CN114703203A

CN114703203A - Baculovirus vectors and uses thereof

Info

Publication number: CN114703203A
Application number: CN202210127524.1A
Authority: CN
Inventors: 潘雨堃; 王天天
Original assignee: Shanghai Boyin Biotechnology Co ltd
Current assignee: Shanghai Boyin Biotechnology Co ltd
Priority date: 2022-02-11
Filing date: 2022-02-11
Publication date: 2022-07-05

Abstract

The present application relates to a method for preparing a linear double-stranded endless DNA (neDNA) expression vector comprising AAV Inverted Terminal Repeats (ITRs) and a gene expression cassette using an insect cell-baculovirus system. The yield of the neDNA prepared by the insect cell-baculovirus system is high, and the yield is improved by 2-3 times on average. Compared with other Bac-Rep, the expression stability of the Rep protein (Rep78) is better after 3 continuous baculovirus passages.

Description

Baculovirus vectors and uses thereof

Technical Field

The application relates to the field of biomedicine, in particular to a baculovirus vector and application thereof.

Background

Gene therapy is a novel therapeutic approach for the treatment of disease at the nucleic acid level by regulating the biological process of gene expression. The ideal gene therapy vector needs to have the characteristics of high delivery efficiency, high safety, scalable production and low cost. The recombinant adeno-associated virus (rAAV) vector has the characteristics of high efficiency and safety, and is the main gene delivery vector for genetic disease gene therapy at present. rAAV still faces the problems of difficult production scale-up and high production cost. Non-viral vector gene therapy based on DNA therapy is expected to solve this problem. In 2013, Robert Kotin et al used an insect cell baculovirus expression system to prepare a linear double-stranded non-terminal DNA (no end DNA, neDNA), both ends of which were closed by Inverted Terminal Repeats (ITRs) of AAV genome. The preparation method of Robert Kotin is directly converted from an AAV baculovirus production system developed in the laboratory 2002, and the yield is not optimized aiming at the neDNA; meanwhile, when the recombinant baculovirus Bac-Rep expresses the Rep protein, homologous recombination can occur between the Rep78 and the Rep52, and the system is unstable.

There is therefore still a need to overcome the above serious limitations of large scale (commercial) production of neDNA in insect cells. It is therefore an object of the present invention to provide means and methods for producing neDNA stably and in high yield (large scale) in insect cells.

Disclosure of Invention

The application aims to design an efficient insect cell-based baculovirus expression system and a method for preparing the neDNA by using the efficient insect cell-based baculovirus expression system, so that a Rep protein expression vector is optimized, the stability of Rep protein expression is improved, and the yield of the neDNA and the stability of a production system are improved. The features of the invention include: 1) the strong promoter (p10 promoter) is used, so that the expression level of Rep78 is improved; 2) the sequence codons of Rep52 are optimized, and homologous recombination of the Rep78 and the Rep52 sequences is avoided. The invention has the following effects: 1) compared with the Robert Kotin preparation method, the yield is improved by 2-3 times; 2) the Rep protein baculovirus expression vector is stable after 3 generations.

In one aspect, the present application provides an isolated nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO. 12.

In certain embodiments, the isolated nucleic acid molecule encodes an adeno-associated virus (AAV) Rep52 protein.

In another aspect, the present application provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the adeno-associated virus (AAV) Rep78 protein and a nucleotide sequence encoding the Rep52 protein, wherein the nucleic acid molecule encoding the Rep52 protein comprises the nucleotide sequence set forth in SEQ ID No. 12.

In certain embodiments, wherein the nucleotide sequence encoding the Rep78 protein is wild-type.

In certain embodiments, the nucleic acid molecule encoding Rep78 protein comprises the nucleotide sequence set forth in SEQ ID NO. 11.

In certain embodiments, it further comprises a first promoter that initiates transcription of the nucleotide sequence encoding the AAV Rep78 protein and a second promoter that initiates transcription of the nucleic acid molecule encoding the AAV Rep52 protein, the first promoter being the same as or different from the second promoter.

In certain embodiments, the first promoter and the second promoter comprise insect cell promoters.

In certain embodiments, the first promoter comprises a strong promoter.

In certain embodiments, the first promoter has the same or greater transcription initiation capability as the second promoter.

In certain embodiments, wherein the first promoter and the second promoter are each independently selected from the group consisting of: the p10 promoter, the polyhedrin (polh) promoter, and the IE1 promoter.

In certain embodiments, wherein the direction of transcription of the first promoter and the second promoter is the same or opposite.

In certain embodiments, wherein the first promoter is operably linked to the nucleotide sequence encoding Rep78 protein and the second promoter is operably linked to the nucleotide sequence encoding Rep52 protein.

In certain embodiments, when the first promoter and the second promoter are transcribed in the same direction, they comprise in sequence the first promoter, the nucleotide sequence encoding Rep78 protein, the second promoter, and the nucleotide sequence encoding Rep52 protein.

In certain embodiments, the nucleotide sequence encoding Rep78 protein and the nucleotide sequence encoding Rep52 protein further comprise downstream of the nucleotide sequence encoding polyA (pA), respectively.

In certain embodiments, when the first promoter and the second promoter are transcribed in the same direction, they comprise, in order, the first promoter, the nucleotide sequence encoding Rep78 protein, the first pA, the second promoter, the nucleotide sequence encoding Rep52 protein, and the second pA.

In certain embodiments, when the first promoter and the second promoter are transcribed in opposite directions, they comprise, in order, a nucleotide sequence encoding Rep78, a first promoter, a second promoter, a nucleotide sequence encoding Rep52, wherein the first promoter initiates transcription of the nucleotide sequence encoding Rep78 protein and the second promoter initiates transcription of the nucleotide sequence encoding Rep52 protein.

In certain embodiments, the 5 'end of the first promoter is linked directly or indirectly to the 5' end of the second promoter.

In certain embodiments, the 3 'end of the first promoter is linked directly or indirectly to the 5' end of the nucleotide sequence encoding Rep 78.

In certain embodiments, it further comprises a first pA, wherein the 3 'end of the nucleotide sequence encoding Rep78 protein is linked directly or indirectly to the 5' end of the first pA.

In certain embodiments, the 3 'end of the second promoter is linked directly or indirectly to the 5' end of the nucleotide sequence encoding Rep 52.

In certain embodiments, it further comprises a second pA, wherein the 3 'end of the nucleotide sequence encoding Rep52 protein is linked directly or indirectly to the 5' end of the second pA.

In certain embodiments, wherein said pA is selected from: any one of SV40 polyA and HSV TK polyA.

In certain embodiments, the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO. 8.

In another aspect, the present application provides an isolated nucleic acid molecule comprising, in order, a first polyA (pA), a nucleotide sequence encoding a Rep78 protein, a first promoter, a second promoter, a nucleotide sequence encoding a Rep52 protein, and a second polyA (pA), wherein the first promoter is a nucleotide sequence encoding a Rep78 protein and a transcriptional promoter of first pA, and the second promoter is a nucleotide sequence encoding a Rep52 protein and a transcriptional promoter of second polyA, wherein the nucleotide sequence encoding a Rep52 protein and/or the sequence encoding a Rep78 protein are codon optimized to avoid homologous recombination, the first and second promoters comprising insect cell promoters, and the first promoter is a strong promoter.

In certain embodiments, wherein the first promoter comprises a p10 promoter, a polh promoter, or an IE1 promoter.

In certain embodiments, wherein the p10 promoter comprises the nucleotide sequence set forth in SEQ ID NO. 9.

In certain embodiments, wherein the second promoter comprises a second promoter comprising a p10 promoter, a polh promoter, or an IE1 promoter.

In certain embodiments, the polh promoter comprises the nucleotide sequence set forth in SEQ ID NO. 10.

In another aspect, the present application provides a vector comprising an isolated nucleic acid molecule described herein.

In certain embodiments, the vector comprises a viral vector.

In certain embodiments, the vector comprises a baculovirus vector.

In certain embodiments, the vector comprises a pFastBac vector.

In certain embodiments, the vector comprises the nucleotide sequence set forth in SEQ ID NO. 14.

In another aspect, the present application provides a cell comprising an isolated nucleic acid molecule described herein or a vector described herein.

In certain embodiments, the cell comprises an insect cell.

In certain embodiments, the cell comprises a Spodoptera frugiperda (Sf9) cell.

In another aspect, the present application provides a baculovirus expression system comprising a first baculovirus vector which is a baculovirus vector as described herein and a second baculovirus vector comprising a nucleic acid sequence encoding a gene of interest.

In certain embodiments, the nucleic acid sequence encoding the gene of interest comprises, in order from 5 'to 3', an Inverted Terminal Repeat (ITR) of the first parvovirus, the gene of interest, and a second ITR.

In certain embodiments, wherein the first ITR further comprises at least one promoter with the gene of interest.

In certain embodiments, wherein the first ITR further comprises at least one eukaryotic promoter between the first ITR and the gene of interest.

In certain embodiments, wherein the first ITR further comprises at least one mammalian cell promoter between the first ITR and the gene of interest.

In certain embodiments, wherein the first ITR further comprises a mammalian cell promoter and an insect cell promoter between the first ITR and the gene of interest.

In certain embodiments, the mammalian cell promoter includes a broad promoter and a tissue-specific promoter.

In certain embodiments, the broad promoter comprises a CMV, SV40, EF1a, CAG, or UBC promoter.

In certain embodiments, the tissue-specific promoter comprises an ALB, hAAT, TBG, TTR, GFAP, MHCK7, or hSyn promoter.

In certain embodiments, wherein the mammalian cell promoter comprises a CMV promoter.

In certain embodiments, wherein the insect cell promoter comprises a p10 promoter.

In certain embodiments, the promoter comprises CMV and p10 promoters.

In another aspect, the present application provides an insect cell comprising a first nucleotide sequence encoding a first amino acid sequence comprising a nucleotide sequence encoding Rep78 protein and a second nucleotide sequence encoding a second amino acid sequence comprising a nucleotide sequence encoding Rep52 protein, wherein the first nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 11 and the second nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 12.

In certain embodiments, wherein the first and second nucleotide sequences are part of a nucleic acid construct, wherein the first and second nucleotide sequences are each operably linked to an expression control sequence for expression in an insect cell.

In certain embodiments, wherein the insect cell further comprises: a third nucleic acid sequence comprising at least one parvoviral inverted terminal repeat nucleotide sequence (ITR).

In certain embodiments, wherein the third nucleotide sequence further comprises at least one nucleotide sequence encoding a gene of interest.

In certain embodiments, wherein the third nucleotide sequence comprises two parvoviral ITR nucleotide sequences and wherein the at least one nucleotide sequence encoding a gene of interest is located between the two parvoviral ITR nucleotide sequences.

In certain embodiments, wherein the parvovirus comprises an adeno-associated virus.

In certain embodiments, wherein the third nucleotide sequence is part of another nucleic acid construct, wherein each of the nucleotide sequences encoding a gene of interest is operably linked to an expression control sequence for mammalian expression.

In certain embodiments, the nucleic acid construct is an insect cell-compatible vector.

In certain embodiments, the nucleic acid construct is a baculovirus vector.

In certain embodiments, it comprises a baculovirus vector as described herein.

In another aspect, the present application provides the use of a baculovirus expression system as described herein or an insect cell as described herein for the preparation of a nucleic acid molecule of interest.

In certain embodiments, wherein the nucleic acid molecule of interest is a linear DNA molecule (neDNA) having covalently closed ends.

In another aspect, the present application provides a method for producing a nucleic acid molecule of interest, comprising culturing an insect cell as described herein.

In certain embodiments, the method of making comprises:

1) providing a baculovirus expression system as described herein;

2) inserting a gene sequence of interest into the second baculovirus vector;

3) co-transfecting the first baculovirus vector and the second baculovirus vector into an insect cell;

4) growing the insect cell under conditions that allow replication and release of the DNA comprising the gene of interest;

5) collecting the target nucleic acid molecule.

In certain embodiments, the method also protects isolating the nucleic acid molecule of interest.

In another aspect, the present application provides a kit comprising an isolated nucleic acid molecule described herein, a baculovirus expression system described herein, and/or an insect cell described herein.

Other aspects and advantages of the present application will be readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application have been shown and described in the following detailed description. As those skilled in the art will recognize, the disclosure of the present application enables those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention as it is directed to the present application. Accordingly, the descriptions in the drawings and the specification of the present application are illustrative only and not limiting.

Drawings

The specific features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates will be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings. The drawings are briefly described as follows:

FIG. 1A shows a map of the pFastBac-ITR-EGFP plasmid described herein.

FIG. 1B shows a map of the pFastBac-p10Rep plasmid described herein.

FIG. 2 shows a schematic representation of the transcription of the p10Rep, RepWT, inRep and CORep genes described herein.

FIG. 3 shows the result of Western Blotting analysis of Rep protein expression and stability; wherein Ctr: no Sf9 cells were infected; 1: BacV-RepWT infected Sf9 cells; 2: BacV-inRep infected Sf9 cells; 3: BacV-CORep infected Sf9 cells; 4: BacV-p10Rep infected Sf9 cells.

FIG. 4 shows the results of identifying different Rep protein-driven neDNA-ITR-EGFP gene expression vectors described herein; wherein, M: DNA Marker; 1-4: respectively, the electropherograms of RepWT, inRep, CORep and p10Rep driving neDNA-ITR-EGFP gene expression vectors.

FIGS. 5A-5B show the results of enzyme cleavage identification of the neDNA-ITR-EGFP gene expression vector described herein.

FIG. 6 shows fluorescent expression patterns of the cells transfected for 72h under a fluorescence microscope, wherein the RepWT, inRep, CORep and p10Rep are used for driving the neDNA-ITR-EGFP gene expression vector and transfecting HEK293 cells respectively.

FIG. 7 shows the results of the nanoliposome particle delivery of neDNA-ITR-FLUc luciferase expression in C57BL/6 mice.

FIG. 8 shows the alignment of Rep52 before and after optimization as described in the present application (Query: Rep52WT, Sbjct: Rep 52-CO).

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification.

Definition of terms

Viruses of the parvoviridae family are small DNA animal viruses. The parvoviridae family can be divided into two subfamilies: parvovirinae which infects vertebrates and densovirus subfamily which infects insects. Members of the parvovirinae are referred to herein as parvoviruses and include dependovirus genera. As can be inferred from their generic names, such virus-dependent members are unique in that they typically need to be co-infected with a helper virus such as adenovirus or herpes virus that produces the infection in cell culture. The dependovirus genus includes AAV, which is very common in humans and other primates, and several serotypes have been isolated from various tissue samples.

Serotypes

2, 3, 5 and 6 are found in human cells, AAV serotypes 1, 4 and 7-11 in non-human primate samples. Kenneth i.berns, "parsoviridae: the Therrus and the Their Replication, "Chapter 69in Fields Virology (3dEd.1996) describes additional information about parvoviruses and other members of the parvoviridae family. It is to be understood that the present invention is not limited to AAV, but may be equally applied to other parvoviruses.

The genome of AAV is a linear, single-stranded DNA molecule less than about 5000 nucleotides (nt) in length. Inverted Terminal Repeats (ITRs) flank the unique coding nucleotide sequences encoding the nonstructural replication (rep) protein and the structural protein (VP). The VP proteins (VP1, VP2, and VP3) make up the capsid. The terminal 145nt is self-complementary and ordered to form an energetically stable intramolecular duplex forming a T-hairpin. These hairpin structures function as origins of viral DNA replication and serve as primers for the cellular DNA polymerase complex. Upon wtAAV infection of mammalian cells, the Rep genes (i.e., Rep78 and Rep52) are expressed from the P5 promoter and the P19 promoter, respectively, and both of the expressed Rep proteins play a role in replication of the viral genome. The splicing event in this Rep ORF actually results in the expression of four Rep proteins (i.e., Rep78, Rep68, Rep52, and Rep 40). However, the unspliced mRNA encoding Rep78 and Rep52 is sufficient in mammalian cells to produce AAV vectors. The Rep78 and Rep52 proteins are also sufficient to produce AAV vectors in insect cells.

In the present application, the term "AAV vector" or "rAAV vector" generally refers to a vector that comprises one or more polynucleotide sequences of interest, genes of interest, or "transgenes" flanked by parvoviral or AAV Inverted Terminal Repeats (ITRs).

In this application, the term "operably linked" refers to the linkage of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably linked" when it is placed in a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are generally contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.

In the present application, the term "expression control sequence" generally refers to a nucleic acid sequence that regulates the expression of a nucleotide sequence to which it is operably linked. An expression control sequence is "operably linked" to a nucleotide sequence when the expression control sequence controls and regulates the transcription and/or translation of the nucleotide sequence. Thus, an expression control sequence may include a promoter, enhancer, Internal Ribosome Entry Site (IRES), transcription terminator, start codon in front of the protein-encoding gene, intron splicing signal, and stop codon. The term "expression control sequence" is intended to include, at a minimum, a sequence that is present to effect expression, and may also include other advantageous components. For example, a leader sequence and a fusion partner sequence (fusion partner sequence) are expression control sequences. The term may also include nucleic acid sequence designs in which potential start codons that are not desired in frame are removed from the sequence. It may also include nucleic acid sequence designs that remove unwanted possible splice sites. It includes a sequence or polyadenylation sequence (pA) that directs the addition of a polyA tail, i.e., a stretch of adenine residues located at the 3' end of the mRNA, which is referred to as the polyA sequence. It can also be designed to increase the stability of the mRNA. Expression control sequences, such as promoters, which affect transcriptional and translational stability, as well as sequences which effect translation, such as Kozak sequences, are known to be present in insect cells. The expression control sequence has the property of modulating the nucleotide sequence to which it is operably linked, thereby reducing or increasing the level of expression.

In the present application, the term "promoter" or "transcription regulatory sequence" generally refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, that is located upstream in the direction of transcription from the transcription start site of the coding sequence, and that is structurally recognized by the presence of a DNA-dependent RNA polymerase binding site, the transcription start site, and any other DNA sequences known to those skilled in the art, including but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences known to those skilled in the art that may act directly or indirectly to regulate the amount of transcription from a promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is regulated physiologically or developmentally, for example, by the use of a chemical inducer. A "tissue-specific" promoter is active only in a particular tissue or cell type.

In the present application, the term "strong promoter" generally refers to a promoter having a high affinity for RNA polymerase, which directs the synthesis of a large amount of mRNA, i.e., a promoter that can efficiently initiate DNA transcription. The mammalian strong promoters include CMV promoter, CAG promoter, EF1a promoter, SV40 promoter and the like. Strong promoters of insect cells include p10 promoter, polh promoter, IE1 promoter, and the like. Taking the insect cell-baculovirus expression system p10 promoter as an example in the specification: the p10 promoter (p10 promoter) is a p10 promoter from the middle and late expression of autographa californica nucleopolyhedrovirus (AcMNPV) and is a sequence capable of driving the target gene to be highly expressed in insect cells.

In the present application, the term "linear double-stranded non-terminal DNA (no end DNA, neDNA)" generally refers to a linear, double-stranded, terminal-blocked DNA vector, both ends of which are closed by Inverted Terminal Repeats (ITRs) of the AAV genome. The neDNA vector is covalently blocked and thus resistant to exonucleases (e.g., exonuclease I or exonuclease III). The neDNA may have various configurations, such as: monomers, dimers, trimers, and multimers, among others.

In the present application, the term "vector" or "construct" is generally a nucleic acid molecule (typically DNA or RNA) for transferring a passenger nucleic acid sequence (i.e., DNA or RNA) to a host cell. Three common types of vectors include plasmids, phages and viruses. The vector is preferably a virus. Vectors containing both a promoter and a cloning site into which the polynucleotide may be operably linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo and are commercially available from suppliers such as Stratagene (La Jolla, Calif.) and Promega Biotech (Madison, ffins.). To optimize expression and/or in vitro transcription, it may be desirable to remove, add or alter the 5 'and/or 3' untranslated portions of the clone to remove additional, possibly inappropriate, variable translation initiation codons or other sequences that may interfere with or reduce expression at the transcriptional or translational level.

In the present application, the term "viral vector" generally refers to a viral gene, control sequences, and viral packaging sequences comprising some or all of the vector-encoded gene products listed below.

In the present application, a "parvoviral vector" can be defined as a recombinantly produced parvovirus or parvoviral particle comprising a polynucleotide to be delivered to a host cell (in vivo (ex vivo), ex vivo (ex vivo) or in vitro (in vitro)). Examples of parvoviral vectors include, for example, adeno-associated viral vectors.

In the present application, the term "Baculovirus insect cell expression system" or "BEVS" (Baculovirus expression vector system) generally refers to a eukaryotic expression system that expresses a foreign protein. The currently most widely used baculovirus expression system is the lytic virus of Autographa california multiplex expressed nuclear polyhedrosis virus (AcMNPV), abbreviated as baculovirus (baculovir). The vector is characterized in that the baculovirus expression system completely uses a protein modification, processing and transfer system existing in higher eukaryotic cells, and belongs to the eukaryotic expression system; AcMNPV is a non-helper virus, and can be suitable for mass proliferation in insect cells growing in suspension without any helper factors, thereby being convenient for mass expression of recombinant proteins; the expression system makes the expression product in a dissolved state; the baculovirus gene is large (130kb), suitable for cloning large-fragment foreign genes. Baculovirus does not infect vertebrates viral promoters are inactive in mammalian cells.

In the present application, the term "Bacmid" or "Bacmid" generally refers to Baculovirus recombinant DNA capable of shuttling between insect cells and e.

In the present application, the terms "substantially identical", "substantially identical" or "substantially similar" generally mean that two peptide sequences or two nucleotide sequences, when optimally aligned, for example by the GAP or BESTFIT programs with default parameters, share at least a certain percentage of sequence identity, as defined elsewhere in the specification. GAP uses the Needleman and Wunsch full sequence alignment algorithm to align two full-length sequences, and maximizes the number of matches and minimizes the number of GAPs. GAP default parameters are typically used, with GAP creation penalty of 50 (nucleotides)/8 (protein) and GAP extension penalty of 3 (nucleotides)/2 (protein). The default scoring matrix used for nucleotides was nwsgapdna and for proteins was Blosum62(Henikoff & Henikoff,1992, PNAS 89, 915-. It is clear that thymine in a DNA sequence corresponds to uracil (U) in an RNA sequence when the RNA sequence is considered to be substantially similar to the DNA sequence or to have a certain degree of sequence identity. Percent sequence identity can be determined by sequence alignment and scoring using a computer program. Alternatively, the percent similarity or identity can also be determined by searching databases such as FASTA, BLAST, and the like.

In this application, the terms "comprises" and variations such as "comprising" and "comprises" are generally intended to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The term "comprising" as used herein may in turn be replaced by the term "containing" or "including", or the term "having" as used herein may sometimes be used instead.

It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" and "an" and the terms "one or more" and "at least one" may be used interchangeably herein.

Detailed Description

Isolated nucleic acid molecules

The codons of the Rep52 sequence are optimized, so that homologous recombination of Rep78 and Rep52 is avoided after optimization. Codon optimization can be performed based on codon usage of Spodoptera frugiperda organisms found in a codon usage database (see, e.g., http:// www.kazusa.or.jp/codon /), or Sf9 insect cell transcriptome sequencing data can be extracted from the NCBI database, and the extraction of parameters such as codon preference adaptation index is done manually. Suitable computer programs for codon optimization are available to those skilled in the art (see, e.g., Anders fusion, 2003, Protein Expression and Purification 31: 247-. Alternatively, the optimization can be done manually using the same codon usage database. In order to avoid homologous recombination, the nucleotide sequences of continuous bases are selected to be candidate sequences with the same number of less than or equal to 30 and the homology of less than or equal to 85 percent, and subsequent experiments are carried out to verify, and finally the Rep52 codon optimized sequence is obtained.

The nucleic acid sequence of Rep52-WT is shown in SEQ ID NO. 13, the nucleic acid sequence of Rep52-CO is shown in SEQ ID NO. 12, and the codon optimization alignment of Rep52-WT and Rep52-CO is shown in FIG. 8.

In certain embodiments, wherein the nucleotide sequence encoding Rep78 protein is wild-type.

In certain embodiments, wherein the first promoter comprises a p10 promoter.

In certain embodiments, wherein the first promoter comprises a full-length p10 promoter.

In certain embodiments, wherein the first promoter comprises the nucleotide sequence set forth in SEQ ID NO. 9.

In certain embodiments, wherein the second promoter comprises a polyhedrin (polh) promoter.

In certain embodiments, wherein the second promoter comprises the nucleotide sequence set forth in SEQ ID NO. 10.

In certain embodiments, when the first promoter and the second promoter are transcribed in the same direction, they comprise, in order, the first promoter, the nucleotide sequence encoding Rep78 protein, the second promoter, and the nucleotide sequence encoding Rep52 protein.

In certain embodiments, wherein the 3 'end of the second promoter is linked directly or indirectly to the 5' end of the nucleotide sequence encoding Rep 52.

In another aspect, the present application provides an isolated nucleic acid molecule comprising, in order, a first polyA (pA), a nucleotide sequence encoding a Rep78 protein, a first promoter, a second promoter, a nucleotide sequence encoding a Rep52 protein, and a second polyA (pA), wherein the first promoter is a nucleotide sequence encoding a Rep78 protein and a transcription promoter of the first pA, and the second promoter is a nucleotide sequence encoding a Rep52 protein and a transcription promoter of the second polyA, wherein the nucleotide sequence encoding a Rep52 protein and/or the sequence encoding a Rep78 protein are codon optimized to avoid homologous recombination, and the first promoter has the same or higher transcription initiation capability than the second promoter.

The first promoter having the same or higher transcription initiation ability as compared to the second promoter may be defined as follows. The strength of the promoter can be determined by the expression obtained under the conditions used in the method of the present application.

In certain embodiments, the first promoter or the second promoter is selected from the group consisting of polh promoter, p10 promoter, alkaline protein promoter, an inducible promoter or IE1 promoter, or any other late or very late baculovirus gene promoter.

In one embodiment, the first promoter is a p10 promoter and the second promoter is a polh promoter. In another embodiment, the first promoter in the nucleic acid construct of the invention is a polh promoter and the second promoter is an IE1 promoter. In another embodiment, the first promoter in the nucleic acid construct of the invention is the pl0 promoter and the second promoter is the IE1 promoter. In another embodiment, the first promoter in the nucleic acid construct of the invention is a polh promoter and the second promoter is a polh promoter.

In certain embodiments, wherein the first promoter comprises a p10 promoter.

In certain embodiments, wherein the second promoter comprises a Polyhedrin promoter.

Vectors and expression systems

In certain embodiments, the vector is suitable for expression and/or replication in an insect cell.

In certain embodiments, the vector comprises a viral vector.

In certain embodiments, the vector comprises a baculovirus vector, for example, the vector may be a pFastBac vector

In certain embodiments, the vector comprises the nucleotide sequence set forth in SEQ ID No. 14 or a nucleotide sequence having at least 50%, 60%, 70%, 80%, 81%, 82%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID No. 14.

In certain embodiments, the cell comprises an insect cell. For example, the cells may be Sf9 cells.

In certain embodiments, the gene of interest comprises at least one nucleotide sequence encoding a gene product of interest expressed in a mammalian cell.

In certain embodiments, wherein the first ITR comprises at least one promoter with the gene of interest.

In certain embodiments, wherein at least one eukaryotic promoter is included between the first ITR and the gene of interest.

In certain embodiments, wherein the first ITR comprises at least one mammalian cell promoter with a gene of interest.

In certain embodiments, at least one nucleotide sequence encoding a gene product of interest expressed in a mammalian cell is operably linked to at least one mammalian cell-compatible expression control sequence, such as a promoter. Many such promoters are known in the art. Constitutive promoters, such as the CMV promoter, which are widely expressed in a wide variety of cells, can be used. In other embodiments, the promoter is inducible, tissue-specific, cell type-specific, or cell cycle-specific. For example, for liver-specific expression, the promoter may be selected from the group consisting of a 1-antitrypsin promoter, thyroid hormone binding globulin promoter, albumin promoter, LPS (thyroxine binding globulin) promoter, HCR-Ap0CII hybrid promoter, HCR-hAAT hybrid promoter and apolipoprotein E promoter. Other examples include the E2F promoter for tumor-selective, in particular neuronal tumor-selective expression (Parr et al, 1997, nat. Med.3:1145-9) or the IL-2 promoter for use in mononuclear blood cells (Hagenbaugh et al, 1997, J Exp Med; 185: 2101-10).

In certain embodiments, wherein the first ITR comprises a mammalian cell promoter and an insect cell promoter.

In certain embodiments, the promoter comprises CMV and p10 promoters.

Insect cell

In another aspect, the present application provides an insect cell comprising a first nucleotide sequence encoding a first amino acid sequence comprising a nucleotide sequence encoding a Rep78 protein and a second nucleotide sequence encoding a Rep52 protein, wherein the first nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 11 or a nucleotide sequence having at least 50%, 60%, 70%, 80%, 81%, 82%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO. 11 and the second nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 12 or a nucleotide sequence having at least 50%, 60%, 70%, 80%, 81%, 82%, 85%, 90%, 95%, 97% sequence identity to SEQ ID NO. 12, A nucleotide sequence with 98% or 99% sequence identity.

For example, the cell line used may be from Spodoptera frugiperda (Spodoptera frugiperda), a Drosophila cell line, or a mosquito cell line, such as an Aedes albopictus (Aedesalbopictus) derived cell line. Preferred insect cells or cell lines are cells from insect species susceptible to infection by baculovirus, including for example Se301, SeIZD2109, SeUCRU Sf9, Sf900+, Sf21, BT1-TN-5Bl-4, MG-l, Tn368, HzAml, Ha2302, Hz2E5, High Five (Invitrogen, CA, USA) and (

US

6, 103, 526; Protein Sciences Corp., CT, USA).

In certain embodiments, wherein the first and second nucleotide sequences are part of one nucleic acid construct, each of the first and second nucleotide sequences is operably linked to an expression control sequence for expression by an insect cell.

In certain embodiments, wherein the insect cell further comprises: a third nucleic acid sequence comprising at least one parvoviral Inverted Terminal Repeat (ITR) nucleotide sequence.

In the present application, the term "parvoviral ITR" is generally understood to mean a palindromic sequence containing a majority of complementary, symmetrically arranged sequences, also referred to as and "C" regions. The ITRs function as origins of replication, a site that has a "cis" effect in replication, i.e., as recognition sites for trans-acting replication proteins, such as Rep78 (or Rep68), that recognize the palindrome and specific sequences within the palindrome. One exception to the symmetry of the ITR sequences is the "D" region of the ITRs. It is unique (no complementary sequence within one ITR). The cleavage of the single-stranded DNA occurs at the junction between the A-and D-regions. It is the region where new DNA synthesis starts. The D region is typically located on one side of the palindrome and provides directionality to the nucleic acid replication steps. Parvoviruses that replicate in mammalian cells typically contain two ITR sequences. However, it is possible to design an ITR such that the binding sites are symmetrically distributed on both strands of the A and D regions, one on each side of the palindrome. Thus, on a double stranded circular DNA template (e.g., a plasmid), Rep78 or Rep68 assisted nucleic acid replication proceeds in both directions, and a single ITR sequence is sufficient for parvoviral replication of the circular vector. Thus, an ITR nucleotide sequence can be used in the context of the present invention. Preferably, however, two or other even number of regular ITRs are used. Most preferably, two ITR sequences are used. In one embodiment, the parvoviral ITRs are AAV ITRs.

In the present application, the term "insect cytocompatible vector" is generally understood to mean a nucleic acid molecule capable of productively transforming or transfecting an insect or insect cell. Examples of biological vectors include plasmids, linear nucleic acid molecules, and recombinant viruses. Any vector can be used as long as it is compatible with insect cells. The vector may be integrated into the genome of the insect cell but the vector may also be episomal. The vector need not be permanently present in the insect cell, but also includes transient episomal vectors. The vector may be introduced by any known method, for example by chemical treatment, electroporation or infection of the cells. In some embodiments, the vector is a baculovirus, a viral vector, or a plasmid. For example, the vector may be a baculovirus, i.e. the construct is a baculovirus vector.

In certain embodiments, the nucleic acid construct is a baculovirus vector.

In certain embodiments, the insect cell comprises a baculovirus vector described herein.

For example, the insect cell may comprise 2 different baculoviruses, namely: Bac-Rep: Rep52 and Rep78 containing rAAV, regulated by a Polyhedrin promoter (Polyhedrin promoter) and a p10 promoter, respectively; Bac-Transgene containing Transgene wrapped by rAAV terminal repeat sequence and regulated by mammalian Cytomegalovirus (CMV) promoter.

As another example, the insect cell may comprise 2 different baculoviruses, Bac-Rep: Rep52 and Rep78 containing rAAV, regulated by a Polyhedrin promoter (Polyhedrin promoter) and a p10 promoter, respectively; Bac-Transgene containing Transgene wrapped by rAAV terminal repetitive sequence and regulated by insect p10 and mammalian Cytomegalovirus (CMV) promoter.

In certain embodiments, the nucleotide sequence encoding the gene of interest is positioned such that it can be integrated into the neDNA that replicates in the insect cell. Any nucleotide sequence can be integrated for subsequent expression in mammalian cells transfected with the neDNA produced according to the present invention. It may encode, for example, a nucleotide sequence that expresses an RNAi agent, i.e., an RNA molecule capable of RNA interference, such as shRNA (short hairpin RNA) or siRNA (short interfering RNA).

In certain embodiments, the nucleotide sequence encoding the gene of interest may encode a transposase or a defective transposon of a transposon system, including but not limited to Sleeping Beauty transposons and piggyBac transposons.

In certain embodiments, the nucleotide sequence encoding the gene of interest can encode a gene editor or a DNA template for gene editing mediated homologous recombination, gene editing systems including, but not limited to, CRISPR, TALEN, and classes of single base gene editors.

The product of interest expressed in the mammalian cell may be a therapeutic gene product. The therapeutic gene product may be a polypeptide or RNA molecule (siRNA) or other gene product which when expressed in the target cell provides a desired therapeutic effect, for example to eliminate an unwanted activity, such as to remove an infected cell or to complement a gene defect (such as a defect leading to a loss of enzyme activity). Examples of therapeutic polypeptide gene products include CFTR, factor IX, factor VIII, PAH, lipoprotein lipase (LPL, preferably LPLS 447X; see WO 01/00220), apolipoprotein Al, uridine diphosphate glucuronosyltransferase (UGT), retinitis pigmentosa GTPase regulator interacting protein (RP-GRIP) and cytokines or interleukins such as IL-10. In certain embodiments, examples of the therapeutic gene product include a polypeptide gene therapy product encoding a therapeutic antibody. In certain embodiments, examples of the therapeutic gene product include antigens encoding antibodies that can induce activation of a humoral or cellular immune response in vivo for treatment of infectious diseases and tumors.

In addition, the third nucleotide sequence may further comprise a nucleotide sequence encoding a polypeptide that serves as a marker protein to determine cell transformation and expression. Suitable marker proteins for this purpose are, for example, the fluorescent protein GFP, Luciferase (Luciferase), the selectable marker genes HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418) and dihydrofolate reductase (DHFR) (for selection on methotrexate), CD20 (low affinity nerve growth factor gene). Sources for obtaining these marker genes and methods of their use are described in Sambrook and Russel (2001) "Molecular Cloning, Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory Press, New York.

In addition, the third nucleotide sequence defined herein above may contain a nucleotide sequence encoding a polypeptide that can be used as a fail-safe mechanism, which polypeptide allows, when deemed necessary, curing of the subject with the cells transduced with the neDNA of the present invention. This nucleotide sequence, commonly referred to as a suicide gene, encodes a protein that is capable of converting a prodrug into a toxic substance that is capable of killing the transgenic cells in which the protein is expressed. Suitable examples of such suicide genes include, for example, the E.coli cytosine deaminase gene or one of the thymidine kinase genes of herpes simplex virus, cytomegalovirus and varicella zoster virus, in which ganciclovir can be used as a prodrug to kill transgenic cells in a subject (see, e.g., Clair et al 1987, Antimicrob. Agents Chemother.31: 844-849).

In another embodiment, a gene product of interest can be an AAV protein. In particular Rep proteins, such as Rep78 and/or Rep52, or functional fragments thereof. Expression of Rep78 and/or Rep52 in ne DNA transduced or infected mammalian cells may facilitate certain applications of the recombinant parvoviral (rAAV) vector by allowing long-term or permanent expression of other gene products of interest introduced into the cells via the vector.

Use of

In certain embodiments, the method of making comprises:

1) providing a baculovirus expression system as described herein;

2) inserting a gene sequence of interest into the second baculovirus vector;

5) collecting the target nucleic acid molecule.

In a specific operation, 2 kinds of baculovirus are first infected with Spodoptera frugiperda (Sf9) cells respectively and then amplified, and the purified 2 kinds of baculovirus co-infected insect-producing cells are cultured in suspension. The parameters of infected cell quantity, survival rate, ne DNA yield and the like are regularly detected in the production process so as to optimize the production process. After harvesting cells and extracting and purifying the neDNA at an optimum period of time, the yield and quality of the neDNA were examined.

The present application also provides the following embodiments:

1. an isolated nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO 12.

2. An isolated nucleic acid molecule according to embodiment 1, encoding an adeno-associated virus (AAV) Rep52 protein.

3. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the adeno-associated virus (AAV) Rep78 protein and a nucleotide sequence encoding the Rep52 protein, wherein the nucleic acid molecule encoding the Rep52 protein comprises the nucleotide sequence set forth in SEQ ID No. 12.

4. An isolated nucleic acid molecule according to embodiment 3, wherein the nucleotide sequence encoding the Rep78 protein is wild-type.

5. An isolated nucleic acid molecule according to embodiment 3, wherein the nucleic acid molecule encoding Rep78 protein comprises the nucleotide sequence set forth in SEQ ID NO. 11.

6. An isolated nucleic acid molecule according to any one of embodiments 3-5, further comprising a first promoter that initiates transcription of the nucleotide sequence encoding the AAV Rep78 protein and a second promoter that initiates transcription of the nucleic acid molecule encoding the AAV Rep52 protein, the first promoter being the same as or different from the second promoter.

7. The isolated nucleic acid molecule of embodiment 6, wherein the first and second promoters comprise insect cell promoters.

8. The isolated nucleic acid molecule according to any one of embodiments 6-7, wherein the first promoter comprises a strong promoter.

9. The isolated nucleic acid molecule of any one of embodiments 6-8, wherein said first promoter has the same or greater transcriptional initiation capability as said second promoter.

10. The isolated nucleic acid molecule according to any one of embodiments 6-9, wherein the first and second promoters are each independently selected from the group consisting of: the p10 promoter, the polyhedrin (polh) promoter, and the IE1 promoter.

11. The isolated nucleic acid molecule according to any one of embodiments 6-10, wherein the direction of transcription of the first and second promoters is the same or opposite.

12. An isolated nucleic acid molecule according to any one of embodiments 6-11, wherein the first promoter is operably linked to the nucleotide sequence encoding Rep78 protein and the second promoter is operably linked to the nucleotide sequence encoding Rep52 protein.

13. An isolated nucleic acid molecule according to any one of embodiments 11-12, which comprises, in order, the first promoter, a nucleotide sequence encoding a Rep78 protein, the second promoter, and a nucleotide sequence encoding a Rep52 protein when the first promoter and the second promoter are transcribed in the same direction.

14. The isolated nucleic acid molecule according to embodiment 13, wherein the nucleotide sequence encoding Rep78 protein and the nucleotide sequence encoding Rep52 protein further comprise downstream a nucleotide sequence encoding polyA (pA), respectively.

15. An isolated nucleic acid molecule according to embodiment 14, which comprises, in order, the first promoter, the nucleotide sequence encoding Rep78 protein, the first pA, the second promoter, the nucleotide sequence encoding Rep52 protein, and the second pA when the first promoter and the second promoter are in the same direction of transcription.

16. An isolated nucleic acid molecule according to any one of embodiments 11-12, which comprises in order, when the direction of transcription of the first promoter and the second promoter is reversed, a nucleotide sequence encoding Rep78, the first promoter, the second promoter, a nucleotide sequence encoding Rep52, wherein the first promoter initiates transcription of the nucleotide sequence encoding Rep78 protein and the second promoter initiates transcription of the nucleotide sequence encoding Rep52 protein.

17. The isolated nucleic acid molecule of embodiment 16, wherein the 5 'end of the first promoter is linked directly or indirectly to the 5' end of the second promoter.

18. The isolated nucleic acid molecule according to embodiment 17, wherein the 3 'end of said first promoter is directly or indirectly linked to the 5' end of said nucleotide sequence encoding Rep 78.

19. The isolated nucleic acid molecule according to embodiment 18, further comprising a first pA, wherein the 3 'end of the nucleotide sequence encoding Rep78 protein is linked directly or indirectly to the 5' end of the first pA.

20. The isolated nucleic acid molecule according to embodiment 16, wherein the 3 'end of the second promoter is directly or indirectly linked to the 5' end of the nucleotide sequence encoding Rep 52.

21. The isolated nucleic acid molecule according to embodiment 20, further comprising a second pA, wherein the 3 'end of the nucleotide sequence encoding Rep52 protein is linked directly or indirectly to the 5' end of the second pA.

22. The isolated nucleic acid molecule according to any one of embodiments 14-21, wherein the pA is selected from the group consisting of: any one of SV40 polyA and HSV TK polyA.

23. The isolated nucleic acid molecule according to any one of embodiments 3-22, comprising the nucleotide sequence set forth in SEQ ID No. 8.

24. An isolated nucleic acid molecule comprising, in order, a first polyA (pA), a nucleotide sequence encoding a Rep78 protein, a first promoter, a second promoter, a protein nucleotide sequence encoding a Rep52, and a second polyA (pA), wherein the first promoter is a nucleotide sequence encoding a Rep78 protein and a transcription promoter of first pA, and the second promoter is a nucleotide sequence encoding a Rep52 protein and a transcription promoter of second polyA, wherein the nucleotide sequence encoding a Rep52 protein and/or the sequence of nucleotide sequence encoding a Rep78 protein is codon optimized to avoid homologous recombination, the first and second promoters comprising insect cell promoters, the first promoter being a strong promoter.

25. The isolated nucleic acid molecule of embodiment 24, wherein the first promoter comprises a p10 promoter, a polh promoter, or an IE1 promoter.

26. The isolated nucleic acid molecule of embodiment 25, wherein the p10 promoter comprises the nucleotide sequence set forth in SEQ ID No. 9.

27. The isolated nucleic acid molecule of embodiment 24, wherein the second promoter comprises a p10 promoter, a polh promoter, or an IE1 promoter.

28. The isolated nucleic acid molecule of embodiment 27, wherein the polh promoter comprises the nucleotide sequence set forth in SEQ ID No. 10.

29. A vector comprising the isolated nucleic acid molecule of any one of embodiments 1-28.

30. The vector of embodiment 29, comprising a viral vector.

31. The vector of embodiment 29, comprising a baculovirus vector.

32. The vector of embodiment 29, comprising a pFastBac vector.

33. The vector according to any one of embodiments 29-32, comprising the nucleotide sequence set forth in SEQ ID No. 14.

34. A cell comprising the isolated nucleic acid molecule of any one of embodiments 1-28 or the vector of any one of embodiments 29-33.

35. The cell of embodiment 34, comprising an insect cell.

36. The cell of embodiment 35, comprising a Spodoptera frugiperda (Sf9) cell.

37. A baculovirus expression system comprising a first baculovirus vector which is the baculovirus vector of any one of embodiments 31-33 and a second baculovirus vector comprising a nucleic acid sequence encoding a gene of interest.

38. The baculovirus expression system of claim 37, from 5 'to 3', the nucleic acid sequence encoding a gene of interest comprising in order Inverted Terminal Repeat (ITR) of a first parvovirus, a gene of interest and a second ITR.

39. The baculovirus expression system of any one of embodiments 38, wherein said first ITR further comprises at least one promoter with a gene of interest.

40. The baculovirus expression system of any one of claims 38-39 wherein at least one eukaryotic promoter is further comprised between the first ITR and a gene of interest.

41. The baculovirus expression system of any one of embodiments 38-40 wherein at least one mammalian cell promoter is further comprised between the first ITR and a gene of interest.

42. The baculovirus expression system of any one of embodiments 38-41 wherein said first ITR further comprises a mammalian cell promoter and an insect cell promoter between said first ITR and a gene of interest.

43. The baculovirus expression system of any one of embodiments 42, wherein said mammalian cell promoter comprises a broad promoter and a tissue-specific promoter.

44. The baculovirus expression system of embodiment 43, wherein the broad promoter comprises a CMV, SV40, EF1a, CAG, or UBC promoter.

45. The baculovirus expression system of claim 43, wherein the tissue-specific promoter comprises an ALB, hAAT, TBG, TTR, GFAP, MHCK7, or hSyn promoter.

46. The baculovirus expression system of any one of embodiments 42-25 wherein the insect cell promoter includes a p10 promoter.

47. The baculovirus expression system of any one of embodiments 42-26, said promoters comprising CMV and p10 promoters.

48. An insect cell comprising a first nucleotide sequence encoding a first amino acid sequence comprising a nucleotide sequence encoding a Rep78 protein and a second nucleotide sequence encoding a Rep52 protein, wherein the first nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 11 and the second nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 12.

49. An insect cell according to embodiment 48, wherein the first and second nucleotide sequences are part of one nucleic acid construct, wherein the first and second nucleotide sequences are each operably linked to an expression control sequence for expression in the insect cell.

50. The insect cell of any one of embodiments 48-49, wherein the insect cell further comprises: a third nucleic acid sequence comprising at least one Inverted Terminal Repeat (ITR) of a parvovirus.

51. An insect cell according to embodiment 50, wherein the third nucleotide sequence further comprises at least one nucleotide sequence encoding a gene of interest.

52. An insect cell according to any one of embodiments 50-51, wherein the third nucleotide sequence comprises two parvoviral ITR nucleotide sequences, and wherein the at least one nucleotide sequence encoding a gene of interest is located between the two parvoviral ITR nucleotide sequences.

53. An insect cell according to embodiment 52, wherein the parvovirus comprises an adeno-associated virus.

54. An insect cell according to any one of embodiments 51-53, wherein the third nucleotide sequence is part of another nucleic acid construct, wherein each of the nucleotide sequences encoding a gene of interest is operably linked to an expression control sequence for mammalian expression.

55. The insect cell of any one of embodiments 49-54, wherein the nucleic acid construct is an insect cell-compatible vector.

56. The insect cell of embodiment 55, wherein the nucleic acid construct is a baculovirus vector.

57. An insect cell according to any one of embodiments 48-56, comprising a baculovirus vector according to any one of embodiments 31-33 or a baculovirus expression system according to any one of embodiments 37-47.

58. Use of a baculovirus expression system as defined in any one of embodiments 37 to 47 or an insect cell as defined in any one of embodiments 48 to 57 in the preparation of a nucleic acid molecule of interest.

59. The use of embodiment 58, wherein the nucleic acid molecule of interest is a linear DNA molecule (neDNA) having covalently closed ends.

60. A method for producing a nucleic acid molecule of interest, comprising culturing an insect cell according to any one of embodiments 48-57.

61. The method of making of embodiment 60, comprising:

1) providing a baculovirus expression system as defined in any one of claims 37 to 47;

2) inserting a gene sequence of interest into the second baculovirus vector;

5) collecting the target nucleic acid molecule.

62. The method of preparation according to embodiment 62, further protecting isolating the nucleic acid molecule of interest.

63. A kit comprising an isolated nucleic acid molecule of any one of embodiments 1-28, a baculovirus expression system of any one of embodiments 37-47, and/or an insect cell of any one of embodiments 48-57.

Without wishing to be bound by any theory, the following examples are merely intended to illustrate the nucleic acid molecules, vectors, expression systems, methods of preparation and use, etc. of the present application and are not intended to limit the scope of the invention of the present application.

Examples

Example 1

First, experiment method

The technology described herein involves the use of an insect cell-baculovirus system to prepare a linear double-stranded endless dna (neDNA) expression vector containing AAV Inverted Terminal Repeats (ITRs) and a gene expression cassette (exemplified herein by the EGFP expression cassette). An exemplary synthetic method using the neDNA vector disclosed herein involves several major steps:

1. vector construction

1.1 construction of pFastBac-ITR-EGFP Donor vector

The plasmid pAAV-CMV-P10-EGFP is used as a template, a CMV-P10-EGFP sequence is amplified through PCR, an upstream primer and a downstream primer are respectively P1 and P2 (see table 1), and the gene is cloned to a vector pFastBac-AAV-MCS-PA through enzyme cutting sites 5 'BamHI and 3' SalI to construct a plasmid pFastBac-ITR-EGFP.

Wherein, the pAAV-CMV-p10-EGFP vector is obtained by synthesizing a CMV-p10 sequence [ SEQ ID No:1] through genes, adding 5 'KpnI and 3' NcoI enzyme cutting sites, and performing enzyme cutting connection and insertion into the pAAV-EGFP vector [ SEQ ID No:2 ];

the pFastBac-AAV-MCS-PA vector is obtained by gene synthesis of an ITR-MCS-PA-ITR sequence [ SEQ ID No. 3], addition of 5 'KpnI and 3' HindIII enzyme cutting sites, enzyme cutting connection and insertion into a pFastBac dual vector [ SEQ ID No. 4 ].

1.2 construction of pFastBac-ITR-Fluc Donor plasmid

Through gene synthesis of CpGfreeFluc sequence [ SEQ ID No:5], and addition of 5'SalI and 3' PmlI enzyme cutting sites, enzyme cutting connection insertion of pFastBac-AAV-MCS-PA, pFastBac-CpGfreeFluc is constructed.

Table 1: primer sequences

Name of primer	Sequence (5 '-3')	SEQ ID NO:
			P1	GATCCGGTACCACGCGTCTAG	15
P2	CTCGACGTCGACTTTACTTGTACAGC	16
			P3	GCGGGGTTTTACGAGATTGTG	17
P4	GGGGTGCCTGCTCAATCAGA	18
			P5	GCAGCACACACTGACATCCA	19
P6	GATCACCGGCGCATCAGAATTG					20
			P7	ACTTCAAGATCCGCCACAACAT	21
P8	TCTCGTTGGGGTCTTGCTCAG	22
			M13F	CCCAGTCACGACGTTGTAAAACG	23
M13R	AGCGGATAACAATTTCACACAGG	24

1.3 construction of pFastBac-RepFastBac and pFastBac-inRep helper vectors

The gene Rep52WT [ SEQ ID No:13] was synthesized, and cloned into the vector pFastBac-Rep by 5 'XmaI and 3' NheI to construct the plasmid pFastBac-RepEWT. The gene inRep [ SEQ ID No:6] was synthesized, and the gene was cloned into the vector pFastBac dual by 5 'BstZ 17I and 3' SphI to construct the plasmid pFastBac-inRep.

1.4 Rep52 codon optimization and construction of pFastBac-CORep helper vector

Sf9 insect cell transcriptome sequencing data were extracted from the NCBI database and codon preference adaptive index and codon background parameters were captured. After the initial Rep52WT sequence is input, a codon optimization algorithm is used for randomly generating a progeny sequence, and iteration is carried out in a circulating mode until the result is converged to obtain a candidate codon optimization gene sequence. In order to avoid homologous recombination, the nucleotide sequences of continuous bases are selected to be candidate sequences with the same number of less than or equal to 30 and the homology of less than or equal to 85 percent, and subsequent experiments are carried out to verify, and finally the Rep52 codon optimized sequence is obtained.

A gene Rep52 codon optimized sequence Rep52-CO [ SEQ ID No:12] was synthesized, and the gene was cloned into a vector pFastBac-Rep by 5 'XmaI and 3' NheI to construct a plasmid pFastBac-CORep.

1.5 construction of pFastBac-p10Rep auxiliary vector

Gene p10[ SEQ ID No:9] was synthesized conventionally, 5 'BstZ 17I and 3' NotI were added, and the gene was cloned into vector pFastBac-CORep via 5 'BstZ 17I and 3' NotI to construct plasmid pFastBac-p10 Rep.

2. Plasmid transformation DH10 Bac

The donor plasmids pFastBac-ITR-EGFP or pFastBac-ITR-Fluc and helper plasmids (pFastBac-RepWT, pFastBac-inRep, pFastBac-CORep or pFastBac-p10Rep plasmids) were transformed into DH10 Bac E.coli competent cells (Solebao, cat # C1480), respectively. Inducing the recombination between the plasmid in the DH10 Bac cell and Bacmid baculovirus shuttle plasmid to generate recombinant Bacmid baculovirus plasmid. The product of the phi 80dlacZ delta M15 gene in DH10 Bac cells can realize the alpha-complementation phenomenon of beta-galactosidase and is used for carrying out blue-white spot screening of recombinant Bacmid on LB solid medium (kanamycin (50 mu g/ml), tetracycline (10 mu g/ml), gentamicin (7 mu g/ml), IPTG (40 mu g/ml) and X-gal (100 mu g/ml)); white single colonies resulting from translocation disrupting the β -galactosidase indicator gene were selected and cultured overnight at 37 ℃ in LB medium (kanamycin (50. mu.g/ml), tetracycline (10. mu.g/ml) and gentamicin (7. mu.g/ml)); using PureLink^TMHiPure Plasimd DNA Miniprep Kit (Saimeishefei, cat # K2100-02) extracts recombinant Bacmid in E.coli.

3. PCR identification of recombinant Bacmid rod-shaped plasmid

The recombinant Bacmid plasmid was identified by PCR using the universal primer M13F/R on Bacmid (see Table 1). The conditions for PCR amplification were: 2min at 98 ℃; 10s at 98 ℃, 30s at 60 ℃ and 1min at 72 ℃ for 35 cycles; 5min at 72 ℃. After the PCR is finished, an agarose gel electrophoresis experiment is carried out to determine the size of the target band.

4. Acquisition of P0 Generation recombinant baculovirus

Respectively using Expifeacmine to identify correctly identified recombinant rod-shaped plasmids Bacmid-ITR-EGFP, Bacmid-ITR-Fluc, Bacmid-RepWT, Bacmid-inRep, Bacmid-CORep and Bacmid-p10Rep^TM Sf TransfectionTransfection reagent (Saimeifei, cat # A38915) transfection of Sf9 cells (Saimeifei, cat # 11496-₂Incubation at constant temperature), 3ml of Sf900 per well^TMIII SFM^TMThe medium (Saimeifei, cat. No.: 12658-⁶Sf9 cells, and continuing to culture for 72-96h, when the cells have a vacuole-shaped structure and tend to be cracked, centrifugally collecting cell culture supernatant (500g, 5min) and passing through a 0.22 μm filter to obtain P0 generation baculovirus, which can be stored at 4 ℃ in a dark place.

The titer of recombinant baculovirus was determined using plaque assay, depending on the replication of the virus in infected cells and the formation of focal lesions by infecting peripheral cells. Sf9 cells were plated at 1x 10⁶Cell mass was pre-plated in cell 6-well plates with Sf900^TMIII SFM^TMThe culture medium was 10-fold diluted serially with P0 generation baculovirus stock solutions, respectively^-1To 10^-8Dilutions, each dilution having a volume of 5 ml. 1ml of each dilution was added to the above cell 6-well plate, 2 replicate assay wells were set for each dilution, and incubated at 27 ℃ for 1 h. 10ml of 4% agar solution was thoroughly mixed with 30ml of Sf-900 medium (1.3X) (Samerfei, cat. No.: 10967-032), and placed in a water bath at 40 ℃ until use. Completely absorbing and removing the virus diluent in the 6-well plate, spreading the agar solution with the concentration of 2 ml/well, incubating at room temperature for 1h, and transferring the cell culture plate to an incubator with the temperature of 27 ℃ for further incubation after the agar is completely solidified. After 7-10 days, small and white spots can be seen by naked eyes to be virus plaques, and agar in a 6-well plate can be stained by using 1mg/ml neutral red dye, so that the number of the plaques can be counted more clearly. The number of single visible plaques at each dilution was counted and the virus titer was calculated using the following formula:

and simultaneously, carrying out real-time quantitative PCR detection by using a SYBR dye method, and detecting the copy number of the recombinant baculovirus foreign gene to determine the titer of the recombinant baculovirus. The P0 generation baculovirus genomic DNA was extracted using the GeneJET Viral DNA and RNA Purification Kit (Sermer fly, cat # K0821), the Viral DNA was dissolved in TE solution, and stored at-80 ℃ for further use. qPCR primers were designed from the EGFP, RepWT, inRep, CORep and P10Rep sequences, respectively, with the RepWT, CORep and P10Rep sequences sharing primers P3 and P4, the inRep sequence primers being P5 and P6, and the EGFP sequence primers being P7 and P8 (see Table 1 for primer sequence information). The real-time quantitative PCR system comprises: 25. mu.l of a SYBR dye premix, 2. mu.l each of the upstream and downstream primers (10 μm), 5. mu.l of a sample solution, and 16. mu.l of distilled water. PCR reaction procedure: pre-denaturation at 95 ℃ for 60s, 95 ℃ for 15s, 60 ℃ for 15s, 72 ℃ for 45s, and 40 cycles; and (4) analyzing a dissolution curve. 3 replicate assay tubes were set for each sample. According to the corresponding relation between the concentration of the standard curve and the Ct value (threshold cycle, cycle of threshold, Ct), the initial concentration of each sample to be detected can be determined.

5. Amplification of recombinant baculovirus

Usually the P0 generation baculovirus is small in volume and low in titer, and Sf9 cells need to be infected continuously to obtain high titer baculovirus. Initial P0 baculovirus titers were at 1x 10⁶To 1x 10⁷pfu/ml (plaque forming units, pfu), titer of baculovirus P1 passage after amplification was 1 × 10⁷To 1x 10⁸pfu/ml. A125 ml cell shake flask containing 30ml Sf9 cells (27 ℃, 130rpm) with a cell density of 2 x 10⁶The cells are infected by P0 baculovirus with MOI of 0.1; culturing for 72-96h, when the dead cell number reaches 60-80%, centrifuging to collect cell culture supernatant (500g, 5min) and passing through 0.22 μm filter to obtain P1 generation baculovirus. High titer P2 virus was obtained following the same procedure described above. Viral titers were determined using real-time quantitative fluorescent PCR method and plaque method (supra).

6. Identification of Bac-p10Rep protein expressed by baculovirus

The expression of Rep protein was examined using Western Blotting (WB). The Sf9 cells were infected with the P2-P5 virus at MOI of 3, and the cell samples were collected by centrifugation. Protein supernatants were prepared by lysing cells using 1x SDS solution. Carrying out electrophoresis by using SDS-PAGE, and transferring a protein sample to a nitrocellulose membrane after the electrophoresis is finished; rep protein expression was detected using an anti-AAV Rep mouse monoclonal antibody (ARP, cat # 03-65171), and the stability of Rep protein expression was examined, i.e., Rep protein expression was observed in P2, P3, P4 and P5-generation baculoviruses.

7. Preparation of neDNA-ITR-EGFP and neDNA-ITR-Fluc expression vectors

P2 generation two recombinant baculovirus BacV-ITR-EGFP or BacV-ITR-Fluc and BacV-Rep co-infect 2 x 10 according to MOI 1-5 (selecting proper MOI parameter)⁶Sf9 insect cells/ml, continuously culturing for 72-96h, and collecting cells (500g, 5min) when the cell diameter is 18-20 μm and the cell viability is about 80%. A DNA having a small molecular weight in Sf9 cells was extracted using QIAGEN plasmid extraction kit (cat. No.: 12163).

8. Expression ability of neDNA in HEK293T cells

The neDNA-ITR-EGFP was transfected into HEK293T cells using LipoFectamine 2000 transfection reagent (Series fly, cat # 11668-019) (using high-glucose DMEM medium (Gibco, cat # 11965-092) containing 10% fetal bovine serum at 37 ℃ with 5% CO₂Culture under the condition), and after 72h, observing the expression condition of EGFP by using a fluorescence microscope.

9. Ability of nano-lipid particle (lipid nanoparticle) to deliver neDNA expression in C57BL/6 mice

Dissolving 1mg of neDNA-ITR-Fluc in a sodium acetate-acetic acid buffer solution to obtain an aqueous phase mixed solution; dissolving ionizable cationic lipid Dlin-MC3-DMA, dioleoylphosphatidylcholine DOPC, cholesterol and PEG lipid in ethanol at a ratio of 50:10:38:2 to obtain lipid phase mixed solution; the aqueous and lipid phases were mixed using Precision Nanosystems Ignite microfluidic chips and dialyzed against neutral phosphate buffer to obtain a suspension of LNP-DNA complex in neutral buffer. C57BL/6 mice were injected tail vein at a dose of 2 mg/kg. When the neDNA-ITR-Fluc mediated gene expression is observed, 150mg/kg of luciferase substrate luciferin is injected intraperitoneally in a mouse, and a fluorescence signal is observed on a Xenogen IVIS Spectrum small animal living body imager.

Second, experimental results

1. Preparation of Donor plasmids and baculoviruses

An EGFP gene expression frame containing ITR sequences at two ends is inserted into the plasmid pFastBac to obtain a recombinant plasmid pFastBac-ITR-EGFP (shown in figure 1A).

The helper plasmids pFastBac-p10Rep (FIG. 1B, SEQ ID NO:14) were constructed, with p10 being the promoter of Rep78-WT and polh being the promoter of Rep 52-CO. A helper plasmid, pFastBac-RepFTT, was constructed in which Δ IE1 is the promoter of Rep78 and polh is the promoter of Rep52 WT. Construction of the helper plasmid pFastBac-inRep, in the same expression frame, where p10 is the Rep78 promoter and an artificially synthesized Intron (Intron) sequence (containing polh promoter) between Rep78 and Rep52, as the promoter for Rep52, was based on the work of Haifeng Chen 2008. Construction of helper plasmid pFastBac-CORep, Δ IE1 is the promoter of Rep78 and polh is the promoter of Rep 52-CO. FIG. 2 is a schematic diagram of the transcription of the p10Rep gene, RepWT gene, inRep gene and CORep gene.

And (3) respectively transforming the donor plasmid (pFastBac-ITR-EGFP) and different auxiliary plasmids into a DH10 Bac escherichia coli competent cell, carrying out blue-white spot screening to obtain Bacmid-ITR-EGFP and Bacmid-Rep, and further screening the recombinant Bacmid with correct sequence through PCR. And (3) transfecting the Sf9 cells by the recombinant Bacmid respectively to obtain recombinant baculovirus BacV-ITR-EGFP and BacV-Rep.

2. Expression of Rep protein in insect cell Sf9

Rep proteins expressed by BacV-p10Rep infected Sf9 cells were detected with a mouse monoclonal antibody against anti-AAV Rep (ARP, cat # 03-65171), while non-infected Sf9 cells were used as a negative control. Using BacV-RepWT^[1]，BacV-inRep^[2]And BacV-CORep (Rep 52 sequence in optimized RepWT) as a control. P1 BacV-Rep baculoviruses were obtained by sequential infection of Sf9 cells at MOI ═ 0.1, yielding P2, P3, P4, and P5 baculoviruses, respectively. Sf9 cells were infected with P2-P5 BacV-Rep with MOI ═ 3, respectively, cell samples were collected, expression of Rep proteins was detected with WB, and stability of Rep protein expression in different generations of baculoviruses was examined, as shown in fig. 3.

3. Preparation of neDNA-ITR-EGFP Gene expression vector

A P2 generation two recombinant baculovirus BacV-ITR-EGFP and BacV-Rep co-infect Sf9 insect cells according to MOI of 3, culture is carried out for 72-96h, when the cell diameter is 18-20 mu m and the cell survival rate is about 80%, the cells are collected, and a small molecular weight neDNA-ITR-EGFP gene expression vector is extracted. The band size of the neDNA was identified by electrophoresis using 0.8% agarose gel, with the main bands at 2.7kb and 5.4kb, corresponding to monomer and dimer of the neDNA-ITR-EGFP expression vector, respectively. The bands above the dimer can be extrapolated to trimer and multimer by size, as shown in FIG. 4.

The digestion of the neDNA with SalI single restriction enzyme yielded 2kb, 0.7kb bands, consistent with the expected monomeric size of the digested fragment, as shown in FIGS. 5A-B, with the 5A. neDNA-EGFP monomeric fragment 2.7kb long, and the SalI restriction enzyme cleaved the monomeric fragment into 2kb and 0.7kb sized fragments. Dimers have a "head-to-head, tail-to-tail" structure and can be cleaved into fragments of 2kb and 1.4kb size or fragments of 4kb and 0.7kb size. The dark blue rectangles indicate 5 'ITR sequences, and the light blue rectangles indicate 3' ITR sequences.

The expression yields of the different Rep protein-driven neDNA-ITR-EGFP gene expression vectors are different, and compared with the expression yields of the RepWT, inRep and CORep-driven neDNA-ITR-EGFP gene expression vectors, the expression yield of the p10 Rep-driven neDNA-ITR-EGFP gene expression vector is about: every 6 x 10⁷Sf9 cells can express nearly 270. mu.g of neDNA gene expression vector, which is 2-3 times of other three groups, and the details are shown in Table 2.

Table 2: yield of neDNA

4. HEK293 cell transfected by neDNA-ITR-EGFP gene expression vector

The neDNA-ITR-EGFP was transfected into HEK293 cells using LipoFectamine 2000 transfection reagent, and 24h was used to observe EGFP expression using a fluorescence microscope. 72h after transfection, the expression of the neDNA-ITR-EGFP gene expression vector in HEK293 cells is shown in FIG. 6.

5. Expression vector of neDNA-ITR-Fluc gene for expressing luciferase in mice

And (3) constructing Bacmid-ITR-Fluc and Bacmid-p10Rep by using donor plasmids pFastBac-ITR-Fluc and an auxiliary plasmid pFastBac-p10Rep to obtain recombinant Bacmid-ITR-Fluc and BacV-p10Rep, and preparing the neDNA-ITR-Fluc gene expression vector. In vivo, in mice injected with nano-lipid particles (LNP) to deliver neDNA-ITR-Fluc tail vein into C57BL/6, stable luciferase expression in mouse liver was observed at 24h, as shown in FIG. 7.

In summary,

the present application provides a method for producing a neDNA using an insect cell-baculovirus expression system, the neDNA produced using the method having various configurations such as: monomers, dimers, trimers, and multimers, among others. In mouse experiments, neDNA mediates long-term expression of the gene expression cassette of interest (e.g., liver) compared to plasmid DNA.

The method optimizes a Rep protein expression vector and improves the stability of Rep protein expression, thereby preparing a product with improved yield of neDNA and the stability of a production system, wherein p10Rep is an optimized expression frame, and a complete p10 promoter improves the expression quantity of Rep 78; after the Rep52 sequence is optimized by codons, the homologous recombination of the Rep78 and the Rep52 is avoided.

Compared with other Bac-Rep and Bac-EFGP co-infected Sf9 cells, the Bac-p10Rep has the highest yield of neDNA and the yield is improved by 2-3 times on average.

Compared with other Bac-Rep, the Bac-p10Rep has better expression stability of the Rep protein (Rep78) after 3 continuous baculovirus passages.

Reference documents:

[1]Masashi Urabe,Chuantian Ding,Robert M Kotin.Insect cells as a factory to produce adeno-associated virus type 2 vectors.Hum Gene Ther,2002,13(16):1935-43.

[2]Haifeng Chen.Intron splicing-mediated expression of AAV Rep and Cap genes and production of AAV vectors in insect cells.Mol Ther,2008,16(5):924-30.

sequence listing

<110> Bohai Biotech Co., Ltd

<120> baculovirus vectors and uses thereof

<130> 0251-PA-002

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 1097

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> CMV-p10

<400> 1

ggtaccacgc gtctagttat taatagtaat caattacggg gtcattagtt catagcccat 60

atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg 120

acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt 180

tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag 240

tgtatcatat gccaagtccg ccccctattg acgtcaatga cggtaaatgg cccgcctggc 300

attatgccca gtacatgacc ttacgggact ttcctacttg gcagtacatc tacgtattag 360

tcatcgctat taccatgctg atgcggtttt ggcagtacac caatgggcgt ggatagcggt 420

ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc 480

accaaaatca acgggacttt ccaaaatgtc gtaataaccc cgccccgttg acgcaaatgg 540

gcggtaggcg tgtacggtgg gaggtctata taagcagacg tcgtttagtg aaccgtcaga 600

tcactagatg ctttattgcg gtagtttatc acagttaaat tgctaacgcc agtctcgaac 660

ttaacgtgca gaagttggtc gtgaggcact gggcaggtaa gtatcgggcc ctttgtgcgg 720

ggggagcggc tcggggctgt ccgcgggggg acggctgcct tcggggggga cggggcaggg 780

cggggttcgg cttctggcgt gtgaccggcg gctctagagc ctctgctaac catgttcatg 840

ccttcttctt tttcctacag ctcctgggca acgtgctggt tattgtgctg tctcatcatt 900

ttggcaaaga attggatcgg accgaaatta atacgactca ctatagggga attgtgagcg 960

gataacaatt ccccggagtt aatccgggac ctttaattca acccaacaca atatattata 1020

gttaaataag aattattatc aaatcatttg tatattaatt aaaatactat actgtaaatt 1080

acattttatt tacaatc 1097

<210> 2

<211> 5547

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> pAAV-GFP

<400> 2

cagcagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag 60

cctgaatggc gaatggaatt ccagacgatt gagcgtcaaa atgtaggtat ttccatgagc 120

gtttttcctg ttgcaatggc tggcggtaat attgttctgg atattaccag caaggccgat 180

agtttgagtt cttctactca ggcaagtgat gttattacta atcaaagaag tattgcgaca 240

acggttaatt tgcgtgatgg acagactctt ttactcggtg gcctcactga ttataaaaac 300

acttctcagg attctggcgt accgttcctg tctaaaatcc ctttaatcgg cctcctgttt 360

agctcccgct ctgattctaa cgaggaaagc acgttatacg tgctcgtcaa agcaaccata 420

gtacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac 480

cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc 540

cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt 600

tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg 660

gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag 720

tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt 780

ataagggatt ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt 840

taacgcgaat tttaacaaaa tattaacgtt tacaatttaa atatttgctt atacaatctt 900

cctgtttttg gggcttttct gattatcaac cggggtacat atgattgaca tgctagtttt 960

acgattaccg ttcatcgcct gcactgcgcg ctcgctcgct cactgaggcc gcccgggcaa 1020

agcccgggcg tcgggcgacc tttggtcgcc cggcctcagt gagcgagcga gcgcgcagag 1080

agggagtgga attcacgcgt ggtacgatct gaattcggta caattcacgc gtgggtacca 1140

cgcgtctagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga 1200

gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg 1260

cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg 1320

acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca 1380

tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc 1440

ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc 1500

tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc 1560

acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa 1620

tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag 1680

gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc agatcgcctg 1740

gagacgccat ccacgctgtt ttgacctcca tagaagacac cgggaccgat ccagcctcca 1800

ccggttcgcc accatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct 1860

ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg 1920

cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt 1980

gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc 2040

cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga 2100

gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga 2160

gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa 2220

catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga 2280

caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag 2340

cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct 2400

gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg 2460

cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga 2520

gctgtacaag taaagcggcc atcaagctta tcgataccgt cgactagagc tcgctgatca 2580

gcctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc 2640

ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg 2700

cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg 2760

gaggattggg aagacaatag caggcatgct ggggagagat cgatctgagg aacccctagt 2820

gatggagttg gccactccct ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa 2880

ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg agcgagcgag cgcgcagaga 2940

gggagtggcc aacccccccc cccccccccc tgcatgcagg cgattctctt gtttgctcca 3000

gactctcagg caatgacctg atagcctttg tagagacctc tcaaaaatag ctaccctctc 3060

cggcatgaat ttatcagcta gaacggttga atatcatatt gatggtgatt tgactgtctc 3120

cggcctttct cacccgtttg aatctttacc tacacattac tcaggcattg catttaaaat 3180

atatgagggt tctaaaaatt tttatccttg cgttgaaata aaggcttctc ccgcaaaagt 3240

attacagggt cataatgttt ttggtacaac cgatttagct ttatgctctg aggctttatt 3300

gcttaatttt gctaattctt tgccttgcct gtatgattta ttggatgttg gaattcctga 3360

tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatatgg tgcactctca 3420

gtacaatctg ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg 3480

acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct 3540

ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg 3600

gcctcgtgat acgcctattt ttataggtta atgtcatgat aataatggtt tcttagacgt 3660

caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac 3720

attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa 3780

aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat 3840

tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc 3900

agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga 3960

gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg 4020

cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactgagtga 4080

taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt 4140

tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga 4200

agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg 4260

caaactatta actggcgaac tacttactct agcttcccgg caacaattaa tagactggat 4320

ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat 4380

tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc 4440

agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga 4500

tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc 4560

agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag 4620

gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc 4680

gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt 4740

tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt 4800

gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat 4860

accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc 4920

accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa 4980

gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg 5040

ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag 5100

atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag 5160

gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa 5220

cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt 5280

gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg 5340

gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc 5400

tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac 5460

cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca aaccgcctct 5520

ccccgcgcgt tggccgattc attaatg 5547

<210> 3

<211> 925

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ITR-MCS-PA-ITR

<400> 3

ggtaccacat gtcctgcagg cagctgcgcg ctcgctcgct cactgaggcc gcccgggcaa 60

agcccgggcg tcgggcgacc tttggtcgcc cggcctcagt gagcgagcga gcgcgcagag 120

agggagtggc caactccatc actaggggtt cctgcggccg cagatctacc ggtggcgcgc 180

cggatccgaa ttctctagag tcgacgtcga gctagcatcg atgtttaaac gagctcacta 240

gtctcgagac gcgtacgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct 300

ggaagttgcc actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcatttt 360

gtctgactag gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg 420

gcaagttggg aagacaacct gtagggcctg cggggtctat tgggaaccaa gctggagtgc 480

agtggcacaa tcttggctca ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc 540

tcagcctccc gagttgttgg gattccaggc atgcatgacc aggctcagct aatttttgtt 600

tttttggtag agacggggtt tcaccatatt ggccaggctg gtctccaact cctaatctca 660

ggtgatctac ccaccttggc ctcccaaatt gctgggatta caggcgtgaa ccactgctcc 720

cttccctgtc cttctgattt tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc 780

ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga 840

ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc 900

agctgcctgc aggggcgcca agctt 925

<210> 4

<211> 5238

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> pFastBac dual

<400> 4

ttctctgtca cagaatgaaa atttttctgt catctcttcg ttattaatgt ttgtaattga 60

ctgaatatca acgcttattt gcagcctgaa tggcgaatgg gacgcgccct gtagcggcgc 120

attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 180

agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 240

tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 300

ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 360

ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 420

aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 480

ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 540

attaacgttt acaatttcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 600

tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 660

gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 720

tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 780

aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 840

cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 900

agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 960

ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 1020

tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 1080

tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 1140

caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 1200

accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 1260

attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 1320

ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 1380

taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 1440

taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 1500

aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 1560

agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 1620

ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 1680

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 1740

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 1800

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 1860

tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 1920

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 1980

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 2040

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 2100

acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 2160

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 2220

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 2280

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 2340

ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 2400

taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 2460

cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca 2520

tctgtgcggt atttcacacc gcagaccagc cgcgtaacct ggcaaaatcg gttacggttg 2580

agtaataaat ggatgccctg cgtaagcggg tgtgggcgga caataaagtc ttaaactgaa 2640

caaaatagat ctaaactatg acaataaagt cttaaactag acagaatagt tgtaaactga 2700

aatcagtcca gttatgctgt gaaaaagcat actggacttt tgttatggct aaagcaaact 2760

cttcattttc tgaagtgcaa attgcccgtc gtattaaaga ggggcgtggc caagggcatg 2820

gtaaagacta tattcgcggc gttgtgacaa tttaccgaac aactccgcgg ccgggaagcc 2880

gatctcggct tgaacgaatt gttaggtggc ggtacttggg tcgatatcaa agtgcatcac 2940

ttcttcccgt atgcccaact ttgtatagag agccactgcg ggatcgtcac cgtaatctgc 3000

ttgcacgtag atcacataag caccaagcgc gttggcctca tgcttgagga gattgatgag 3060

cgcggtggca atgccctgcc tccggtgctc gccggagact gcgagatcat agatatagat 3120

ctcactacgc ggctgctcaa acctgggcag aacgtaagcc gcgagagcgc caacaaccgc 3180

ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta cggagcaagt tcccgaggta 3240

atcggagtcc ggctgatgtt gggagtaggt ggctacgtct ccgaactcac gaccgaaaag 3300

atcaagagca gcccgcatgg atttgacttg gtcagggccg agcctacatg tgcgaatgat 3360

gcccatactt gagccaccta actttgtttt agggcgactg ccctgctgcg taacatcgtt 3420

gctgctgcgt aacatcgttg ctgctccata acatcaaaca tcgacccacg gcgtaacgcg 3480

cttgctgctt ggatgcccga ggcatagact gtacaaaaaa acagtcataa caagccatga 3540

aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa ggttctggac cagttgcgtg 3600

agcgcatacg ctacttgcat tacagtttac gaaccgaaca ggcttatgtc aactgggttc 3660

gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac cttgggcagc agcgaagtcg 3720

aggcatttct gtcctggctg gcgaacgagc gcaaggtttc ggtctccacg catcgtcagg 3780

cattggcggc cttgctgttc ttctacggca aggtgctgtg cacggatctg ccctggcttc 3840

aggagatcgg tagacctcgg ccgtcgcggc gcttgccggt ggtgctgacc ccggatgaag 3900

tggttcgcat cctcggtttt ctggaaggcg agcatcgttt gttcgcccag gactctagct 3960

atagttctag tggttggcct acgtacccgt agtggctatg gcagggcttg ccgccccgac 4020

gttggctgcg agccctgggc cttcacccga acttgggggt tggggtgggg aaaaggaaga 4080

aacgcgggcg tattggtccc aatggggtct cggtggggta tcgacagagt gccagccctg 4140

ggaccgaacc ccgcgtttat gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt 4200

ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt tcagttagcc 4260

tcccccatct cccggtaccg catgctatgc atcagctgct agcaccatgg ctcgagatcc 4320

cgggtgatca agtcttcgtc gagtgattgt aaataaaatg taatttacag tatagtattt 4380

taattaatat acaaatgatt tgataataat tcttatttaa ctataatata ttgtgttggg 4440

ttgaattaaa ggtccgtata ctccggaata ttaatagatc atggagataa ttaaaatgat 4500

aaccatctcg caaataaata agtattttac tgttttcgta acagttttgt aataaaaaaa 4560

cctataaata ttccggatta ttcataccgt cccaccatcg ggcgcggatc ccggtccgaa 4620

gcgcgcggaa ttcaaaggcc tacgtcgacg agctcactag tcgcggccgc tttcgaatct 4680

agagcctgca gtctcgacaa gcttgtcgag aagtactaga ggatcataat cagccatacc 4740

acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct gaacctgaaa 4800

cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa tggttacaaa 4860

taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt 4920

ggtttgtcca aactcatcaa tgtatcttat catgtctgga tctgatcact gcttgagcct 4980

aggagatccg aaccagataa gtgaaatcta gttccaaact attttgtcat ttttaatttt 5040

cgtattagct tacgacgcta cacccagttc ccatctattt tgtcactctt ccctaaataa 5100

tccttaaaaa ctccatttcc acccctccca gttcccaact attttgtccg cccacagcgg 5160

ggcatttttc ttcctgttat gtttttaatc aaacatcctg ccaactccat gtgacaaacc 5220

gtcatcttcg gctacttt 5238

<210> 5

<211> 3129

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> CpGfreeFluc

<400> 5

tttagggtta gggttagggt tagggaaaaa tttagggtta gggttagggt tagggaaaaa 60

tttagggtta gggttagggt tagggaaaaa aagcttgagt caatgggaaa aacccattgg 120

agccaagtac actgactcaa tagggacttt ccattgggtt ttgcccagta cataaggtca 180

atagggggtg agtcaacagg aaagtcccat tggagccaag tacattgagt caatagggac 240

tttccaatgg gttttgccca gtacataagg tcaatgggag gtaagccaat gggtttttcc 300

cattactgac atgtatactg agtcattagg gactttccaa tgggttttgc ccagtacata 360

aggtcaatag gggtgaatca acaggaaagt cccattggag ccaagtacac tgagtcaata 420

gggactttcc attgggtttt gcccagtaca aaaggtcaat agggggtgag tcaatgggtt 480

tttcccatta ttggcacata cataaggtca ataggggtga ctagtggaga agagcatgct 540

tgagggctga gtgcccctca gtgggcagag agcacatggc ccacagtccc tgagaagttg 600

gggggagggg tgggcaattg aactggtgcc tagagaaggt ggggcttggg taaactggga 660

aagtgatgtg gtgtactggc tccacctttt tccccagggt gggggagaac catatataag 720

tgcagtagtc tctgtgaaca ttcaagcttc tgccttctcc ctcctgtgag tttggtaagt 780

cactgactgt ctatgcctgg gaaagggtgg gcaggaggtg gggcagtgca ggaaaagtgg 840

cactgtgaac cctgcagccc tagacaattg tactaacctt cttctctttc ctctcctgac 900

aggttggtgt acagtagctt ccaccatgga ggatgccaag aatattaaga aaggccctgc 960

cccattctac cctctggaag atggcactgc tggtgagcaa ctgcacaagg ccatgaagag 1020

gtatgccctg gtccctggca ccattgcctt cactgatgct cacattgagg tggacatcac 1080

ctatgctgaa tactttgaga tgtctgtgag gctggcagaa gccatgaaaa gatatggact 1140

gaacaccaac cacaggattg tggtgtgctc tgagaactct ctccagttct tcatgcctgt 1200

gttaggagcc ctgttcattg gagtggctgt ggcccctgcc aatgacatct acaatgagag 1260

agagctcctg aacagcatgg gcatcagcca gccaactgtg gtctttgtga gcaagaaggg 1320

cctgcaaaag atcctgaatg tgcagaagaa gctgcccatc atccagaaga tcatcatcat 1380

ggacagcaag actgactacc agggcttcca gagcatgtat acctttgtga ccagccactt 1440

accccctggc ttcaatgagt atgactttgt gcctgagagc tttgacaggg acaagaccat 1500

tgctctgatt atgaacagct ctggctccac tggactgccc aaaggtgtgg ctctgcccca 1560

cagaactgct tgtgtgagat tcagccatgc cagagacccc atctttggca accagatcat 1620

ccctgacact gccatcctgt ctgtggttcc attccatcat ggctttggca tgttcacaac 1680

actggggtac ctgatctgtg gcttcagagt ggtgctgatg tataggtttg aggaggagct 1740

gtttctgagg agcctacaag actacaagat ccagtctgcc ctgctggtgc ccactctgtt 1800

cagcttcttt gccaagagca ccctcattga caagtatgac ctgagcaacc tgcatgagat 1860

tgcctctgga ggagcacccc tgagcaagga ggtgggtgag gctgtggcaa agaggttcca 1920

tctcccagga atcagacagg gctatggcct gactgagacc acctctgcca tcctcatcac 1980

ccctgaagga gatgacaagc ctggtgctgt gggcaaggtg gttccctttt ttgaggccaa 2040

ggtggtggac ctggacactg gcaagaccct gggagtgaac cagaggggtg agctgtgtgt 2100

gaggggtccc atgatcatgt ctggctatgt gaacaaccct gaggccacca atgccctgat 2160

tgacaaggat ggctggctgc actctggtga cattgcctac tgggatgagg atgagcactt 2220

tttcattgtg gacaggctga agagcctcat caagtacaaa ggctaccaag tggcacctgc 2280

tgagctagag agcatcctgc tccagcaccc caacatcttt gatgctggtg tggctggcct 2340

gcctgatgat gatgctggag agctgcctgc tgctgttgtg gttctggagc atggaaagac 2400

catgactgag aaggagattg tggactatgt ggccagtcag gtgaccactg ccaagaagct 2460

gaggggaggt gtggtgtttg tggatgaggt gccaaagggt ctgactggca agctggatgc 2520

cagaaagatc agagagatcc tgatcaaggc caagaagggt ggcaaacaat tgatctctgg 2580

agccaatgga gtctagctag ctggccagac atgataagat acattgatga gtttggacaa 2640

accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga tgctattgct 2700

ttatttgtaa ccattataag ctgcaataaa caagttaaca acaacaattg cattcatttt 2760

atgtttcagg ttcaggggga ggtgtgggag gttttttaaa gcaagtaaaa cctctacaaa 2820

tgtggtatgg aattcggatc cggtgtggaa agtccccagg ctccccagca ggcagaagta 2880

tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag 2940

caggcagaag tatgcaaagc atgcatctca attagtcagc aaccagagct ctggggactt 3000

tccgctgggg actttccgct ggggactttc cgctggggac tttccgctgg ggactttccg 3060

catttaaatg gtacattttg ttctagaaca aaatgtaccg gtacattttg ttctggtaca 3120

ttttgttct 3129

<210> 6

<211> 2305

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> inRep

<400> 6

gacctttaat tcaacccaac acaatatatt atagttaaat aagaattatt atcaaatcat 60

ttgtatatta attaaaatac tatactgtaa attacatttt atttacaatc actcgacgaa 120

gacttgatca ccctacccgc catgccgggg ttttacgaga ttgtgattaa ggtccccagc 180

gaccttgacg agcatctgcc cggcatttct gacagctttg tgaactgggt ggccgagaag 240

gaatgggagt tgccgccaga ttctgacatg gatctgaatc tgattgagca ggcacccctg 300

accgtggccg agaagctgca gcgcgacttt ctgacggaat ggcgccgtgt gagtaaggcc 360

ccggaggccc ttttctttgt gcaatttgag aagggagaga gctacttcca catgcacgtg 420

ctcgtggaaa ccaccggggt gaaatccatg gttttgggac gtttcctgag tcagattcgc 480

gaaaaactga ttcagagaat ttaccgcggg atcgagccga ctttgccaaa ctggttcgcg 540

gtcacaaaga ccagaaatgg cgccggaggc gggaacaagg tggtggatga gtgctacatc 600

cccaattact tgctccccaa aacccagcct gagctccagt gggcgtggac taatatggaa 660

cagtatttaa ggtaagtact ccctatcagt gatagagatc tatcatggag ataattaaaa 720

tgataaccat ctcgcaaata aataagtatt ttactgtttt cgtaacagtt ttgtaataaa 780

aaaacctata aatattccgg attattcata ccgtcccacc atcgggcgcg aagggggaga 840

cctgtagtca gagcccccgg gcagcacaca ctgacatcca ctcccttcct attgtttcag 900

cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc 960

gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag 1020

atcaaaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac 1080

ctcggagaag cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc 1140

caactcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac 1200

taaaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacattt ccagcaatcg 1260

gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct 1320

gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac 1380

taccgggaag accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt 1440

aaactggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg 1500

ggaggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag 1560

caaggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat 1620

cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca 1680

ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga 1740

ctttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt 1800

ggttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc 1860

cagtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac 1920

gtcagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca 1980

cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc 2040

aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc 2100

tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat 2160

gggaaaggtg ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg 2220

catctttgaa caataaatga tttaaatcag gtatggctgc cgatggttat cttccagatt 2280

ggctcgagga cactctctct gaagg 2305

<210> 7

<211> 3884

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> CORep

<400> 7

gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt ttattgccgt catagcgcgg 60

gttccttccg gtattgtctc cttccgtgtt tcagttagcc tcccccatct cccggtaccg 120

catgctatgc atcagctgct agcttactgc tcgaagatgc agtcgtccag atccacgttc 180

acgagatcgc aagcagtgca agcgtcgggc accttgccca tgatgtggtg gatgtagcac 240

agcttctggt aggccttctt gacgacggac acgggttggg actcggagac ggggaagcat 300

tccagacagt ctttctggcc gtgggtgaag cagatgttgg agttctggtt catgcgctcg 360

cactggcggc aagggaacag catcagattc atgcccacgt ggcggctgca cttattctgg 420

tagcggtcgg cgtagttgat ggaggcttca gcatcggagg tggaaggctg agcgacggac 480

tcacgcacgc gcttaggctc gctgatatca gcgtcgctgg gagcggggcg cttcttagca 540

ccgcccttct tcacgtagaa ctcgtgctcc acctccacga cgtgatcctt ggcccaacgg 600

aagaagtcct tcacctcttg cttggtgact ttgccgaagt cgtggtccag acggcgggtg 660

agctcgaatt tgaacatgcg gtcttgcaga ggttgctgat gttcgaaggt agtggagttg 720

ccgtcgatga cagcgcacat gttggtgttg gaagtcacga tgacgggggt ggggtcgatc 780

tgagcggagg acttgcactt ctggtcgaca cgcaccttgc taccacccag aatggccttg 840

gcggattcga ccaccttggc agtcatcttg ccctcttccc accagatgac catcttgtcg 900

acgcagtcgt tgaaggggaa gttctcgttg gtccagttga cgcagccgta aaagggcacg 960

gtatgggcga tggcttcggc gatgttggtc ttaccagtgg tagcgggacc gaagagccag 1020

atagtgttgc gcttgccgaa cttcttggta gcccaaccga ggaagacgga ggcggcatac 1080

tgggggtcgt agccgttgag ctccagaatc ttgtagatgc ggttggagga gatgtcctcc 1140

acgggctgtt gaccgaccag ataatcggga gcggtcttgg tgaggctcat gatcttacca 1200

gcgttgtcga gggcagcctt gatctgggaa cgggagttgc tggcagcatt gaagctgatg 1260

tagctggctt ggtcctcttg gatccactgc ttctcgctag tgatgccctt gtcgaccagc 1320

caaccgacca gttccatggt ggcccgggtt tcggaccgag atccgcgccc gatggtggga 1380

cggtatgaat aatccggaat atttataggt ttttttatta caaaactgtt acgaaaacag 1440

taaaatactt atttatttgc gagatggtta tcattttaat tatctccatg atctattaat 1500

attccggagt atacaataaa cgataacgcc gttggtggcg tgaggcatgt aaaaggttac 1560

atcattatct tgttcgccat ccggttggta taaatagacg ttcatgttgg tttttgtttc 1620

agttgcaagt tggctgcggc gcgcgcagca cctttgcggc cgccaccatg gcggggtttt 1680

acgagattgt gattaaggtc cccagcgacc ttgacgagca tctgcccggc atttctgaca 1740

gctttgtgaa ctgggtggcc gagaaggaat gggagttgcc gccagattct gacatggatc 1800

tgaatctgat tgagcaggca cccctgaccg tggccgagaa gctgcagcgc gactttctga 1860

cggaatggcg ccgtgtgagt aaggccccgg aggccctttt ctttgtgcaa tttgagaagg 1920

gagagagcta cttccacatg cacgtgctcg tggaaaccac cggggtgaaa tccatggttt 1980

tgggacgttt cctgagtcag attcgcgaaa aactgattca gagaatttac cgcgggatcg 2040

agccgacttt gccaaactgg ttcgcggtca caaagaccag aaatggcgcc ggaggcggga 2100

acaaggtggt ggatgagtgc tacatcccca attacttgct ccccaaaacc cagcctgagc 2160

tccagtgggc gtggactaat atggaacagt atttaagcgc ctgtttgaat ctcacggagc 2220

gtaaacggtt ggtggcgcag catctgacgc acgtgtcgca gacgcaggag cagaacaaag 2280

agaatcagaa tcccaattct gatgcgccgg tgatcagatc aaaaacttca gccaggtaca 2340

tggagctggt cgggtggctc gtggacaagg ggattacctc ggagaagcag tggatccagg 2400

aggaccaggc ctcatacatc tccttcaatg cggcctccaa ctcgcggtcc caaatcaagg 2460

ctgccttgga caatgcggga aagattatga gcctgactaa aaccgccccc gactacctgg 2520

tgggccagca gcccgtggag gacatttcca gcaatcggat ttataaaatt ttggaactaa 2580

acgggtacga tccccaatat gcggcttccg tctttctggg atgggccacg aaaaagttcg 2640

gcaagaggaa caccatctgg ctgtttgggc ctgcaactac cgggaagacc aacatcgcgg 2700

aggccatagc ccacactgtg cccttctacg ggtgcgtaaa ctggaccaat gagaactttc 2760

ccttcaacga ctgtgtcgac aagatggtga tctggtggga ggaggggaag atgaccgcca 2820

aggtcgtgga gtcggccaaa gccattctcg gaggaagcaa ggtgcgcgtg gaccagaaat 2880

gcaagtcctc ggcccagata gacccgactc ccgtgatcgt cacctccaac accaacatgt 2940

gcgccgtgat tgacgggaac tcaacgacct tcgaacacca gcagccgttg caagaccgga 3000

tgttcaaatt tgaactcacc cgccgtctgg atcatgactt tgggaaggtc accaagcagg 3060

aagtcaaaga ctttttccgg tgggcaaagg atcacgtggt tgaggtggag catgaattct 3120

acgtcaaaaa gggtggagcc aagaaaagac ccgcccccag tgacgcagat ataagtgagc 3180

ccaaacgggt gcgcgagtca gttgcgcagc catcgacgtc agacgcggaa gcttcgatca 3240

actacgcaga caggtaccaa aacaaatgtt ctcgtcacgt gggcatgaat ctgatgctgt 3300

ttccctgcag acaatgcgag agaatgaatc agaattcaaa tatctgcttc actcacggac 3360

agaaagactg tttagagtgc tttcccgtgt cagaatctca acccgtttct gtcgtcaaaa 3420

aggcgtatca gaaactgtgc tacattcatc atatcatggg aaaggtgcca gacgcttgca 3480

ctgcctgcga tctggtcaat gtggatttgg atgactgcat ctttgaacaa taaatgattt 3540

aaatcaggta tggctgccga tggttatctt ccagattggc tcgaggacac tctctctgat 3600

ctagagcctg cagtctcgac aagcttgtcg agaagtacta gaggatcata atcagccata 3660

ccacatttgt agaggtttta cttgctttaa aaaacctccc acacctcccc ctgaacctga 3720

aacataaaat gaatgcaatt gttgttgtta acttgtttat tgcagcttat aatggttaca 3780

aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt 3840

gtggtttgtc caaactcatc aatgtatctt atcatgtctg gatc 3884

<210> 8

<211> 3874

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> p10Rep

<400> 8

gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt ttattgccgt catagcgcgg 60

gttccttccg gtattgtctc cttccgtgtt tcagttagcc tcccccatct cccggtaccg 120

catgctatgc atcagctgct agcttactgc tcgaagatgc agtcgtccag atccacgttc 180

acgagatcgc aagcagtgca agcgtcgggc accttgccca tgatgtggtg gatgtagcac 240

agcttctggt aggccttctt gacgacggac acgggttggg actcggagac ggggaagcat 300

tccagacagt ctttctggcc gtgggtgaag cagatgttgg agttctggtt catgcgctcg 360

cactggcggc aagggaacag catcagattc atgcccacgt ggcggctgca cttattctgg 420

tagcggtcgg cgtagttgat ggaggcttca gcatcggagg tggaaggctg agcgacggac 480

tcacgcacgc gcttaggctc gctgatatca gcgtcgctgg gagcggggcg cttcttagca 540

ccgcccttct tcacgtagaa ctcgtgctcc acctccacga cgtgatcctt ggcccaacgg 600

aagaagtcct tcacctcttg cttggtgact ttgccgaagt cgtggtccag acggcgggtg 660

agctcgaatt tgaacatgcg gtcttgcaga ggttgctgat gttcgaaggt agtggagttg 720

ccgtcgatga cagcgcacat gttggtgttg gaagtcacga tgacgggggt ggggtcgatc 780

tgagcggagg acttgcactt ctggtcgaca cgcaccttgc taccacccag aatggccttg 840

gcggattcga ccaccttggc agtcatcttg ccctcttccc accagatgac catcttgtcg 900

acgcagtcgt tgaaggggaa gttctcgttg gtccagttga cgcagccgta aaagggcacg 960

gtatgggcga tggcttcggc gatgttggtc ttaccagtgg tagcgggacc gaagagccag 1020

atagtgttgc gcttgccgaa cttcttggta gcccaaccga ggaagacgga ggcggcatac 1080

tgggggtcgt agccgttgag ctccagaatc ttgtagatgc ggttggagga gatgtcctcc 1140

acgggctgtt gaccgaccag ataatcggga gcggtcttgg tgaggctcat gatcttacca 1200

gcgttgtcga gggcagcctt gatctgggaa cgggagttgc tggcagcatt gaagctgatg 1260

tagctggctt ggtcctcttg gatccactgc ttctcgctag tgatgccctt gtcgaccagc 1320

caaccgacca gttccatggt ggcccgggtt tcggaccgag atccgcgccc gatggtggga 1380

cggtatgaat aatccggaat atttataggt ttttttatta caaaactgtt acgaaaacag 1440

taaaatactt atttatttgc gagatggtta tcattttaat tatctccatg atctattaat 1500

attccggagt atacggacct ttaattcaac ccaacacaat atattatagt taaataagaa 1560

ttattatcaa atcatttgta tattaattaa aatactatac tgtaaattac attttattta 1620

caatcactcg acgaagactt gatcagcggc cgccaccatg gcggggtttt acgagattgt 1680

gattaaggtc cccagcgacc ttgacgagca tctgcccggc atttctgaca gctttgtgaa 1740

ctgggtggcc gagaaggaat gggagttgcc gccagattct gacatggatc tgaatctgat 1800

tgagcaggca cccctgaccg tggccgagaa gctgcagcgc gactttctga cggaatggcg 1860

ccgtgtgagt aaggccccgg aggccctttt ctttgtgcaa tttgagaagg gagagagcta 1920

cttccacatg cacgtgctcg tggaaaccac cggggtgaaa tccatggttt tgggacgttt 1980

cctgagtcag attcgcgaaa aactgattca gagaatttac cgcgggatcg agccgacttt 2040

gccaaactgg ttcgcggtca caaagaccag aaatggcgcc ggaggcggga acaaggtggt 2100

ggatgagtgc tacatcccca attacttgct ccccaaaacc cagcctgagc tccagtgggc 2160

gtggactaat atggaacagt atttaagcgc ctgtttgaat ctcacggagc gtaaacggtt 2220

ggtggcgcag catctgacgc acgtgtcgca gacgcaggag cagaacaaag agaatcagaa 2280

tcccaattct gatgcgccgg tgatcagatc aaaaacttca gccaggtaca tggagctggt 2340

cgggtggctc gtggacaagg ggattacctc ggagaagcag tggatccagg aggaccaggc 2400

ctcatacatc tccttcaatg cggcctccaa ctcgcggtcc caaatcaagg ctgccttgga 2460

caatgcggga aagattatga gcctgactaa aaccgccccc gactacctgg tgggccagca 2520

gcccgtggag gacatttcca gcaatcggat ttataaaatt ttggaactaa acgggtacga 2580

tccccaatat gcggcttccg tctttctggg atgggccacg aaaaagttcg gcaagaggaa 2640

caccatctgg ctgtttgggc ctgcaactac cgggaagacc aacatcgcgg aggccatagc 2700

ccacactgtg cccttctacg ggtgcgtaaa ctggaccaat gagaactttc ccttcaacga 2760

ctgtgtcgac aagatggtga tctggtggga ggaggggaag atgaccgcca aggtcgtgga 2820

gtcggccaaa gccattctcg gaggaagcaa ggtgcgcgtg gaccagaaat gcaagtcctc 2880

ggcccagata gacccgactc ccgtgatcgt cacctccaac accaacatgt gcgccgtgat 2940

tgacgggaac tcaacgacct tcgaacacca gcagccgttg caagaccgga tgttcaaatt 3000

tgaactcacc cgccgtctgg atcatgactt tgggaaggtc accaagcagg aagtcaaaga 3060

ctttttccgg tgggcaaagg atcacgtggt tgaggtggag catgaattct acgtcaaaaa 3120

gggtggagcc aagaaaagac ccgcccccag tgacgcagat ataagtgagc ccaaacgggt 3180

gcgcgagtca gttgcgcagc catcgacgtc agacgcggaa gcttcgatca actacgcaga 3240

caggtaccaa aacaaatgtt ctcgtcacgt gggcatgaat ctgatgctgt ttccctgcag 3300

acaatgcgag agaatgaatc agaattcaaa tatctgcttc actcacggac agaaagactg 3360

tttagagtgc tttcccgtgt cagaatctca acccgtttct gtcgtcaaaa aggcgtatca 3420

gaaactgtgc tacattcatc atatcatggg aaaggtgcca gacgcttgca ctgcctgcga 3480

tctggtcaat gtggatttgg atgactgcat ctttgaacaa taaatgattt aaatcaggta 3540

tggctgccga tggttatctt ccagattggc tcgaggacac tctctctgat ctagagcctg 3600

cagtctcgac aagcttgtcg agaagtacta gaggatcata atcagccata ccacatttgt 3660

agaggtttta cttgctttaa aaaacctccc acacctcccc ctgaacctga aacataaaat 3720

gaatgcaatt gttgttgtta acttgtttat tgcagcttat aatggttaca aataaagcaa 3780

tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 3840

caaactcatc aatgtatctt atcatgtctg gatc 3874

<210> 9

<211> 110

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> p10

<400> 9

gacctttaat tcaacccaac acaatatatt atagttaaat aagaattatt atcaaatcat 60

ttgtatatta attaaaatac tatactgtaa attacatttt atttacaatc 110

<210> 10

<211> 92

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> polh

<400> 10

atcatggaga taattaaaat gataaccatc tcgcaaataa ataagtattt tactgttttc 60

gtaacagttt tgtaataaaa aaacctataa at 92

<210> 11

<211> 1866

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Rep78-WT

<400> 11

atggcggggt tttacgagat tgtgattaag gtccccagcg accttgacga gcatctgccc 60

ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt gccgccagat 120

tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga gaagctgcag 180

cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct tttctttgtg 240

caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac caccggggtg 300

aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat tcagagaatt 360

taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac cagaaatggc 420

gccggaggcg ggaacaaggt ggtggatgag tgctacatcc ccaattactt gctccccaaa 480

acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag cgcctgtttg 540

aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc gcagacgcag 600

gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag atcaaaaact 660

tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac ctcggagaag 720

cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc caactcgcgg 780

tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac taaaaccgcc 840

cccgactacc tggtgggcca gcagcccgtg gaggacattt ccagcaatcg gatttataaa 900

attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct gggatgggcc 960

acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac taccgggaag 1020

accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt aaactggacc 1080

aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg ggaggagggg 1140

aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag caaggtgcgc 1200

gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat cgtcacctcc 1260

aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca ccagcagccg 1320

ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga ctttgggaag 1380

gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt ggttgaggtg 1440

gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc cagtgacgca 1500

gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac gtcagacgcg 1560

gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca cgtgggcatg 1620

aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc aaatatctgc 1680

ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc tcaacccgtt 1740

tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat gggaaaggtg 1800

ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg catctttgaa 1860

caataa 1866

<210> 12

<211> 1194

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Rep52-CO

<400> 12

atggaactgg tcggttggct ggtcgacaag ggcatcacta gcgagaagca gtggatccaa 60

gaggaccaag ccagctacat cagcttcaat gctgccagca actcccgttc ccagatcaag 120

gctgccctcg acaacgctgg taagatcatg agcctcacca agaccgctcc cgattatctg 180

gtcggtcaac agcccgtgga ggacatctcc tccaaccgca tctacaagat tctggagctc 240

aacggctacg acccccagta tgccgcctcc gtcttcctcg gttgggctac caagaagttc 300

ggcaagcgca acactatctg gctcttcggt cccgctacca ctggtaagac caacatcgcc 360

gaagccatcg cccataccgt gcccttttac ggctgcgtca actggaccaa cgagaacttc 420

cccttcaacg actgcgtcga caagatggtc atctggtggg aagagggcaa gatgactgcc 480

aaggtggtcg aatccgccaa ggccattctg ggtggtagca aggtgcgtgt cgaccagaag 540

tgcaagtcct ccgctcagat cgaccccacc cccgtcatcg tgacttccaa caccaacatg 600

tgcgctgtca tcgacggcaa ctccactacc ttcgaacatc agcaacctct gcaagaccgc 660

atgttcaaat tcgagctcac ccgccgtctg gaccacgact tcggcaaagt caccaagcaa 720

gaggtgaagg acttcttccg ttgggccaag gatcacgtcg tggaggtgga gcacgagttc 780

tacgtgaaga agggcggtgc taagaagcgc cccgctccca gcgacgctga tatcagcgag 840

cctaagcgcg tgcgtgagtc cgtcgctcag ccttccacct ccgatgctga agcctccatc 900

aactacgccg accgctacca gaataagtgc agccgccacg tgggcatgaa tctgatgctg 960

ttcccttgcc gccagtgcga gcgcatgaac cagaactcca acatctgctt cacccacggc 1020

cagaaagact gtctggaatg cttccccgtc tccgagtccc aacccgtgtc cgtcgtcaag 1080

aaggcctacc agaagctgtg ctacatccac cacatcatgg gcaaggtgcc cgacgcttgc 1140

actgcttgcg atctcgtgaa cgtggatctg gacgactgca tcttcgagca gtaa 1194

<210> 13

<211> 1194

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Rep52WT

<400> 13

atggagctgg tcgggtggct cgtggacaag gggattacct cggagaagca gtggatccag 60

gaggaccagg cctcatacat ctccttcaat gcggcctcca actcgcggtc ccaaatcaag 120

gctgccttgg acaatgcggg aaagattatg agcctgacta aaaccgcccc cgactacctg 180

gtgggccagc agcccgtgga ggacatttcc agcaatcgga tttataaaat tttggaacta 240

aacgggtacg atccccaata tgcggcttcc gtctttctgg gatgggccac gaaaaagttc 300

ggcaagagga acaccatctg gctgtttggg cctgcaacta ccgggaagac caacatcgcg 360

gaggccatag cccacactgt gcccttctac gggtgcgtaa actggaccaa tgagaacttt 420

cccttcaacg actgtgtcga caagatggtg atctggtggg aggaggggaa gatgaccgcc 480

aaggtcgtgg agtcggccaa agccattctc ggaggaagca aggtgcgcgt ggaccagaaa 540

tgcaagtcct cggcccagat agacccgact cccgtgatcg tcacctccaa caccaacatg 600

tgcgccgtga ttgacgggaa ctcaacgacc ttcgaacacc agcagccgtt gcaagaccgg 660

atgttcaaat ttgaactcac ccgccgtctg gatcatgact ttgggaaggt caccaagcag 720

gaagtcaaag actttttccg gtgggcaaag gatcacgtgg ttgaggtgga gcatgaattc 780

tacgtcaaaa agggtggagc caagaaaaga cccgccccca gtgacgcaga tataagtgag 840

cccaaacggg tgcgcgagtc agttgcgcag ccatcgacgt cagacgcgga agcttcgatc 900

aactacgcag accgctacca aaacaaatgt tctcgtcacg tgggcatgaa tctgatgctg 960

tttccctgca gacaatgcga gagaatgaat cagaattcaa atatctgctt cactcacgga 1020

cagaaagact gtttagagtg ctttcccgtg tcagaatctc aacccgtttc tgtcgtcaaa 1080

aaggcgtatc agaaactgtg ctacattcat catatcatgg gaaaggtgcc agacgcttgc 1140

actgcctgcg atctggtcaa tgtggatttg gatgactgca tctttgaaca ataa 1194

<210> 14

<211> 8310

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> pFastBac-p10Rep

<400> 14

ttctctgtca cagaatgaaa atttttctgt catctcttcg ttattaatgt ttgtaattga 60

ctgaatatca acgcttattt gcagcctgaa tggcgaatgg gacgcgccct gtagcggcgc 120

attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 180

agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 240

tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 300

ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 360

ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 420

aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 480

ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 540

attaacgttt acaatttcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 600

tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 660

gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 720

tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 780

aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 840

cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 900

agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 960

ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 1020

tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 1080

tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 1140

caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 1200

accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 1260

attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 1320

ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 1380

taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 1440

taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 1500

aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 1560

agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 1620

ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 1680

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 1740

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 1800

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 1860

tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 1920

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 1980

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 2040

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 2100

acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 2160

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 2220

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 2280

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 2340

ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 2400

taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 2460

cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca 2520

tctgtgcggt atttcacacc gcagaccagc cgcgtaacct ggcaaaatcg gttacggttg 2580

agtaataaat ggatgccctg cgtaagcggg tgtgggcgga caataaagtc ttaaactgaa 2640

caaaatagat ctaaactatg acaataaagt cttaaactag acagaatagt tgtaaactga 2700

aatcagtcca gttatgctgt gaaaaagcat actggacttt tgttatggct aaagcaaact 2760

cttcattttc tgaagtgcaa attgcccgtc gtattaaaga ggggcgtggc caagggcatg 2820

gtaaagacta tattcgcggc gttgtgacaa tttaccgaac aactccgcgg ccgggaagcc 2880

gatctcggct tgaacgaatt gttaggtggc ggtacttggg tcgatatcaa agtgcatcac 2940

ttcttcccgt atgcccaact ttgtatagag agccactgcg ggatcgtcac cgtaatctgc 3000

ttgcacgtag atcacataag caccaagcgc gttggcctca tgcttgagga gattgatgag 3060

cgcggtggca atgccctgcc tccggtgctc gccggagact gcgagatcat agatatagat 3120

ctcactacgc ggctgctcaa acctgggcag aacgtaagcc gcgagagcgc caacaaccgc 3180

ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta cggagcaagt tcccgaggta 3240

atcggagtcc ggctgatgtt gggagtaggt ggctacgtct ccgaactcac gaccgaaaag 3300

atcaagagca gcccgcatgg atttgacttg gtcagggccg agcctacatg tgcgaatgat 3360

gcccatactt gagccaccta actttgtttt agggcgactg ccctgctgcg taacatcgtt 3420

gctgctgcgt aacatcgttg ctgctccata acatcaaaca tcgacccacg gcgtaacgcg 3480

cttgctgctt ggatgcccga ggcatagact gtacaaaaaa acagtcataa caagccatga 3540

aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa ggttctggac cagttgcgtg 3600

agcgcatacg ctacttgcat tacagtttac gaaccgaaca ggcttatgtc aactgggttc 3660

gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac cttgggcagc agcgaagtcg 3720

aggcatttct gtcctggctg gcgaacgagc gcaaggtttc ggtctccacg catcgtcagg 3780

cattggcggc cttgctgttc ttctacggca aggtgctgtg cacggatctg ccctggcttc 3840

aggagatcgg tagacctcgg ccgtcgcggc gcttgccggt ggtgctgacc ccggatgaag 3900

tggttcgcat cctcggtttt ctggaaggcg agcatcgttt gttcgcccag gactctagct 3960

atagttctag tggttggcct acgtacccgt agtggctatg gcagggcttg ccgccccgac 4020

gttggctgcg agccctgggc cttcacccga acttgggggt tggggtgggg aaaaggaaga 4080

aacgcgggcg tattggtccc aatggggtct cggtggggta tcgacagagt gccagccctg 4140

ggaccgaacc ccgcgtttat gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt 4200

ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt tcagttagcc 4260

tcccccatct cccggtaccg catgctatgc atcagctgct agcttactgc tcgaagatgc 4320

agtcgtccag atccacgttc acgagatcgc aagcagtgca agcgtcgggc accttgccca 4380

tgatgtggtg gatgtagcac agcttctggt aggccttctt gacgacggac acgggttggg 4440

actcggagac ggggaagcat tccagacagt ctttctggcc gtgggtgaag cagatgttgg 4500

agttctggtt catgcgctcg cactggcggc aagggaacag catcagattc atgcccacgt 4560

ggcggctgca cttattctgg tagcggtcgg cgtagttgat ggaggcttca gcatcggagg 4620

tggaaggctg agcgacggac tcacgcacgc gcttaggctc gctgatatca gcgtcgctgg 4680

gagcggggcg cttcttagca ccgcccttct tcacgtagaa ctcgtgctcc acctccacga 4740

cgtgatcctt ggcccaacgg aagaagtcct tcacctcttg cttggtgact ttgccgaagt 4800

cgtggtccag acggcgggtg agctcgaatt tgaacatgcg gtcttgcaga ggttgctgat 4860

gttcgaaggt agtggagttg ccgtcgatga cagcgcacat gttggtgttg gaagtcacga 4920

tgacgggggt ggggtcgatc tgagcggagg acttgcactt ctggtcgaca cgcaccttgc 4980

taccacccag aatggccttg gcggattcga ccaccttggc agtcatcttg ccctcttccc 5040

accagatgac catcttgtcg acgcagtcgt tgaaggggaa gttctcgttg gtccagttga 5100

cgcagccgta aaagggcacg gtatgggcga tggcttcggc gatgttggtc ttaccagtgg 5160

tagcgggacc gaagagccag atagtgttgc gcttgccgaa cttcttggta gcccaaccga 5220

ggaagacgga ggcggcatac tgggggtcgt agccgttgag ctccagaatc ttgtagatgc 5280

ggttggagga gatgtcctcc acgggctgtt gaccgaccag ataatcggga gcggtcttgg 5340

tgaggctcat gatcttacca gcgttgtcga gggcagcctt gatctgggaa cgggagttgc 5400

tggcagcatt gaagctgatg tagctggctt ggtcctcttg gatccactgc ttctcgctag 5460

tgatgccctt gtcgaccagc caaccgacca gttccatggt ggcccgggtt tcggaccgag 5520

atccgcgccc gatggtggga cggtatgaat aatccggaat atttataggt ttttttatta 5580

caaaactgtt acgaaaacag taaaatactt atttatttgc gagatggtta tcattttaat 5640

tatctccatg atctattaat attccggagt atacggacct ttaattcaac ccaacacaat 5700

atattatagt taaataagaa ttattatcaa atcatttgta tattaattaa aatactatac 5760

tgtaaattac attttattta caatcactcg acgaagactt gatcagcggc cgccaccatg 5820

gcggggtttt acgagattgt gattaaggtc cccagcgacc ttgacgagca tctgcccggc 5880

atttctgaca gctttgtgaa ctgggtggcc gagaaggaat gggagttgcc gccagattct 5940

gacatggatc tgaatctgat tgagcaggca cccctgaccg tggccgagaa gctgcagcgc 6000

gactttctga cggaatggcg ccgtgtgagt aaggccccgg aggccctttt ctttgtgcaa 6060

tttgagaagg gagagagcta cttccacatg cacgtgctcg tggaaaccac cggggtgaaa 6120

tccatggttt tgggacgttt cctgagtcag attcgcgaaa aactgattca gagaatttac 6180

cgcgggatcg agccgacttt gccaaactgg ttcgcggtca caaagaccag aaatggcgcc 6240

ggaggcggga acaaggtggt ggatgagtgc tacatcccca attacttgct ccccaaaacc 6300

cagcctgagc tccagtgggc gtggactaat atggaacagt atttaagcgc ctgtttgaat 6360

ctcacggagc gtaaacggtt ggtggcgcag catctgacgc acgtgtcgca gacgcaggag 6420

cagaacaaag agaatcagaa tcccaattct gatgcgccgg tgatcagatc aaaaacttca 6480

gccaggtaca tggagctggt cgggtggctc gtggacaagg ggattacctc ggagaagcag 6540

tggatccagg aggaccaggc ctcatacatc tccttcaatg cggcctccaa ctcgcggtcc 6600

caaatcaagg ctgccttgga caatgcggga aagattatga gcctgactaa aaccgccccc 6660

gactacctgg tgggccagca gcccgtggag gacatttcca gcaatcggat ttataaaatt 6720

ttggaactaa acgggtacga tccccaatat gcggcttccg tctttctggg atgggccacg 6780

aaaaagttcg gcaagaggaa caccatctgg ctgtttgggc ctgcaactac cgggaagacc 6840

aacatcgcgg aggccatagc ccacactgtg cccttctacg ggtgcgtaaa ctggaccaat 6900

gagaactttc ccttcaacga ctgtgtcgac aagatggtga tctggtggga ggaggggaag 6960

atgaccgcca aggtcgtgga gtcggccaaa gccattctcg gaggaagcaa ggtgcgcgtg 7020

gaccagaaat gcaagtcctc ggcccagata gacccgactc ccgtgatcgt cacctccaac 7080

accaacatgt gcgccgtgat tgacgggaac tcaacgacct tcgaacacca gcagccgttg 7140

caagaccgga tgttcaaatt tgaactcacc cgccgtctgg atcatgactt tgggaaggtc 7200

accaagcagg aagtcaaaga ctttttccgg tgggcaaagg atcacgtggt tgaggtggag 7260

catgaattct acgtcaaaaa gggtggagcc aagaaaagac ccgcccccag tgacgcagat 7320

ataagtgagc ccaaacgggt gcgcgagtca gttgcgcagc catcgacgtc agacgcggaa 7380

gcttcgatca actacgcaga caggtaccaa aacaaatgtt ctcgtcacgt gggcatgaat 7440

ctgatgctgt ttccctgcag acaatgcgag agaatgaatc agaattcaaa tatctgcttc 7500

actcacggac agaaagactg tttagagtgc tttcccgtgt cagaatctca acccgtttct 7560

gtcgtcaaaa aggcgtatca gaaactgtgc tacattcatc atatcatggg aaaggtgcca 7620

gacgcttgca ctgcctgcga tctggtcaat gtggatttgg atgactgcat ctttgaacaa 7680

taaatgattt aaatcaggta tggctgccga tggttatctt ccagattggc tcgaggacac 7740

tctctctgat ctagagcctg cagtctcgac aagcttgtcg agaagtacta gaggatcata 7800

atcagccata ccacatttgt agaggtttta cttgctttaa aaaacctccc acacctcccc 7860

ctgaacctga aacataaaat gaatgcaatt gttgttgtta acttgtttat tgcagcttat 7920

aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg 7980

cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg gatctgatca 8040

ctgcttgagc ctaggagatc cgaaccagat aagtgaaatc tagttccaaa ctattttgtc 8100

atttttaatt ttcgtattag cttacgacgc tacacccagt tcccatctat tttgtcactc 8160

ttccctaaat aatccttaaa aactccattt ccacccctcc cagttcccaa ctattttgtc 8220

cgcccacagc ggggcatttt tcttcctgtt atgtttttaa tcaaacatcc tgccaactcc 8280

atgtgacaaa ccgtcatctt cggctacttt 8310

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P1

<400> 15

gatccggtac cacgcgtcta g 21

<210> 16

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P2

<400> 16

ctcgacgtcg actttacttg tacagc 26

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P3

<400> 17

gcggggtttt acgagattgt g 21

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P4

<400> 18

ggggtgcctg ctcaatcaga 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P5

<400> 19

gcagcacaca ctgacatcca 20

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P6

<400> 20

gatcaccggc gcatcagaat tg 22

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P7

<400> 21

acttcaagat ccgccacaac at 22

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P8

<400> 22

tctcgttggg gtcttgctca g 21

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> M13 F

<400> 23

cccagtcacg acgttgtaaa acg 23

<210> 24

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> M13 R

<400> 24

agcggataac aatttcacac agg 23

Claims

1. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the adeno-associated virus (AAV) Rep78 protein and a nucleotide sequence encoding the Rep52 protein, wherein the nucleic acid molecule encoding the Rep52 protein comprises the nucleotide sequence set forth in SEQ ID NO. 12.

2. The isolated nucleic acid molecule of claim 1, further comprising a first promoter that initiates transcription of the nucleotide sequence encoding the AAV Rep78 protein and a second promoter that initiates transcription of the nucleic acid molecule encoding the AAV Rep52 protein, the first promoter being the same as or different from the second promoter.

3. The isolated nucleic acid molecule of claim 2, wherein the first and second promoters are each independently selected from the group consisting of: the p10 promoter, the polyhedrin (polh) promoter, and the IE1 promoter.

4. The isolated nucleic acid molecule of any one of claims 2-3, wherein the direction of transcription of the first promoter and the second promoter is the same or opposite.

5. An isolated nucleic acid molecule according to claim 4, which comprises in sequence a nucleotide sequence encoding Rep78, a first promoter, a second promoter, a nucleotide sequence encoding Rep52, when the first promoter and the second promoter are transcribed in opposite directions, wherein the first promoter initiates transcription of the nucleotide sequence encoding Rep78 protein and the second promoter initiates transcription of the nucleotide sequence encoding Rep52 protein.

6. The isolated nucleic acid molecule of any one of claims 1-5, comprising the nucleotide sequence set forth in SEQ ID NO 8.

7. A vector comprising the isolated nucleic acid molecule of any one of claims 1-6.

8. A cell comprising the isolated nucleic acid molecule of any one of claims 1-6 or the vector of claim 7.

9. A baculovirus expression system comprising a first baculovirus vector and a second baculovirus vector comprising a nucleic acid sequence encoding a gene of interest, said first baculovirus vector being the vector of claim 7.

10. An insect cell comprising a first nucleotide sequence encoding a first amino acid sequence comprising a nucleotide sequence encoding a Rep78 protein and a second nucleotide sequence encoding a Rep52 protein, wherein the first nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 11 and the second nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 12.