions at a temperature of 20 ° C. or lower. The cells can be cultured at a low temperature that does not inhibit the growth and protein production of E. coli. For example, the culture is preferably performed within a range of 10 to 20 ° C, and particularly preferably performed within a range of 15 to 20 ° C.

  Selection of a host cell carrying the recombinant vector of the present invention can be performed by, for example, the presence or absence of expression of a marking sequence. For example, when a drug resistance gene is used as the marking sequence, it can be performed by culturing in a drug-containing medium corresponding to the drug resistance gene.

  The purification step may be performed by recovering, that is, isolating and purifying the highly activated mutant of the present invention from the transformant culture obtained in the above-described culture step. Depending on the fraction in which the highly activating mutant of the present invention is present, a technique according to a general protein isolation and purification method may be applied. Specifically, when the highly activating mutant of the present invention is produced outside the host cell, the culture solution is used as it is, or the host cell is removed by means of centrifugation, filtration, etc. Get. Subsequently, the protein of the present invention can be isolated and purified by appropriately selecting a known protein purification method for the culture supernatant. For example, known isolation and purification techniques such as ammonium sulfate precipitation, dialysis, SDS-PAGE electrophoresis, gel filtration, various types of chromatography such as hydrophobicity, anion, cation, and affinity chromatography can be applied alone or in appropriate combination. . In particular, when affinity chromatography is used, it is preferable to express the protein of the present invention as a fusion protein with a tag peptide such as a His tag and use the affinity for the tag peptide.

  On the other hand, when the highly activating mutant of the present invention is produced in a host cell, the host cell is recovered by means of centrifugation, filtration or the like. Subsequently, the host cells are disrupted by an enzymatic disruption method such as lysozyme treatment or a physical disruption method such as ultrasonic treatment, freeze-thawing, and osmotic shock. After crushing, the solubilized fraction is collected by means such as centrifugation or filtration. The obtained solubilized fraction can be isolated and purified by treating in the same manner as in the case of producing extracellularly.

  When the highly activated mutant of the present invention has high heat resistance in addition to high catalytic activity, it is useful and convenient to use heat treatment in the isolation and purification steps described above. The host cell and culture supernatant obtained from the culture contain various proteins derived from the host cell. However, the host cell-derived contaminating protein is denatured and condensed and precipitated by heat treatment. On the other hand, since a protein having high heat resistance is not generated, it can be easily separated from contaminating proteins derived from the host by centrifugation or the like. In addition, when the culture solution is used as it is or when a crude extract is used, other proteins are inactivated by heat treatment, so that the protein solution substantially contains only the desired highly activated mutant. Can be used as Thus, even when a highly activating mutant is produced by genetic engineering techniques, other proteins derived from the host can be easily removed. Therefore, there is an advantage that the degree of purification can be improved and a highly reliable protein can be produced.

  Then, confirmation of whether or not the purified highly active mutant has a mutation site in which a desired modification has occurred can be performed by analyzing its physicochemical properties and sequence. When analyzing physicochemical properties, the laccase activity of the obtained protein is measured by a known method, and it is performed by confirming whether the activity is improved as compared with wild-type MELAC that does not have a modified site. it can. Therefore, it can be carried out by measuring the oxidative activity for the phenolic compound as a substrate. The activity can be measured using any method known as a method for measuring the activity of an enzyme that catalyzes a redox reaction of a phenol compound. For example, ABTS can be used as a substrate, and measurement can be performed with the change in absorbance at 418 nm accompanying the oxidation reaction of the substrate, and the activity of the protein can be determined by the change in absorbance. Therefore, the oxidation rate of ABTS can be calculated from the rate of change in absorbance at 418 nm. In the case of sequence analysis, the amino acid sequence of the obtained protein can be performed by a known amino acid analysis method. For example, an automatic amino acid determination method based on Edman degradation can be used.

6). Utilization of Highly Activated Mutant of the Present Invention The highly activated mutant of the present invention has high laccase activity and can be used in various industrial fields. The mode of use will be described below, but is not limited thereto.

6-1. Enzyme electrode The highly activated mutant of the present invention can be used as a catalyst for an enzyme electrode. Preferably, it can be constructed by immobilizing the highly activated mutant of the present invention on a conductive substrate connected to an external circuit, and the constructed electrode can be used for a biobattery or a biosensor. it can.

Examples of conductive substrates include carbon materials such as graphite and glassy carbon, metals or alloys such as aluminum, copper, gold, platinum, silver, nickel, and palladium, SnO ₂ , In ₂ O ₃ , WO ₃ , TiO _2, etc. Conventionally known conductive materials such as conductive oxides can be used. Moreover, you may comprise this with a single layer or a 2 or more types of laminated structure. The size and shape of the electrode are not particularly limited, and can be appropriately adjusted according to the purpose of use.

  The N-terminal truncated high activation mutant of the present invention described above can be fixed in the form of direct electron transfer with the electrode in the pores of the porous material. It can be configured as an electrode having catalytic current performance. And there is also an advantage that the performance degradation of the N-terminal side cleavage type highly activated mutant of the present invention on the electrode can be reduced by filling the pores. That is, there is an advantage that the stability of the electrode is improved.

  Here, the porous material means a material having a large number of pores, and can be used without particular limitation as long as it is an electrically conductive (conductive) substance having a large number of pores on its surface. The porous material is preferably porous carbon, and carbon fine particles such as carbon gel are particularly preferable. Specifically, it is preferable that carbon fine particles such as carbon gel are applied to a conductive substrate such as carbon paper. As the conductive substrate, a known substrate as described above can be used. For example, it can be prepared by the method of Example 15. Here, the carbon gel is a porous carbon material formed by polymerization of resorcinol and formaldehyde, and is a conductive material having mesopores. Therefore, it is used as a catalyst carrier, a capacitor material, and a base material for an enzyme electrode of a bio battery. Is expected to be used.

  The size of the pores of the porous carbon is appropriately set according to the N-terminal truncated high activation mutant of the present invention to be immobilized. In other words, the pore size has an optimum value that matches the size of the protein to be immobilized, and if the pore size is smaller than the N-terminal truncated highly activated mutant of the present invention to be immobilized, the high activity The modified mutant cannot enter the pores and cannot achieve high density immobilization. On the other hand, if the pore diameter is larger than the N-terminally truncated highly activated mutant of the present invention, the highly activated mutant can enter the pore and perform an efficient electron transfer reaction with the electrode. The catalyst function can be exhibited. However, even when the pore diameter is too large, an extra space is formed between the fixed highly activated mutant and the electrode, which causes a problem such as a decrease in direct electron transfer efficiency, which is not preferable. That is, it is necessary that the site for transferring electrons on the enzyme contacts the porous carbon with appropriate orientation. Therefore, for example, in the case of the N-terminal truncated high activation mutant of SEQ ID NO: 25, the pore diameter may be 20 to 40 nm, preferably 20 to 35 nm, particularly 22 to 22.2 nm. The optimum pore diameter is 22.2 nm.

  The protein can be immobilized on the conductive substrate and the porous material by a known method. For example, it is possible to use a carrier binding method that is immobilized through physical adsorption, ionic bond, or covalent bond. For example, in the case of immobilization by physical adsorption, it can be simply immobilized by bringing a conductive substrate into contact with a solution containing the highly activated mutant of the present invention and drying it. Further, a crosslinking method in which crosslinking is performed with a crosslinking reagent having a divalent functional group such as glutaraldehyde can be used. Furthermore, polysaccharides such as alginic acid and carrageenan, conductive polymers, redox polymers, polymers having a network structure such as photocrosslinkable polymers, and a comprehensive method in which they are sealed in a semipermeable membrane such as a dialysis membrane Can also be used. Moreover, you may use combining these.

6-2. Bio Battery The highly activated mutant of the present invention can be used for the construction of a bio battery, and such a bio battery also forms part of the present invention. The biobattery of the present invention includes, for example, an anode side electrode that performs an oxidation reaction and a cathode side electrode that performs a reduction reaction, and includes an electrolyte layer that separates the anode side electrode and the cathode side electrode as necessary. Preferably, an electrode in which the highly active mutant of the present invention described in the section 6-1 is immobilized on a conductive base material connected to an external circuit is provided. Alternatively, the high activation mutant may be supplied in a form dissolved in an appropriate buffer. At the time of immobilization, the highly active mutant is preferably immobilized in the state of a holoenzyme containing a copper atom. However, it may be immobilized in the form of an apoenzyme and supplied as a separate layer or in a form dissolved in an appropriate buffer solution. In addition, substances necessary for the expression of the catalytic activity of other enzymes may be supplied as a separate layer or in a form dissolved in an appropriate buffer.

  And preferably, the electrode which fixed the highly activated variant on the electroconductive base material connected to the external circuit is constructed | assembled as a cathode side electrode. At the cathode side electrode, the activation mutant of the present invention catalyzes a reaction that accepts electrons from the anode side electrode and reduces oxygen to water. Specifically, it catalyzes a reaction that generates four water molecules by reducing four-electron molecular oxygen using electrons generated in the negative electrode.

  Preferably, the anode side electrode is a carbon electrode and is configured to directly exchange electrons between the carbon electrode and the highly activated mutant. Moreover, you may comprise so that a redox substance may be interposed between a carbon electrode and a highly activated variant. For example, an electrode on which an oxidoreductase such as glucose dehydrogenase is immobilized can be used as the anode side electrode. If necessary, an electron mediator that mediates enzyme reaction and electron transfer between electrodes is used. The mediator is not particularly limited, and examples thereof include quinones, cytochromes, viologens, phenazines, phenoxazines, phenothiazines, ferricyanides, ferredoxins, ferrocene and derivatives thereof.

  Since the biobattery of the present invention uses the highly activated mutant of the present invention having an excellent substrate catalytic ability to exhibit high laccase activity, the redox reaction on the cathode side electrode can be advanced with high efficiency. . As a result, the obtained electric energy increases, and high output and stable power generation becomes possible. This can improve the performance of the biobattery.

  As described above, the N-terminal cleavage type highly active mutant of the present invention can be fixed in a form that allows direct electron transfer with the electrode in the pores of the porous material, thereby allowing direct electron transfer type. It can be configured as an electrode having excellent catalytic current performance. And there is also an advantage that the performance degradation of the N-terminal side cleavage type highly activated mutant of the present invention on the electrode can be reduced by filling the pores. That is, the stability of the electrode is improved. Thereby, further high output and stable power generation becomes possible, and a high-performance and highly practical bio battery can be constructed.

6-3. Biosensor The highly activated mutant of the present invention can be used to construct a biosensor, and such a biosensor also forms part of the present invention. The biosensor of the present invention includes an electrode in which the highly activated mutant described in Section 6-1 is immobilized on a conductive base material connected to an external circuit. For example, this electrode is used as a working electrode serving as a substrate recognition site, and its counter electrode is provided. If necessary, from the viewpoint of improving the reliability of measurement accuracy, a three-electrode system provided with a reference electrode such as silver-silver chloride may be used. By comprising in this way, any compound used as the substrate of laccase can be detected. In particular, it can be preferably used for detection of phenol compounds, and can be practically used as a phenol sensor.

  In addition, the above-mentioned N-terminal cleavage type highly active mutant of the present invention can be fixed in a form that allows direct electron transfer with the electrode in the pores of the porous material, thereby enabling direct electron transfer type. It can be configured as an electrode having high catalytic current performance. And the biosensor provided with this electrode is also included as a part of this invention, and can contribute to the further performance improvement of a biosensor.

  In the measurement by the biosensor of the present invention, the test sample is brought into contact with the sensor, and the change caused by the oxidation reaction of the highly activated mutant of the present invention and the substrate on the electrode is converted into an electric signal and detected. Is done. By processing the obtained electrical signal, the presence or concentration of the substrate in the test sample can be measured. At this time, by preparing a standard curve prepared in advance with a substrate solution having a standard concentration within the target concentration range, the substrate concentration can be determined based on the obtained current value. Here, as a sample, all samples in which the presence of a substrate is expected can be targeted. Examples include biological samples derived from organisms such as blood, urine, saliva, food samples, environmental samples such as soil, river water, lake water, seawater, and the like, but are not limited thereto. Moreover, the sample which performed the appropriate process to these samples as needed may also be included. The biosensor of the present invention can be used to detect all substances that can serve as a substrate for laccase. Furthermore, since the biosensor of the present invention uses the highly activated mutant of the present invention having excellent substrate catalytic ability to exhibit high laccase activity, the redox reaction proceeds with high efficiency on the working electrode, As a result, the detection sensitivity can be improved by increasing the output of the electric signal. Thereby, a biosensor with high performance and high practicality can be constructed. Therefore, it can be used in various industrial fields such as medical, food and environmental fields.

6-4. Method for Detecting Phenol Compounds The highly activated mutant of the present invention can be used for detection of all compounds that can serve as a substrate for laccase in a sample. In particular, it can be used for the detection of phenol compounds. The detection of the phenol compound can be performed by measuring a change in activity with respect to the phenol compound to be detected. The activity can be measured using any method known as a method for measuring the activity of an enzyme that catalyzes a redox reaction of a phenol compound. For example, the highly activated mutant of the present invention can be reacted with a sample to be measured, the change in absorbance associated with the oxidation reaction of the phenol compound can be measured, and the presence of the phenol compound can be detected based on the change in absorbance. Once appropriate test conditions have been selected, this change in absorbance is linearly proportional to the enzyme activity to be measured. Therefore, by preparing a standard curve in advance with a phenol compound solution having a standard concentration within the target concentration range, the phenol compound concentration can be determined based on the obtained absorbance change value.

  Here, as a test sample, all samples in which the presence of a compound that can be a substrate of an enzyme having laccase activity, such as a phenol compound, can be used. For example, biological samples derived from organisms such as blood, urine and saliva, food samples, environmental samples such as water such as soil, rivers, lakes, and seawater are not limited thereto. Moreover, the sample which performed the appropriate process to these samples as needed may also be included. In particular, since the highly activated mutant of the present invention has an excellent substrate catalytic ability, an oxidation-reduction reaction with respect to a substrate as a measurement target substance is performed with high efficiency. As a result, the detection sensitivity is improved, and the sample can be analyzed with high accuracy. That is, the measurement accuracy can be improved, and the amount of laccase used can be reduced, so that a cost reduction effect can be achieved.

EXAMPLES Hereinafter, although an Example demonstrates this invention further more concretely, this invention is not limited to these Examples at all.
In addition, Examples 1-11 describe the invention relevant to the protein which has the laccase activity which has the amino acid sequence shown to sequence number 4 and 5. Examples 12 to 19 describe inventions relating specifically to proteins with laccase activity having the amino acid sequences shown in SEQ ID NOs: 25 and 27. However, it is not intended that the present invention be limited to these examples.

[Example 1] Enzyme modification using molecular evolution engineering technique Random mutations were introduced into wild-type laccase to search for highly active mutants using an enzyme modification technique called molecular evolution engineering technique. . Here, as the wild-type laccase, the amino acid sequence of SEQ ID NO: 22 obtained by binding a His tag to the wild-type MELAC having the amino acid sequence of SEQ ID NO: 2 (FIG. 1B) was used as a base for modification as a wild-type MELAC.

Step 1: Construction of protein expression plasmid of wild type MELAC gene The gene encoding wild type MELAC was cloned into the multicloning site NdeI / HindIII of the E. coli protein expression vector pET-22b (+) to construct a protein expression plasmid. The gene encoding wild type MELAC used here has the base sequence shown in SEQ ID NO: 21 encoding the amino acid sequence of SEQ ID NO: 22.

Step 2: Construction of mutant gene library In order to prepare a mutant gene library of wild-type MELAC, random mutations were introduced into the wild-type MELAC gene using error-prone PCR. Specifically, in order to promote the frequency of mistaken nucleotide incorporation of DNA polymerase, the magnesium concentration and the manganese concentration are adjusted to [Mg, Mn] = [5, 0.5] mM, and 1 to A library into which two mutations were introduced was prepared. Error-prone PCR reaction conditions were as follows: 50 μl reaction system, 2.5 unit Taq DNA polymerase (manufactured by Takara Bio Inc.), 0.5 μM primer 1 and primer 2, 10 mM Tris-HCl buffer (pH 8.3), 50 mM KCl, 5.0 mM MgCl ₂ and 0.5 mM MnCl ₂ were mixed to prepare a reaction solution. In the PCR reaction temperature program, the reaction at 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was set as one cycle, and this was performed for 30 cycles.

  Next, an overlapping PCR method was performed in order to link the gene fragment into which the random mutation was introduced and the gene fragment into which the mutation was not introduced. Specifically, in order to obtain a gene fragment that is not mutagenized, PCR amplification was performed using the expression vector prepared in step 1 as a template and using primer 3 and primer 4. Here, as PCR reaction conditions, PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.) was used, and the primer concentration was adjusted to 0.2 μM for each. In the PCR reaction temperature program, a reaction at 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was defined as one cycle, and this was performed for 20 cycles. Subsequently, the amplified fragment was purified using a DNA purification kit (GE Healthcare). PCR amplification was performed using Primer 2 and Primer 3 using both the obtained gene fragment with mutation introduced and the gene fragment without mutation introduced as a template. After amplification, the amplified fragment was purified using a DNA purification kit (GE Healthcare). Subsequently, PCR amplification was performed using the primer 5 and the primer 6 in order to add a primer sequence for single molecule PCR to both ends of the obtained DNA fragment encoding the MELAC gene. After amplification, the amplified DNA fragment was purified using a DNA purification kit, and TE Buffer was added to obtain a DNA solution. Thus, in the gene encoding wild-type MELAC, the amino acid region Ile250? A mutant gene library was prepared by introducing random mutations into the base sequence corresponding to Leu500.

The base sequence information of the primer used here is shown.
Primer 1: 5'-GCCAACAAACCAGCAGAATCCGGATAACCTGGTGCGCACG-3 '(SEQ ID NO: 6)
Primer 2: 5'-TCCGGATATAGTTCCTCCTTTCAG-3 '(SEQ ID NO: 7)
Primer 3: 5'- ATCTCGATCCCGCGAAATTAATAC -3 '(SEQ ID NO: 8)
Primer 4: 5'-CGTGCGCACCAGGTTATCCGGATTCTGCTGGTTTGTTGGC-3 '(SEQ ID NO: 9)
Primer 5: 5′-GGAGCTAGGGTTTACGAGTGGAATG-ATCTCGATCCCGCGAAATTAATAC -3 ′ (SEQ ID NO: 10)
Primer 6: 5′-GGAGCTAGGGTTTACGAGTGGAATG-TCCGGATATAGTTCCTCCTTTCAG -3 ′ (SEQ ID NO: 11)

Step 3: Construction of mutant protein library The DNA solution of the mutant gene library obtained in Step 2 above is diluted with TE Buffer containing 0.5% blue dextran, and the DNA solution has a concentration of 1.5 DNA molecules / μl (calculated). Was made. Next, in order to perform single molecule PCR amplification, the diluted DNA solution was dispensed into a 384 well PCR plate, and PCR amplification was then performed using primer 7. In the PCR reaction temperature program, the reaction at 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was set as one cycle, and this was performed for 70 cycles.

Next, using the obtained amplified DNA fragment as a template, a mutant protein library was prepared by a cell-free protein synthesis system of E. coli. Specifically, 5 μl was dispensed into each well of a 384 well plate, followed by 1.5 μl of the PCR reaction solution. Then, using a commercially available cell-free protein synthesis system (Rabbit Translation System: RTS 100, E.coli HY Kit), in accordance with the manufacturer's instructions, reaction time of 4 hours, reaction temperature of 30 ° C, 384-well plate The protein synthesis reaction was performed in the inside. Next, in order to activate (holoform) the synthesized protein (apo-type), 15 μl of 1 mM CuSO ₄ solution was added to 8 μl of protein synthesis solution and reacted at 4 ° C. for 4 hours.

The base sequence information of the primer used here is shown.
Primer 7: 5'-GGAGCTAGGGTTTACGAGTGGAATG-3 '(SEQ ID NO: 12)

Step 4: Measurement of laccase activity and selection of highly activating mutants The proteins synthesized in Step 3 and screened for laccase activity were screened. For the measurement of laccase activity, 80 μl of an activity measurement solution was first prepared with 50 mM phosphate buffer pH 7, 1.0 mM ABTS, 1.0 mM CuSO ₄ and dispensed into a 384 well plate. Subsequently, 2 μl of protein synthesis solution was added to each well and laccase activity was measured. The measurement was performed by a colorimetric method in which ABTS was used as a substrate and the change in absorbance at 418 nm accompanying the oxidation of the substrate was measured with a plate reader.

  Here, the number of base mutations, the number of amino acid mutations, and the amino acid mutation sites of the mutants produced in this example are shown in Table 1 below. In the “amino acid mutation site” in the table, for example, “R287H” indicates that the 287th arginine (R) in SEQ ID NO: 22 which is the amino acid sequence of wild-type MELAC is replaced with histidine (H). Represent. In the present specification, amino acid positions are numbered with 1 being the initiation codon methionine.

  The screening results are shown in FIG. As a result, it was found that a mutant exhibiting higher laccase activity than wild type MELAC could be obtained. In particular, the mutant designated as “mutant No. 3” in Table 1 showed 3.43-fold laccase activity as compared to wild-type MELAC. This mutant No. 3 has mutations Q255R and M308R as shown in Table 1. And at the gene level, it has 764; A-> G, 923; T-> G nucleotide mutations. Here, in the nucleotide mutation, for example, the notation “764; A-> G” is obtained by replacing the 764th adenine (A) in SEQ ID NO: 1, which is the base sequence of wild-type MELAC, with guanine (G). Represents that. The nucleotide sequence of mutant No. 3 obtained here and its deduced amino acid sequence are shown in SEQ ID NOs: 3 and 4, and FIGS. 1C and D, respectively.

[Example 2] Preparation of protein expression plasmid For producing recombinant protein by transforming the gene encoding wild-type MELAC or MELAC mutant obtained in Example 1 into E. coli and expressing it in E. coli cells An expression plasmid was prepared.

  For protein expression, a gene encoding a wild-type MELAC or MELAC mutant was cloned into a multicloning site of an E. coli protein expression vector pET22b so as to be expressed as a protein having a His tag fused to the C-terminus of the protein. Subsequently, this expression plasmid was transformed into E. coli BL21 (DE3) pLysS, and a gene transfer plasmid was selected.

  Specifically, specific primers 8 and 9 for the partial sequences of the gene obtained in Example 1 (5 ′ end sequence end encoding N-terminal region and 3 ′ end sequence encoding C-terminal region) were used. PCR amplification was performed. The obtained amplification product is subjected to agarose gel electrophoresis for analysis and purification. The purified DNA fragment is cloned into the multi-cloning site (NdeI-HindIII) of the E. coli expression vector pET22b Vector, a cloning kit (In-Fusion Advantage PCR cloning kit). A homologous sequence (15 bases: 15 bases on each 5 ′ side) set at the end of the vector and the insert is underlined. At this time, except for the stop codon at the C-terminus of the laccase gene, cloning into the NdeI / HindIII site of pET22b and fusion with a peptide containing histidine on the C-terminal side (LAAALEHHHHHH (SEQ ID NO: 13): HHHHHH is a His tag) A protein expression plasmid was constructed. This was transformed into E. coli DH5α strain, and a gene transfer plasmid was selected.

The base sequence information of the primer used here is shown.
Primer 8: 5'-GAAGGAGATATACATATGGAAGATTCCAGACGGCATGG -'3 (SEQ ID NO: 14)
Primer 9: 5'-GAGTGCGGCCGCAAGCTTCACAACCTCGATGATGCCCA -'3 (SEQ ID NO: 15)

[Example 3] Protein expression and purification in E. coli The protein expression plasmid selected in Example 2 was transformed into E. coli and expressed in E. coli cells to produce recombinant proteins.

The protein expression plasmid selected in Example 2 was transformed into E. coli BL21 (DE3) pLysS strain. Subsequently, Escherichia coli into which the protein expression plasmid was introduced was cultured, and by adding isopropyl 1-thio-β-D-galactopyranoside (isopropyl thio-β-galactoside: hereinafter abbreviated as “IPTG”), The fusion protein was induced and expressed. Specifically, Escherichia coli was cultured at 37 ° C. until the absorbance OD ₆₀₀ reached about 0.2, and further 0.1 mM IPTG and 0.5 mM CuCl ₂ were added and cultured at 20 ° C. for 20 hours. After culturing, E. coli was collected by centrifuging the culture solution and frozen until the next experiment.

The bacterial cells expressing the protein were suspended in 10 mM Tris-HCl buffer, 1 mM EDTA, pH 7.4, 0.4% surfactant (Brij58) was added, and the mixture was left on ice for 30 minutes. Next, the cells were crushed with an ultrasonic cell crusher, and the cell lysate was centrifuged at 40,000 × g for 30 minutes to remove insoluble matters by centrifugation, and the cell lysate was collected. Next, the obtained cell lysate was purified with a metal affinity carrier for purifying histidine tag fusion protein (TALON: manufactured by Clontech). Specifically, an appropriate amount of support is packed in an open column, pre-washed with 20 mM sodium phosphate, 5 mM imidazole, and 0.5 M NaCl solution, and the final concentration of the cell lysate obtained above is 0.5 M. NaCl was added and applied to the column. Subsequently, after washing with 20 mM sodium phosphate, 10 mM imidazole, 0.5 M NaCl solution, the protein was eluted with 20 mM sodium phosphate, 150 mM imidazole, 0.5 M NaCl solution. After elution, the eluate was dialyzed overnight using 25 mM Tris-HCl buffer (pH 7.4) and 1 mM CuCl ₂ as external solutions. Thereby, removal of salts such as imidazole and NaCl used for elution, and incorporation of copper ions into the protein can be carried out.

[Example 4] Comparison of laccase activity of each mutant In Example 3, the 16 MELAC mutants obtained in Example 1 were recombinantly synthesized by transforming into E. coli. Subsequently, in this example, the laccase activity of each mutant was measured, and the activities were compared.

  The 16 MELAC mutants obtained in the screening of Example 1 were expressed and purified as recombinant proteins based on the methods of Examples 2 and 3, respectively. In order to confirm protein expression and purification, a protein lysate was added to an appropriate amount of the obtained purified protein, heat treated at 95 ° C., and then subjected to electrophoresis on 12.5% acrylamide gel (CBB staining method ( The protein was visualized by Wako Pure Chemical Industries). The results are shown in FIG. As a result, both the wild-type MELAC and mutant No. 3, which is one of 16 mutants, confirmed a single band of protein, indicating that protein purification was successfully completed. The purified protein obtained here was used for the following confirmation experiment of laccase activity.

The laccase activity was measured according to the method in Step 4 of Example 1. Specifically, first, 200 μl of an activity measurement solution was prepared with 50 mM phosphate buffer, 3.0 mM ABTS, and 1.0 mM CuSO ₄ . At this time, three types of phosphate buffers with pH 6.0, 6.5 and 7.0 were prepared. This was performed by adding 1.0 μg of the purified protein prepared above to the activity measurement solution and measuring the laccase activity. In the measurement, ABTS was used as a substrate, and the amount of change in absorbance at 418 nm per unit time due to the oxidation reaction of the substrate was measured.

  The results of measuring the laccase activity of each mutant are shown in FIG. It is the result of comparing the relative activity change in each mutant with the value of laccase activity of wild-type MELAC under each pH condition being 1. From this result, it was confirmed that mutant No. 3 had a specific activity that was about 3 times higher than that of wild-type MELAC, and that this activity improvement was confirmed under all pH conditions examined. Therefore, it was found that mutant No. 3 is a highly active mutant of wild-type MELAC. For the five mutants (mutant Nos. 6, 7, 12, 14, and 15) whose measurement results are not shown in the figure, protein expression and purification were successful, but laccase activity was almost the same. It was found to disappear.

[Example 5] Mutant activity confirmation 1-pH dependency Mutant No. 3 confirmed to be a highly activating mutant of wild-type MELAC was confirmed for laccase activity at each pH.

The laccase activity at each pH of wild type MELAC purified in Example 3 and mutant No. 3 were compared. The laccase activity was measured according to the measurement methods of Examples 1 and 4. Specifically, first, a 200 μL activity assay solution containing 50 mM buffer adjusted to pH 3.5 to 8, 3.0 mM ABTS, 1.0 mM CuSO ₄ was prepared. As the buffer solution, sodium acetate buffer was used for pH 3.5 to 5.5, sodium phosphate buffer was used for pH 5.5 to 7.0, and Tris-HCl buffer was used for pH 7.5 to 8.0. Subsequently, 0.1 μg of wild-type MELAC and mutant No. 3 were added to the activity measurement solution, and laccase activity was measured. The measurement was performed by calculating the specific activity value from the amount of change in absorbance at 418 nm per unit time (1 minute) associated with the oxidation reaction of the substrate using ABTS as a substrate. Specifically, the amount of enzyme that oxidizes 1 μmol of ABTS per minute was determined by calculating the amount of ABTS oxidized with a molar absorbance coefficient of ABTS of 36,000 / M / cm.

  As a control, specific activity values were calculated in the same manner for bilirubin oxidase (manufactured by Amano Enzyme Co., Ltd .: hereinafter “Mv.BO”).

  The measurement results of laccase activity are shown in FIGS. 5A and 5B. FIG. 5A shows the results of measuring laccase activity at pH 3.5 to 5.5 using sodium acetate Buffer as a buffer. On the other hand, FIG. 5B shows the results of measuring laccase activity at pH 5.5 to 7.0 using sodium phosphate buffer as a buffer, and the results of measuring laccase activity at pH 7.5 to 8.0 using Tris-HCl buffer. In the figure, the results of wild-type MELAC are indicated by white circles, the results of mutant No. 3 are indicated by black circles, and the results of Mv. BO are indicated by white triangles. From these results, it was found that the specific activity of mutant No. 3 was improved under any of the pH conditions examined in comparison with wild-type MELAC.

[Example 6] Mutant activity confirmation 2-Effect on activity improvement of mutation introduction site Mutation introduction site in Mutant No. 3 confirmed to be a highly activated mutant of wild-type MELAC improves activity The effect was examined.

  Mutant No. 3 has two amino acid mutations (Q255R, M308R). In order to examine the effect of these amino acid mutations on the activity improvement, mutants each having only one amino acid mutation were prepared. That is, a mutant in which the 255th glutamine of amino acid sequence 2 representing wild-type MELAC was replaced with arginine (hereinafter referred to as “mutant Q255R”: SEQ ID NO: 16), and the 308th methionine was replaced with arginine. It is a mutant (hereinafter referred to as “mutant M308R”, SEQ ID NO: 5). These laccase activities were measured and compared with wild type MELAC and mutant No. 3. Specifically, in order to prepare two mutants, primer 10 and primer 11 encoding amino acid mutation Q255R, primer 12 and primer 13 encoding amino acid mutation M308R were prepared. Subsequently, using the site-directed mutagenesis kit (PrimeSTAR Mutagenesis Basal Kit: manufactured by Takara Bio Inc.), according to the reaction protocol by the manufacturer, the wild-type MELAC protein expression plasmid prepared in Step 1 of Example 1 was used as a template. Mutation was introduced by PCR amplification using the primers prepared above.

The base sequence information of the primer used here is shown.
Primer 10: 5'-CAGTTGCGGCCGACCATCCGCATGCGA -'3 (SEQ ID NO: 17)
Primer 11: 5'-GGTCGGCCGCAACTGGCCGTTGATCGT -'3 (SEQ ID NO: 18)
Primer 12: 5'-CAGCTGAGGATGGGGCCGGGAGAGCGC -'3 (SEQ ID NO: 19)
Primer 13: 5'- CCCCATCCTCAGCTGGAAATCGGACAC -'3 (SEQ ID NO: 20)

  Decoding the nucleotide sequence of the mutant gene prepared, the 255th glutamine of the amino acid sequence of wild-type MELAC is arginine (mutant Q255R: SEQ ID NO: 16), and the 308th methionine of the amino acid sequence is arginine ( It was confirmed that the mutant M308R was substituted with SEQ ID NO: 5). Next, protein expression plasmids of mutant Q255R and mutant M308R were prepared by the method according to Example 2 using the obtained mutant gene. Subsequently, protein expression and purification were performed in the same manner as in Example 3. And like the method of Example 4, protein expression and purification were confirmed.

  The obtained purified protein was subjected to electrophoresis and the result of visualizing the protein by CBB staining is shown in FIG. In FIG. 6, lane 1 is wild-type MELAC, lane 2 is mutant No. 3, lane 3 is mutant Q255R, lane 4 is mutant M308R, and lane 5 is a molecular weight marker for protein. As a result, a single band of the protein could be confirmed in any case, indicating that the protein purification was successfully completed. The purified protein obtained here was used for the following confirmation experiment of laccase activity.

  Next, laccase activity was compared using the same amount of these purified proteins. The laccase activity was measured by the same method as in Example 4. Four types of phosphate buffers with pH 5.5, 6.0, 6.5, and 7.0 were prepared as buffer solutions.

  The result of the laccase activity measurement of each mutant is shown in FIG. The value of laccase activity of wild-type MELAC under each pH condition was set to 1, and the change of relative activity in each mutant was compared. Moreover, the result of having measured the laccase activity without adding any protein as control is shown. From this result, both the mutant No. 3 and the mutant M308R were confirmed to have an improvement in specific activity of about 2 to 3.5 times that of the wild-type MELAC. On the other hand, mutant Q255R was less active than wild-type MELAC. From this, it was found that both the two amino acid mutations of mutant No. 3 did not affect the activity improvement, but only amino acid mutation M308R contributed to the improvement of the specific activity. And this activity improvement showed the same tendency under all pH conditions examined. In other words, it can be derived that among about 500 amino acids forming the MELAC three-dimensional structure, only one amino acid affects the improvement of the specific activity.

[Example 7] Mutant activity confirmation 3-Substrate concentration dependency Two amino acid mutations of mutant No. 3 confirmed to be a highly activating mutant of wild-type MELAC and mutant No. 3 The laccase activity at each substrate concentration of mutant M308R having only one mutation was confirmed.

In the mutant No. 3 purified in Example 4 and the mutant purified in Example 6 (mutant M308R), the influence of the substrate concentration on the reaction rate was examined. ABTS was used as a substrate. The laccase activity was measured according to the method of Step 4 of Example 1 and Examples 4-6. Specifically, first, 200 μl of an activity measurement solution was prepared with 50 mM phosphate buffer (pH 6.0), ABTS, and 0.5 mM CuSO ₄ . At this time, the substrate ABTS was prepared in a range of 0 to 2000 μM and in the range of 1000 to 4000 μM. 0.3 μg of wild-type MELAC, 0.1 μg of mutant No. 3, and 0.1 μg of mutant M308R were added to the activity measurement solution, respectively, and the laccase activity was measured. In the measurement, ABTS was used as a substrate, and the amount of change in absorbance at 418 nm per unit time due to the oxidation reaction of the substrate was measured.

  The measurement results of laccase activity are shown in FIGS. 8A and 8B. FIG. 8A shows the results of measuring laccase activity within a substrate concentration range of 0 to 2000 μM. On the other hand, FIG. 8B shows the results of measuring laccase activity within a substrate concentration range of 1000 to 4500 μM. In the figure, the result of mutant No. 3 is indicated by ●, the result of mutant M308R is indicated by ■, and the result of wild type MELAC is indicated by ◯. From these results, it was found that the activity of wild-type MELAC increased in a concentration-dependent manner up to a substrate concentration of 5000 μM, and that the affinity of the substrate did not change significantly from that of the wild-type depending on the amino acid mutation of the mutant.

[Example 8] Estimation of activity improvement mechanism of mutant No. 3 The activity improvement mechanism of mutant No. 3 was estimated based on a three-dimensional structure analysis.

  For the amino acid sequence of wild-type MELAC based on the modification of mutant No. 3, a homology search was performed on a protein group with a known three-dimensional structure. As a result, the homology with the thermostable laccase derived from Thermus thermophilus (PDB ID; 2XU9) was the highest and was 32%. Therefore, a three-dimensional structure model of wild-type MELAC was constructed by homology modeling using Discovery studio 3.0 (manufactured by Accelrys) using the thermostable laccase derived from Thermus thermophilus as a reference structure. FIG. 9A shows a wild-type MELAC conformation model, showing the position of the mutation site (M308) and type I copper in a ball & stick display. As a result, it was speculated that there was no mutation site near the type 1 copper in the electron accepting site. In addition, since this structural model was constructed based on the thermostable laccase derived from Thermus thermophilus, there is no amino acid sequence corresponding to wild-type MELAC, and about 50 to 57th amino acid sequence on the N-terminal side ( The structure corresponding to FIG. 12) is not shown.

  FIG. 9B shows the position of the putative binding pocket on the three-dimensional structure of Myrothecium verrucaria-derived bilirubin oxidase (hereinafter abbreviated as “Mv.BO”), which is a similar enzyme to laccase. This is based on the description of the Mv.BO three-dimensional structure (Cracknell, JA, et al., Dalton Trans, 40, 6668-6675 (2011)). Shown in stick display.

  Next, FIG. 9C shows a diagram in which main chains are superimposed on FIGS. 9A and 9B based on sequence alignment. According to this, M308 on wild-type MELAC was not in the vicinity of type I copper, but was located in the vicinity of the amino acid group presumed to be involved in the substrate binding of Mv.BO. From the above, it was speculated that the mutation in M308R may cause a change in electron transfer, and as a result, the activity in the neutral region was improved.

[Example 9] Sequence identification of wild-type MELAC subspecies The amino acid sequence of a wild-type MELAC sub-species is specified, and it is examined whether or not mutant No. 3 is included in a naturally-occurring wild-type MELAC sub-species. did.

  It is known that naturally occurring proteins have many subspecies having different amino acid sequences due to slight differences in the base sequences encoding the proteins. Therefore, a wild-type MELAC subspecies was compared with a metagenomic sample (see Japanese Patent Application Laid-Open No. 2011-87474) from an environmental sample from which wild-type MELAC was isolated (compost collected from Midori-ku, Chiba City). We searched for. Specifically, wild-type MELAC subspecies was obtained by PCR amplification using the metagenomic sample as a template. And the sequence of the obtained subspecies was specified.

  The results of specifying the amino acid sequence of the wild-type MELAC subspecies are shown in FIGS. 10A, 10B, and 10C. In the figure, amino acid residues homologous to wild-type MELAC are boxed. As a result, the 308th amino acid residue, which is the mutation introduction site of the mutant M308R confirmed to be highly active, was not mutated in the subspecies identified this time. Therefore, it was found that the mutant M308R is very likely to be a protein that is not contained in this subspecies and is not found in nature.

[Example 10] Activity confirmation of mutant 4-Reaction rate Among two amino acid mutations of mutant No. 3 confirmed to be a highly activated mutant of wild-type MELAC and mutant No. 3 The reaction rate constants of mutant Q255R and mutant M308R having only one mutation were determined.

  In the mutant No. 3 purified in Example 4 and the mutants purified in Example 6 (mutant Q255R, mutant M308R), the substrate concentration was changed, and the Line Weber-Burk plot of the initial rate of the enzyme reaction Thus, rate constants (Km, Vmax, kcat) of the enzyme reaction were obtained. ABTS was used as a substrate, and the rate constant for ABTS at 25 ° C. and pH 6.0 was determined.

  As a result, the Km for ABTS of wild-type MELAC was 400 μM, Vmax was 13 U / mg protein, and kcat was 691. Further, Km for mutant No. 3 was 400 μM, Vmax was 52 U / mg protein, and kcat was 2853. Km for mutant Q255R was 400 μM, Vmax was 17 U / mg protein, and kcat was 934. Km for the mutant M308R was 400 μM, Vmax was 61 U / mg protein, and kcat was 3384. As a result, it was found that the Vmax was improved about 4 to 5 times by the mutation of M308R.

[Example 11] Confirmation of activity of mutant 5-Comparison of electrocatalytic activity by electrochemical measurement of enzyme-immobilized electrode using mutant M308R confirmed to be a highly activating mutant of wild-type MELAC as an electrode catalyst The catalytic function was evaluated by electrochemical measurement and compared with wild-type MELAC.

Assuming the use of mutant M308R as an electrocatalyst for biocells, an enzyme-immobilized electrode was prepared and its catalytic function was evaluated by comparison with wild-type MELAC. The biobattery was constructed using a round carbon electrode (model name DEP-EP-N, manufactured by Biodevice Technology Co., Ltd.). Specific specifications are: 3 electrode system: immobilization printing electrode, working electrode material: carbon, dimensions: 12.5 × 4 mm × t0.3, working electrode area 2.64 mm ² , sample amount: 20-40 μl. The immobilization method was selected by a method using a photocrosslinkable polymer to prepare an enzyme-immobilized electrode. Specifically, using the enzyme immobilization kit (manufactured by Toyo Gosei Co., Ltd.), which is the optimal experimental kit for the initial investigation of electrochemical detection biosensors, according to the manufacturer's reaction protocol, Immobilized. At this time, 50 μg of the mutant M308R and wild type MELAC were immobilized. Subsequently, the enzyme-immobilized electrode was evaluated using a potentiostat. For the reaction conditions, the reaction mixture was prepared in 50 mM phosphate buffer pH 6.0, 1.0 mM CuSO ₄ , 4.0 mM ABTS, enzyme-immobilized electrode as working electrode, counter electrode (carbon) and reference electrode (silver silver chloride) ) Was immersed in the reaction mixture, and the current response accompanying the reduction reaction of the mediator ABTS (redox potential: 0.5 V) was measured. As a control, the current response was measured in the same manner with respect to an electrode prepared without adding any protein.

Then, the following current response occurs on the enzyme-immobilized electrode to generate a current.
4ABTS + O ² + 4H ⁺ → 4ATBS ・-+ 2H ₂ O
ATBS · ^- + e - → ATBS

The CA measurement conditions for the potentiostat are shown below.
Init E (V) = 0 (open circuit potential),
・ High E (V) = +0.1, Low E (V) = 0
Init P / N = N,
・ Step = 1,
・ Pulse Width (sec) = 30,
・ Sample Interval (s) = 0.01,
Quiet Time (sec) = 2

  The measurement result of the current response is shown in FIG. From these results, it was confirmed that by using the mutant M308R as an electrode catalyst, a higher catalyst current value can be obtained than when wild type MELAC is used. Therefore, it was found that the mutant M308R is very useful as an electrocatalyst for a bio battery.

[Example 12] Examination of enzyme modification In this example, studies were made to add further enzyme modification to the wild-type MELAC highly activating mutant obtained in the above Example.

  As a basis for modification, the mutant M308R confirmed to be a highly activating mutant of wild-type MELAC in the above example was used. First, in the amino acid structure of mutant M308R, a region capable of being deleted without reducing the catalytic activity was selected. Specifically, Thermus thermophilus has the highest amino acid sequence homology with the mutant (approximately 32% homology), and an amino acid important for catalytic activity has been found by X-ray structural analysis. The amino acid sequence was compared with the heat-resistant laccase derived from the HB27 strain (PDB ID: 2XU9, amino acid homology 32%).

  The results of amino acid sequence comparison are shown in FIG. In the figure, the arrows indicate the positions of amino acids important for catalytic activity. The active center amino acid indicated by the arrow is roughly divided into four regions, each coordinating a copper ion. Deletion of the vicinity of these 4 regions may cause a decrease in activity. Therefore, it is considered that about 120 of the amino acids on the N-terminal side or about 180 of the central region can be considered as candidates for deletion studies because deletion does not affect the catalytic activity. It was. However, in the central region, since it is difficult to optimize the structure in the missing space after deletion, the N-terminal amino acid was considered. Therefore, the following experiment was conducted on the assumption that the catalytic activity could be maintained even if about 100 amino acids on the N-terminal side of mutant M308R were deleted.

  And the prediction result of the structural change by deleting this N terminal amino acid is shown in FIG. As for the construction conditions of the structural model constructed here, the thermostable laccase (PDB ID: 2XU9) derived from Thermus thermophilus, which was compared in the above using Discovery studio 3.0 Homology modeling as analysis software, is the reference structure And a structural model was constructed with distance constraints for copper-bonded amino acids. Then, this structural model was compared with the structural model of mutant M308R constructed in the same manner. Here, the structural model of mutant M308R was estimated including the structure of the portion corresponding to the amino acid sequence on the N-terminal side that was not clearly disclosed in FIG. 9A.

  From this comparison result, the N-terminus of mutant M308R has a so-called swaying amino acid loop structure that oscillates for a long time, and it is estimated that mutant M308R-Del68 has a structure in which the loop structure has been deleted. It was done. And it was suggested that such a loop structure may interfere with direct electron transfer with the electrode via Type I copper.

[Example 13] Production of modified enzyme In this example, based on the examination result of the enzyme modification of Example 12 above, a mutant obtained by adding a further enzyme modification to a highly activated mutant of wild-type MELAC was produced. .

  As a modified enzyme, a mutant in which 40 consecutive amino acids from the N-terminus of mutant M308R have been deleted (SEQ ID NO: 27, hereinafter referred to as “mutant M308R-Del41”, methionine corresponding to the start codon is added), Mutant in which 68 amino acids on the N-terminal side are deleted (SEQ ID NO: 25, hereinafter referred to as “mutant M308R-Del68”, methionine corresponding to the start codon is added), and 77 amino acids on the N-terminal side (SEQ ID NO: 28, hereinafter referred to as “mutant M308R-Del77”. Added methionine corresponding to the start codon). The construction of mutant 68M308R-Del68 from mutant M308R is shown in FIGS.

Step 1: Construction of expression plasmid
Using a gene amplification method by PCR, a DNA fragment encoding the modified enzyme was prepared. Specifically, PCR amplification was performed using an expression vector into which the mutant M308R gene was inserted as a template. The sequence information of the primers used here is as follows.

Primer for M308R-Del41 preparation Primer 14: 5'-CATATGTATATCTCCTTCTTAAAGTTAAAC-3 '(SEQ ID NO: 29)
Primer 15: 5'-GAAGGAGATATACATATG-CACCACTCCCACGATGCCACGCCAGTGTCT-3 '
(SEQ ID NO: 30)
Primer for M308R-Del68 preparation Primer 14: 5'-CATATGTATATCTCCTTCTTAAAGTTAAAC-3 '(SEQ ID NO: 29)
Primer 16: 5'-GAAGGAGATATACATATG-GGGCAGGATCTGGTTCAGCCCGAAATGAGG-3 '
(SEQ ID NO: 31)
Primer for M308R-Del77 preparation Primer 14: 5'-CATATGTATATCTCCTTCTTAAAGTTAAAC-3 '(SEQ ID NO: 29)
Primer 17:
5'-GAAGGAGATATACATATG-AGGGAAAGCATCGATGGCGTGCTTGAAACC-3 '
(SEQ ID NO: 32)

  The obtained PCR amplified DNA fragments were separated by agarose electrophoresis, cut out from the gel and purified. The obtained DNA fragment contains a sequence homologous to the both end sequences of the 18 bp E. coli expression vector pET22b (NdeI-HindIII cleavage fragment) indicated by the underlined portion at the end. Using this sequence, it was ligated to the multi-cloning site (NdeI-HindIII) of pET22b using a cloning kit (In-fusion cloning kit). At this time, the modified enzyme was designed to be expressed as a C-terminal His tag fusion protein. Subsequently, E. coli strain JM109 was transformed to construct protein expression plasmids encoding the respective modified enzymes.

Step 2. Protein expression and purification in E. coli The expression plasmid constructed in Step 1 above was transformed into E. coli BL21 (DE3) pLysS strain. Escherichia coli into which this expression plasmid has been introduced is cultured at 37 ° C, and isopropyl 1-thio-β-D-galactopyranoside (isopropyl thio-β-galactoside: IPTG) is added and cultured at 20 ° C. Was induced and expressed. Specifically, Escherichia coli was cultured at 37 ° C. until the absorbance OD ₆₀₀ = 0.2, and further 0.2 mM IPTG and 0.5 mM CuCl ₂ were added and cultured at 20 ° C. for 20 hours. After culturing, the cells were collected by centrifuging the culture solution and frozen until the next experiment.

  The expressed cells were suspended in 10 mM Tris-HCl, 1 mM EDTA, pH 7.4, 0.4% surfactant Brij58 was added, and the mixture was left on ice for 30 minutes. Next, the cells were sonicated with an ultrasonic cell crusher and then centrifuged at 42,000 × g for 30 minutes to remove insoluble matters by centrifugation, and the supernatant was separated to obtain a cell lysate.

The obtained cell lysate was purified with a metal affinity carrier (TALON: manufactured by Clontech) for purifying histidine tag fusion protein. Specifically, an appropriate amount of support is packed in an open column, pre-washed with 20 mM sodium phosphate, 5 mM imidazole, and 0.5 M NaCl solution, and the final concentration of the cell lysate obtained above is 0.5 M. NaCl was added and applied to the column. Subsequently, after washing with 20 mM sodium phosphate, 10 mM imidazole, 0.5 M NaCl solution, the protein was eluted with 20 mM sodium phosphate, 150 mM imidazole, 0.5 M NaCl solution. After elution, the eluate was dialyzed overnight using 25 mM Tris-HCl buffer (pH 7.4) and 1 mM CuCl ₂ as external solutions. Thereby, removal of salts, such as imidazole and NaCl used for elution, and copper ion can be taken into a protein (laccase), and can be made into a holo.

  In the same manner, wild-type MELAC and mutant M308R were also expressed and purified.

  Next, the obtained purified protein was confirmed. Specifically, an appropriate amount of the purified protein after dialysis was collected, a protein solubilizing agent was added, and the mixture was heated at 95 ° C. Subsequently, it was subjected to 12.5% acrylamide gel electrophoresis, and after electrophoresis, the protein was visualized by CBB staining (manufactured by Wako Pure Chemical Industries, Ltd.).

  The results are shown in FIG. In the figure, lane 1 shows the result of wild-type MELAC, lane 2 shows the result of mutant M308R, lane 3 shows the result of mutant M308R-Del41, lane 4 shows the result of mutant M308R-Del68, and lane 5 shows the result of mutant M308R-Del77. Lane M is a molecular weight marker. From this result, it was confirmed that any protein could be induced to induce expression in E. coli, and no protein denaturation due to aggregation or the like occurred.

  In addition, although detailed description is abbreviate | omitted here, protein was not able to be expressed by deletion of 110 amino acids from the N terminal of MELAC.

[Example 14] Confirmation of activity of mutant 6-Measurement of laccase activity In this example, the laccase activity of the three N-terminal truncated mutants obtained in Example 13 was measured.

The laccase activity of the three mutants M308R-Del41, mutant M308R-Del68, and mutant M308R-Del77 obtained in Example 13 was measured. For the activity measurement, add 50 ng of the mutant protein obtained above to 200 μl of the measurement solution containing 1 × McVine buffer (McIlvain buffer, pH 5.0), 3.0 mM ABTS, 0.5 mM CuSO _4, and oxidize the ABTS. The amount of change in absorbance at a wavelength of 419 nm per minute was measured.

  Similarly, the activity of wild-type MELAC and mutant M308R was also measured.

The results are shown in FIG. In the figure, the vertical axis indicates the laccase activity by the amount of change in absorbance at 419 nm per unit time (A _{419 nm} / min) associated with the oxidation reaction of ABTS, and each mutant when mutant M308R is 100%. Relative laccase activity (%). From these results, it was found that the mutant M308R-Del41 and the mutant M308R-Del68 showed the same or higher activity as the mutant MELACM308R, but the activity of the mutant M308R-Del77 was remarkably reduced. By comparison with wild-type MELAC, an improvement in laccase activity of about 4 to 5 times was observed.

  Therefore, it was confirmed that the MLAAC high activation mutant M308R can be deleted up to 68 consecutive amino acids on the N-terminal side without reducing the catalytic activity of the high activation mutant. Therefore, mutant M308R-Del68 was selected and the following experiment was performed.

Example 15 Confirmation of Mutant Activity 7-Comparison of Electrocatalytic Activity by Electrochemical Measurement-1
The catalytic function of the enzyme-immobilized electrode was evaluated by electrochemical measurement using the mutant M308R-Del68, which was confirmed to be a highly activated mutant according to Example 14 above, as an electrode catalyst.

Step 1: Immobilization of mutant M308R-Del68 on carbon electrode substrate Mutant M308R-Del68 was adsorbed on a porous carbon electrode substrate. Here, the carbon electrode substrate used is a porous electrode substrate obtained by applying carbon gel (hereinafter referred to as “CG”) to carbon paper (hereinafter referred to as “CP”).

The carbon gel can be prepared as follows.
After 22 g of resorcinol (Wako Pure Chemical Industries) and 0.106 g of sodium carbonate were dissolved in 66 ml of Milli-Q water, 32.4 ml of 37% formaldehyde solution was added and stirred. From this mixture, undiluted, 50% diluted with water, 40%, 33.3% diluted were prepared. This is for adjusting the pore diameter of the carbon gel pores depending on the dilution rate. Each solution was allowed to react by standing at 25 ° C. for 24 hours, 50 ° C. for 24 hours, and 90 ° C. for 72 hours to obtain a hydrated solution (organic gel). Next, the organic gel was immersed in acetone to replace the water in the gel with acetone. This operation was repeated several times. 8 g of organic gel after acetone substitution was washed with L-CO ₂ for 1 hour at 18 ° C. and SC-CO ₂ for 1 hour at 35 ° C. using a supercritical dryer to obtain a dried organic gel. Subsequently, the dried organic gel is carbonized in a ceramics electric tube furnace under a nitrogen stream (flow rate 500 ml / min) and sequentially heated at 250 ° C for 1 hour, 500 ° C for 1 hour, and 1,000 ° C for 1 hour. A carbon gel was prepared. The carbon gel had a particle size of 40-50 μm.

And a carbon gel electrode base material can be prepared as follows.
Paste 50 mg of the carbon gel obtained above and 0.45 ml of 10% PVDF (polyvinylidene difluoride, average molecular weight 534 k, solvent N-methylpyrrolidone) in an agate mortar. I made it. Further, 1.2 ml of N-methylpyrrolidone was added and mixed until a slurry was obtained. Then, this was apply | coated on both surfaces of carbon paper, and the carbon gel electrode base material was prepared by making it dry at 60 degreeC for 4 hours.

Then, the mutant M308R-Del68 was adsorbed and immobilized on the carbon electrode base material prepared above to produce an enzyme-immobilized electrode. Specifically, the dried carbon gel electrode substrate (5 mm × 5 mm) was dipped lightly in ethanol and then washed with milli-Q water. Then, it was fixed by being immersed in a 1 mg / ml mutant M308R-Del68 solution (25 mM Tris-HCl, 0.1 mM CuSO ₄ pH 7.0) and allowed to stand at 4 ° C. overnight.

  Similarly, an enzyme-immobilized electrode to which the mutant M308R was adsorbed and immobilized was also produced.

Step 2: Measurement of Electrocatalytic Activity by Electrochemical Measurement Method The catalytic current of the enzyme-immobilized electrode prepared in Step 1 was measured by cyclic voltammetry (hereinafter referred to as “CV”).

CV measurement conditions are as follows.
Using an electrochemical measurement device (BAS600C), a silver / silver chloride electrode (3 M NaCl) as the reference electrode, platinum wire (φ0.5 mm) as the counter electrode, and the working electrode sandwiching the enzyme-immobilized electrode with platinum wire Measurements were made. Macvine buffer (pH 5.0) was used as the measurement solution, and the measurement was performed in an oxygen atmosphere and a nitrogen atmosphere.

The measurement parameters are as follows.
Mode: Cyclic voltammetry Initial potential: 0.7 V
High potential: 0.7 V
Low potential: 0 V
Potential scanning speed: 0.02 V / sec

  The results are shown in FIG. In the figure, the horizontal axis represents voltage (V) and the vertical axis represents current (mA). The catalytic current due to laccase activity is due to direct electron transfer from the carbon electrode substrate to the enzyme accompanying the reduction reaction of dissolved oxygen, and is detected as a negative current value. The enzyme-immobilized electrode showing the waveform in the figure and the measurement conditions are shown in Table 2 below.

  From this result, the generation of oxygen reduction current can be confirmed in the vicinity of 0.5 V in the waveform 4 showing the result of measurement of the mutant M308R-Del68 adsorbed and immobilized on a porous carbon electrode coated with carbon gel in an oxygen atmosphere. It was. A jumping waveform indicating oxygen supply rate control from around 0.4 V is observed. That is, the decrease in the catalyst current response observed near 0.4 V is caused by the rate of oxygen supply to the electrode. These findings indicate that MELAC-Del68 is capable of direct electron transfer with the electrode. On the other hand, in the waveform 3 showing the result of measuring the mutant M308R by adsorbing and fixing to the porous carbon electrode coated with carbon gel in an oxygen atmosphere, the generation of oxygen reduction current as in the waveform 4 could not be confirmed. This means that the mutant M308R immobilized electrode has a smaller catalytic current response than the mutant M308R-Del68 immobilized electrode. As this factor, it can be estimated that the adsorption efficiency to the carbon gel or the direct electron transfer efficiency between the electrode and the mutant is low.

  Specifically, in the waveform 4 showing the result of the mutant M308R-Del68 immobilized electrode, the current value around 0.52 V serving as the baseline is -0.64 mA, and around 1.72 mA around 0.42 V. A current value of -1.1 mA was obtained. In contrast, in waveform 3 showing the result of the mutant M308R-immobilized electrode, the current value near 0.52 V, which is the baseline, is -0.73 mA, and it is -0.93 mA near 0.42 V, so the current value is about -0.2 mA. That is, it was found that the mutant M308R-Del68 immobilized electrode can obtain a catalytic current response that is about 4 to 5 times or more that of the mutant M308R immobilized electrode.

  From the above results, it was found that the mutant M308R-Del68 significantly improved the efficiency of direct electron transfer with the electrode when fixed to the carbon electrode substrate. That is, it can be understood that the N-terminal truncated high activation mutant of the present invention has an excellent direct electron transfer function.

Example 16 Confirmation of Mutant Activity 8-Comparison of Electrocatalytic Activity with Existing Enzymes 1
According to Example 15 above, it was found that when the mutant M308R-Del68 was immobilized on a porous carbon electrode, the efficiency of direct electron transfer with the electrode was greatly improved. Evaluated by comparison.

  The target of comparison here is laccase derived from Bacillus subtilis (hereinafter referred to as “CotA”), which is a multi-copper oxidase as in MELAC. Mutants M308R-Del68 and CotA were adsorbed and immobilized on a porous carbon electrode prepared by applying a carbon gel, and electrocatalytic activity was measured in the same manner as in Example 15 in an oxygen atmosphere.

  The results are shown in FIG. In the figure, the horizontal axis represents voltage (V) and the vertical axis represents current (mA). From this result, CotA is known to exhibit heat resistance, but direct electron transfer with the electrode was found to be significantly lower than that of mutant M308R-Del68. Therefore, it can be understood that the N-terminal truncated high activation mutant of the present invention is superior in direct electron transfer function as compared with the existing enzyme.

[Example 17] Optimization of pore size of carbon gel In Examples 15 and 16, the electrocatalytic activity of the mutant M308R-Del168 was measured with an electrode using carbon gel, which is porous carbon. Here, the influence of the pore size of the carbon gel on the electrocatalytic activity was examined, and the pore size was optimized.

Investigation was performed using a carbon electrode base material in which carbon gels having various pore diameters (11.1, 22.0, 22.2, 35.3, 54.3 nm) prepared in Example 15 were applied to carbon paper. Specifically, a carbon electrode substrate prepared by applying carbon gel to carbon paper was immersed in 1.0 mg / ml mutant M308R-Del68 solution (25 mM Tris-HCl, 0.5 mM CuSO ₄ pH 7.0) 4 Allowed to stand overnight at ° C. Then, the amount of mutant M308R-Del68 obtained by subtracting the residual amount after removing the carbon base material from the input amount was estimated as the immobilization amount. As a control, the case where the mutant M308R-Del68 was immobilized without applying the carbon gel was similarly examined.

The results are shown in FIG. In the figure, the horizontal axis represents the pore diameter (nm) of the carbon gel, and the horizontal axis represents the amount of mutant M308R-Del68 adsorbed (A _{280 nm} ). From this result, it was confirmed that the amount of immobilization of the mutant M308R-Del68 was increased by applying the carbon gel as compared with the control in which the carbon gel was not applied. And it became clear that the amount of immobilization increased with the expansion of the pore diameter. In calculation, carbon gel is applied so that the surface area is the same, but the larger pore diameter is because the mutant M308R-Del68 has entered to the back of the three-dimensional pores made by the carbon gel. Conceivable.

  Next, using an enzyme-immobilized electrode in which the mutant M308R-Del68 was immobilized on a carbon electrode base material having various pore sizes as the working electrode, the catalyst current was measured by CV based on the procedure of Step 2 of Example 15.

The measurement parameters are as follows.
Mode: Cyclic voltammetry Initial potential: 0.7 V
Rest time before start: 10 seconds High potential: 0.7 V
Low potential: 0 V
Potential scanning speed: 50mV / sec

  The results are shown in FIG. In the figure, the horizontal axis represents the diameter (nm) of the pores of the carbon gel. The vertical axis represents the relative current (%) of the enzyme-immobilized electrode with each pore diameter, assuming the relative current of the enzyme-immobilized electrode with a pore diameter of 22.2 nm as 100%, and the difference value of 0.5-0.4V of the current response. Is a graph. From this result, it can be confirmed that the catalyst current increases when the pore diameter of the carbon gel is 22.2 nm, and that the catalyst current decreases when the pore diameter is larger than that of the mutant M308R-Del68. It was. As a cause of this, although the mutant M308R-Del68 enters the pores, an extra space is formed between the mutant M308R-Del68 and the electrode, and the direct electron transfer efficiency is considered to be reduced.

  Therefore, it can be understood that the pore size of the carbon gel has an optimum value that matches the size of the enzyme to be immobilized. That is, when the pore size of the carbon gel is smaller than the enzyme, the enzyme cannot enter the pores and cannot exhibit its catalytic activity. On the other hand, when the pore diameter is larger than that of the enzyme, the enzyme can enter the pore, so that a highly efficient electron transfer reaction can be performed between the electrode and the enzyme, and the catalytic activity of the enzyme can be exhibited. However, if the pore diameter is too large, an extra space is formed between the enzyme and the electrode, and the direct electron transfer efficiency decreases. From this, when constructing an electrode in which the mutant M308R-Del68 is immobilized on a carbon gel, the pore diameter of the carbon gel is 20 to 40 nm, preferably 20 to 35 nm, especially 22 to 22.2 nm, especially Preferably it is 22.2 nm. When the pore diameter was 11.1 nm or less, it was found that the mutant M308R-Del68 hardly enters the pores and is not preferable as a carbon gel for fixing the mutant M308R-Del68.

[Example 18] Activity confirmation of mutant 9- Comparison 2 of electrocatalytic activity with existing enzyme 2
According to Example 15, the electrocatalytic function of the mutant M308R-Del68, which was found to have a high electrocatalytic function, was evaluated by electrochemical measurement in comparison with existing enzymes.

  Here, the target of comparison was bilirubin oxidase (hereinafter referred to as “Amano-BOD”) derived from Myrothecius verruvcaria, which is conventionally known to exhibit the highest catalytic current. Like MELAC, it is a multi-copper oxidase.

  An enzyme-immobilized electrode was prepared by adsorbing and immobilizing a glassy carbon electrode substrate coated with carbon gel having a pore diameter of 22.2 nm in a measurement solution containing the same amounts of the mutant M308R-Del68 and Amano-BOD. CV measurement was performed under the same electrochemical measurement conditions as in Example 17.

  The results are shown in FIG. In the figure, the horizontal axis shows voltage (V), the horizontal axis shows current (mA), waveform 1 shows the result of Amano-BOD, and waveform 2 shows the result of mutant M308R-Del68. From this result, it was confirmed that the mutant M308R-Del68 can obtain a catalytic current response of about 3 to 4 times that of Amano-BOD. Specifically, it can be understood that a catalyst current response of 3 to 4 times can be obtained by comparing the oxygen reduction current value around 0.35 V. In addition, in the result of mutant M308R-Del68, since the signal oscillation phenomenon is observed from a negative voltage from 0.2 V, it can be assumed that this is due to insufficient supply of oxygen to the oxygen reduction reaction. It was suggested that a higher catalyst current could be obtained.

[Example 19] Confirmation of activity of mutant 9-Comparison of durability with existing enzyme The durability of mutant M308R-Del68, which was found to have high electrocatalytic activity according to Example 15 above, was compared with that of the existing enzyme. It evaluated by comparison with.

  Here, as in Example 18, Amano-BOD was used for comparison.

  Mutant M308R-Del68 and Amano-BOD were compared for durability in phosphate buffer (pH 7.0) and imidazole buffer (pH 7.0), which are buffers widely used in bio batteries. Specifically, 1.0 mg / ml mutant M308R-Del68 was added to 200 mM phosphate buffer (pH 7.0) and 200 mM imidazole buffer (pH 7.0), and 0, 2, 3, 7, The laccase activity remaining after standing for 8, 9, 10, and 15 days was measured. The laccase activity was measured according to the procedure of Example 14.

  The results are shown in FIG. FIG. 22A shows the results of mutant M308R-Del68, FIG. 22B shows the results of Amano-BOD, and the horizontal axis indicates the number of days left (days), and the vertical axis indicates the laccase activity after 0 days as 100%. The relative activity (%) of laccase activity after each standing period is shown. From these results, it was confirmed that the mutant M308R-Del68 has durability even in the buffer solution of the bio battery, compared with Amano-BOD. On the other hand, with Amano-BOD, it was confirmed that the enzyme activity decreased to 80% in about 8 days for the phosphate buffer and about 2 days for the imidazole buffer.

  In this example, the durability of the mutant M308R-Del68 was not evaluated with an index of electrochemical characteristics. However, when the enzyme-immobilized electrode is fixed to the electrode, the decrease in the activity of the enzyme alone greatly affects the performance of the enzyme-immobilized electrode, so the mutant M308R-Del68 can be used as an electrode catalyst. It can be understood that a high-performance electrode having higher activity and durability than existing electrodes can be constructed.

  The present invention relates to a protein having a novel laccase activity, a nucleic acid molecule encoding the same, and use thereof, and can be used in all fields where utilization of laccase activity is required, particularly in the medical, food and environmental fields. It can be used in various industrial fields such as the electrochemical field.

Claims (15)

A protein selected from the group consisting of:
(A) a protein comprising an amino acid sequence in which the 308th methionine of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid (b) one or several amino acids are deleted, substituted or substituted in the amino acid sequence of SEQ ID NO: 2 And an improved laccase activity as compared to a protein comprising the amino acid sequence of SEQ ID NO: 2 comprising an amino acid sequence other than methionine at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 2 Protein with   The protein according to claim 1, wherein the other amino acid is arginine. The protein according to claim 1 or 2, which is selected from the group consisting of:
(A) a protein comprising the amino acid sequence of SEQ ID NO: 4 (b) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 4, and the 308th amino acid sequence of SEQ ID NO: 4 A protein comprising an amino acid sequence in which the corresponding amino acid residue is arginine and having improved laccase activity compared to a protein comprising the amino acid sequence of SEQ ID NO: 2 (c) a protein comprising the amino acid sequence of SEQ ID NO: 5 (d ) From the amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 5 and the amino acid residue at the position corresponding to position 308 of the amino acid sequence of SEQ ID NO: 5 is arginine Improved laccase compared to the protein consisting of the amino acid sequence of SEQ ID NO: 2 Protein having sex A protein selected from the group consisting of:
(A) a protein comprising the amino acid sequence of SEQ ID NO: 25 (b) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 25, and the 241st amino acid sequence of SEQ ID NO: 25 The amino acid residue at the corresponding position consists of an amino acid sequence that is arginine, and has an improved laccase activity compared to the protein consisting of the amino acid sequence of SEQ ID NO: 2 and the protein consisting of the amino acid sequence of SEQ ID NO: 4 or 5. A protein having improved direct electron transfer activity (c) a protein comprising the amino acid sequence of SEQ ID NO: 27, (d) one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 27, and the sequence The amino acid residue at the position corresponding to position 268 of the amino acid sequence of No. 27 is arginine To the amino acid sequence is a protein having a comparison with improved laccase activity, and SEQ ID NO: 4 or directly improved as compared to a protein consisting of five amino acid sequence electron transfer activity to the protein consisting of the amino acid sequence of SEQ ID NO: 2   The nucleic acid molecule which codes the protein as described in any one of Claims 1-4.   A recombinant vector containing the nucleic acid molecule according to claim 5.   A transformant comprising the recombinant vector according to claim 6.   The method according to any one of claims 1 to 3, comprising a step of culturing the transformant according to claim 7 at 10 to 20 ° C and a step of collecting a protein showing laccase activity from the obtained culture. A method for producing the protein.   A biocell provided with the electrode which fix | immobilized the protein as described in any one of Claims 1-4 as a cathode side electrode.   The biobattery of Claim 9 provided with the electrode which fix | immobilized the protein of Claim 4 through the electroconductive porous material as a cathode side electrode.   The bio battery according to claim 10, wherein the porous material is porous carbon having pores having a diameter of 20 to 40 nm.   A biosensor comprising an electrode on which the protein according to any one of claims 1 to 4 is immobilized as a substrate recognition site.   The biosensor according to claim 12, further comprising an electrode on which the protein according to claim 4 is immobilized via an electrically conductive porous material.   The biosensor according to claim 13, wherein the porous material is porous carbon having pores having a diameter of 20 to 40 nm.   A method for detecting a phenol compound, wherein the protein according to any one of claims 1 to 4 is contacted with a test sample and a change in laccase activity is measured to detect the phenol compound.