CN105925610B - Insect baculovirus expression vector, construction method and application thereof - Google Patents
Insect baculovirus expression vector, construction method and application thereof Download PDFInfo
- Publication number
- CN105925610B CN105925610B CN201610334911.7A CN201610334911A CN105925610B CN 105925610 B CN105925610 B CN 105925610B CN 201610334911 A CN201610334911 A CN 201610334911A CN 105925610 B CN105925610 B CN 105925610B
- Authority
- CN
- China
- Prior art keywords
- vector
- expression vector
- sequence
- insect
- insect baculovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
Abstract
The invention provides an insect baculovirus expression vector, a construction method and application thereof, wherein the insect baculovirus expression vector comprises an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence and an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region, the sequence of the expression vector I is shown as a sequence table SEQ ID 1, and the sequence of the expression vector II is shown as a sequence table SEQ ID 2; the insect baculovirus expression vector III containing alpha-2, 3-sialylglycosyltransferase ST3 is also included, and the sequence of the expression vector III is shown in a sequence table SEQ ID 3. The insect baculovirus expression vector can efficiently express the humanized antibody containing the heavy chain and the light chain.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an insect baculovirus expression vector, a construction method and application thereof.
Background
Antibody molecules possess the complex molecular structure of tetrameric glycoproteins, the extracellular expression of which follows the general rule of "secreted proteins": the light chain and the heavy chain of the whole antibody molecule have bioactivity after being translated, folded, assembled and glycosylated. Through clinical research on antibodies already on the market, the "post-translational modification" of recombinant antibodies by host cells directly influences the clinical curative effect and immunogenicity of antibody drugs, and all IgG molecules only have one conserved N-glycosylation modification site at Asn-297 of each C gamma 2 region. The sugar chain attached at this site helps maintain the quaternary structure and Fc stability of IgG and provides a glycosylation modification site for binding of IgG to lectins. The Fc oligosaccharides of normal human IgG are mainly of the complex dual antenna type with core fucosylation, and heterogeneity is due to galactosylation and sialylation of the terminal sugars. According to the number of terminal galactose, Asn-297 linked dual-antenna 32 glycan chains can be divided into three different subtypes, IgG-G0, -G1, -G2, which account for 35%, 35% and 16% of the total human serum IgG sugar chain; the other 14% are sialylated G1 and G2 sugar chains. In addition, human IgG has a small amount of afucose Fc sugar chains with (or without) bisected acetylglucosamines.
The production of N-sugar chains of sialylated glycoproteins by insects is a problem that is contradictory to insect glycobiology and the use of insect baculovirus expression systems. There is much evidence that there is no sialic acid and sialic acid transporter activity in insect cell lines and that the sugar chain ends of recombinant glycoproteins expressed by baculovirus expression systems are not sialylated. All in the standard insect baculovirus expression system, with sf21, sf9 and BTI-Tn-5B1-4(High Five) cells as hosts, the sugar chain of recombinant N-glycoprotein is a simple, non-sialylated low mannose type, rather than a sialylated complex type sugar chain produced in mammals at the same glycosylation site.
the cell line SfSWT-1 (containing 5 mammalian cell glycosyltransferase genes such as GnT1, GnT2, GalT, ST3, ST6 and the like) has the ability to sialylate the sugar chain of the recombinant glycoprotein. We know that Sf9 cell line does not have CMP-sialic acid, and this substance is a substrate for sialyltransferase enzyme activity. Subsequently, it was found that sialylation of the sugar chain of the recombinant glycoprotein expressed in SfSWT-1 requires culturing the cells in a medium containing added sialic acid, as with FBS, indicating that these insect cells have a compensatory trophic pathway. However, this problem was quickly solved by inserting mammalian genes encoding sialic acid synthase and CMP-sialic acid synthase into SfSWT-1 cells to obtain SfSWT-3 cell lines which are capable of intracellular synthesis of CMP-sialic acid, and which have a sugar chain of a double-antenna, single-terminal-sialylated complex N-sugar chain, but which are grown in a medium containing a precursor of N-acetylmannosamine sialic acid. It is to be particularly emphasized here that all sugar chains produced by transgenic insect cells so far have no sialic acid on the terminal alpha-1, 6 branches. This is because although the mouse ST3GalIV gene was introduced in SfSWT-1 and SfSWT-3 cell lines, sialic acid transporter activity could not be detected, suggesting that although the expression of the gene could be detected from the mRNA level, it could not encode a gene product having activity, which might explain why the ends of the sugar chain of the recombinant glycoprotein expressed by these cell lines did not have two sialic acids at present. Therefore, the current work has focused on the transfer of active ST3 enzyme gene into SfSWT-1 and SfSWT-3 cell lines.
Disclosure of Invention
in view of the above problems in the prior art, the main object of the present invention is to provide an insect baculovirus expression vector which can efficiently express a humanized antibody containing a heavy chain and a light chain, a construction method and applications thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
The insect baculovirus expression vector comprises an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence and an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region, wherein the sequence of the expression vector I is shown as a sequence table SEQ ID 1, and the sequence of the expression vector II is shown as a sequence table SEQ ID 2;
The insect baculovirus expression vector III containing alpha-2, 3-sialylglycosyltransferase ST3 is also included, and the sequence of the expression vector III is shown in a sequence table SEQ ID 3.
More preferably, the expression vectors I, II and III are pFAST Bac1 vectors.
As a further preference, the promoter of the expression vector III is baculovirus very early weak promoter ie 1.
the construction method of the insect baculovirus expression vector comprises the following steps:
The construction method of the vector I comprises the following steps: designing primers to clone a Kappa conserved region fragment of a human antibody light chain from a pFUSE2ss-CLIg-hk vector and connecting the fragment to a pFAST Bac1 vector;
the construction method of the vector II comprises the following steps: designing a primer to clone a human antibody heavy chain IgG1 conserved region fragment from a pFUSs-CHIg-hG 1 vector, and connecting the fragment to a pFAST Bac1 vector;
The construction method of the vector III comprises the following steps: the PH promoter of the pFAST Bac1 vector was replaced with the viral very early weak promoter ie1, and the human α -2, 3-sialylglycosyltransferase ST3 gene was cloned into the pFAST Bac1 vector containing the promoter ie 1.
More preferably, in the method for constructing the vector I, the human antibody light chain Kappa conserved region fragment and the pFAST Bac1 vector are each subjected to double digestion, mixed at a molar ratio of 3:1, and then ligated by a ligase.
further preferably, in the construction method of the vector I, the cloning method comprises: a pFUSE2ss-CLIg-hk vector is used as a template, and a primer is designed to amplify the IgKappa light chain conserved region of the pFUSE2ss-CLIg-hk vector.
more preferably, in the method for constructing the vector I, the primers are an upstream primer L1 and a downstream primer L2, the sequence of the upstream primer L1 is shown as SEQ ID 4, and the sequence of the downstream primer L2 is shown as SEQ ID 5.
More preferably, in the method for constructing the vector II, the fragment of the human antibody heavy chain IgG1 conserved region and the pFAST Bac1 vector are each subjected to double digestion, mixed at a molar ratio of 3:1, and then ligated by a ligase.
Further preferably, in the construction method of the vector II, the cloning method comprises the following steps: and (3) designing a primer to amplify the IgG1 heavy chain conserved region of the pFUSs-CHIg-hG 1 vector by using the pFUSs-CHIg-hG 1 vector as a template.
more preferably, in the method for constructing the vector II, the primers are an upstream primer H1 and a downstream primer H2, the sequence of the upstream primer H1 is shown as SEQ ID 6, and the sequence of the downstream primer H2 is shown as SEQ ID 7.
More preferably, the amplification reaction system used in the method for constructing the vector I and the vector II is: pre-denaturation at 94 ℃ for 5min, at 94 ℃ for 45s, at 58 ℃ for 1min, and at 72 ℃ for 45s, for 30 cycles in total, and extension at 72 ℃ for 10 min.
More preferably, in the method for constructing the vector III, the substitution includes the following: amplifying a part of pFAST Bac1 vector without pPH promoter by taking pFAST Bac1 vector plasmid as a template; synthesizing a baculovirus very early weak promoter ie1, and connecting the promoter ie1 with the amplified pFAST Bac1 vector to obtain a virus expression vector containing the baculovirus very early weak promoter ie 1.
Further preferably, in the method for constructing the vector III, the amplification reaction system includes the following: pfu enzyme is adopted, the amplification conditions are 94 ℃ for 2min, 94 ℃ for 15s, 60 ℃ for 30s and 72 ℃ for 90s, 35 cycles of amplification are carried out, the temperature is 72 ℃ for 7min, and the length of the amplified fragment is 4647 bp.
More preferably, the human alpha-2, 3-sialylglycosyltransferase ST3 gene fragment and the pFAST Bac1 vector containing the promoter ie1 are subjected to double enzyme digestion, mixed in a molar ratio of 2:1, and then linked by a ligase.
As a further preference, the human alpha-2, 3-sialylglycosyltransferase ST3 gene has the sequence shown in SEQ ID 8.
preferably, in the construction method of the vector I, the vector II and the vector III, the double enzyme digestion is BamHI and HindIII double enzyme digestion.
The application of the insect baculovirus expression vector in preparing full-length antibody comprises the following steps:
Respectively cloning a hybridoma cell light chain variable region gene sequence and a hybridoma cell heavy chain variable region gene sequence secreting a mouse monoclonal antibody;
Linking the light chain variable region nucleic acid sequence to an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence, and linking the heavy chain variable region nucleic acid sequence to an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region;
Respectively adopting insect baculovirus expression vector I and insect baculovirus expression vector II to transfect and construct recombinant baculovirus particles to obtain two viruses;
And (3) infecting insect cells by mixing the two viruses to obtain the recombinant human-mouse chimeric antibody.
Preferably, the light chain variable region gene sequence is shown in SEQ ID 9, and the heavy chain variable region gene sequence is shown in SEQ ID 10.
Further preferably, in cloning, the light chain variable region gene sequence of the murine monoclonal antibody is amplified by using primers L3 and L4, and the heavy chain variable region gene sequence of the murine monoclonal antibody is amplified by using primers H3 and H4, wherein the primer sequences L3, L4, H3 and H4 are respectively shown as SEQ ID 11, 12, 13 and 14.
the application of the insect baculovirus expression vector in expressing the human glycoprotein comprises the following steps: and (3) constructing the characteristic protein gene on an expression vector III, and transfecting the insect cell by using the expression vectors I, II and III respectively to obtain three viruses, wherein the three viruses are mixed to infect the insect cell SfSWT-3 cell together.
As a further preference, the infection method is to add the virus solution to cultured SfSWT-3 cells.
The invention has the beneficial effects that:
(1) Antibody detection experiments prove that the insect baculovirus expression vector can efficiently express the humanized antibody containing the heavy chain and the light chain.
(2) The glycosylation modification mode of the recombinant antibody obtained by the invention is consistent with the glycosylation modification mode in human body.
(3) The antibody preparation method of the invention has large expression quantity, low cost and high efficiency.
(4) The antibody dry powder prepared by the invention can be used as a diagnostic raw material for serological examination.
(5) the present invention can express active ST3 enzyme gene in SfSWT-3 cell line.
drawings
FIG. 1 is a Western Blot of recombinant full-length antibodies prepared in the examples of the present invention.
Detailed Description
the application provides an insect baculovirus expression vector, a construction method and application thereof, and the obtained expression vector can efficiently express a humanized antibody containing a heavy chain and a light chain.
The insect baculovirus expression vector comprises an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence and an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region, wherein the sequence of the expression vector I is shown as a sequence table SEQ ID 1, and the sequence of the expression vector II is shown as a sequence table SEQ ID 2;
The insect baculovirus expression vector III containing alpha-2, 3-sialylglycosyltransferase ST3 is also included, and the sequence of the expression vector III is shown in a sequence table SEQ ID 3;
The expression vectors I, II and III are pFAST Bac1 vectors.
The expression elements of the vector I comprise: PH promoter, SV40pA, Tn7L, f1ori, ampicillin, pUC ori, Tn7R, Gentamicin, Kappa conserved region, multiple cloning site, etc.
the expression elements of the vector II comprise: the PH promoter, SV40pA, Tn7L, f1ori, ampicillin, pUC ori, Tn7R, Gentamicin, IgG1 heavy chain conserved region, multiple cloning site, and the like.
The promoter of the expression vector III is a baculovirus very early weak promoter ie 1.
The construction method of the insect baculovirus expression vector comprises the following steps:
The construction method of the vector I comprises the following steps: designing primers to clone a Kappa conserved region fragment of a human antibody light chain from a pFUSE2ss-CLIg-hk vector and connecting the fragment to a pFAST Bac1 vector;
The construction method of the vector II comprises the following steps: designing a primer to clone a human antibody heavy chain IgG1 conserved region fragment from a pFUSs-CHIg-hG 1 vector, and connecting the fragment to a pFAST Bac1 vector;
The construction method of the vector III comprises the following steps: the PH promoter of the pFAST Bac1 vector was replaced with the viral very early weak promoter ie1, and the human α -2, 3-sialylglycosyltransferase ST3 gene was cloned into the pFAST Bac1 vector containing the promoter ie 1. The human alpha-2, 3-sialylglycosyltransferase ST3 gene sequence is shown in SEQ ID 8.
the application of the insect baculovirus expression vector in preparing the full-length antibody comprises the following steps:
Respectively cloning a hybridoma cell light chain variable region gene sequence and a hybridoma cell heavy chain variable region gene sequence secreting a mouse monoclonal antibody;
linking the light chain variable region nucleic acid sequence to an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence, and linking the heavy chain variable region nucleic acid sequence to an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region;
Respectively adopting insect baculovirus expression vector I and insect baculovirus expression vector II to transfect and construct recombinant baculovirus particles to obtain two viruses;
And (3) infecting insect cells by mixing the two viruses to obtain the recombinant human-mouse chimeric antibody.
The gene sequence of the light chain variable region is shown as SEQ ID 9, and the gene sequence of the heavy chain variable region is shown as SEQ ID 10.
The application of the insect baculovirus expression vector in expressing the human glycoprotein comprises the following steps: and (3) constructing the characteristic protein gene on an expression vector III, and transfecting the insect cell by using the expression vectors I, II and III respectively to obtain three viruses, wherein the three viruses are mixed to infect the insect cell SfSWT-3 cell together.
in order to better understand the technical solution, the technical solution will be described in detail with reference to the drawings and the specific embodiments.
Example 1
The expression of the humanized antibody is performed below by taking the mouse HER2 monoclonal antibody as an example.
Construction of recombinant antibody light chain variable region fusion expression vector I
GGATCC AAGCTTa pFUSE2ss-CLIg-hk vector is taken as a template, and a pair of primers is designed to amplify an Ig Kappa Light conserved region of the vector, and the specific steps are as follows: with an upstream primer L1: CGGGCGCGGATCCGAATTCACCGGTCACCATGG and downstream primer L2: TTCTCGACAAGCTTCTCCCTCTAACACTCTCC, using pFUSE2ss-CLIg-hk vector plasmid as template, pre-denaturing at 94 ℃ for 5min,94 ℃ for 45s,58 ℃ for 1min, and 72 ℃ for 45s, performing 30 cycles, and extending at 72 ℃ for 10 min. And (3) carrying out electrophoretic recovery on the PCR product, and carrying out double enzyme digestion on BamH I and Hind III to obtain a humanized antibody light chain Kappa conserved region fragment containing multiple cloning sites. Culturing a vector containing pFAST Bac1 in escherichia coli, extracting a plasmid, carrying out double enzyme digestion on the plasmid by the same BamH I and Hind III, recovering a digestion fragment, and carrying out enzyme digestion on the fragment by using a light chain Kappa conserved region fragment: the pFAST Bac1 vector is mixed in the ratio of 3:1, T4DNA ligase is added for linking, Escherichia coli DH10Bac is transformed, and ampicillin-resistant strains are selected to be successfully constructed vectors.
GAATTC CCATGGFusion protein construction and expression (in antibody production): 1. recovering hybridoma cells, culturing cells and synthesizing cDNA, extracting mRNA from a hybridoma cell strain secreting the anti-HER 2 monoclonal antibody by a conventional method, and carrying out reverse transcription on the mRNA serving as a template into cDNA in vitro by reverse transcriptase catalysis (RT-PCR). Amplifying by using universal mixed primers at both ends of the variable region, then connecting to a cloning vector pMD18-T, randomly selecting some clone sequencing to verify correct antibody genes to obtain a mouse monoclonal antibody light chain variable region gene sequence, and performing amplification by using a primer L3: AGTCCGAATTCGACATCCAGATGACCCAGTC and L4: TGACTGCCATGGACGCTTGATCTCCACCTTGG amplifying the variable region sequence of the gene, and inserting EcoRI and NcoI into the constructed expression vector by double enzyme digestion.
Construction of recombinant antibody heavy chain variable region fusion expression vector II
GGATCC AAGCTTa pFUSEs-CHIg-hG 1 vector is used as a template, and a pair of primers is designed to amplify an IgG1 heavy chain conserved region of the vector. The method comprises the following specific steps: with an upstream primer H1: GCGCGGATCCGAATTCGATATCTCGAGTGCTAG and downstream primer H2: CTCGACAAGCTTCCAGCTAGGACTCATTTAC, using pFUSE2ss-CLIg-hk vector plasmid as template, pre-denaturing at 94 ℃ for 5min,94 ℃ for 45s,58 ℃ for 1min, and 72 ℃ for 45s, performing 30 cycles, and extending at 72 ℃ for 10 min. And (3) carrying out electrophoretic recovery on the PCR product, and carrying out double enzyme digestion to obtain a humanized antibody IgG1 heavy chain conserved region fragment containing the multiple cloning sites. Culturing the vector containing pFAST Bac1 in Escherichia coli, extracting plasmid, carrying out double enzyme digestion on BamHI and HindIII, recovering the enzyme digestion fragment, and carrying out the separation treatment on the fragment by using an IgG1 heavy chain conserved region: the pFAST Bac1 vector is mixed in the ratio of 3:1, T4DNA ligase is added for linking, Escherichia coli DH10Bac is transformed, and ampicillin-resistant strains are selected to be successfully constructed vectors.
GAATTC GATATCFusion protein construction and expression (in antibody production): 1. recovering hybridoma cells, culturing cells and synthesizing cDNA, extracting mRNA from a hybridoma cell strain secreting the anti-HER 2 monoclonal antibody by a conventional method, and carrying out reverse transcription on the mRNA serving as a template into cDNA in vitro by reverse transcriptase catalysis (RT-PCR). The universal mixed primers at two ends of the variable region are used for amplification, then the variable region is connected to a cloning vector pMD18-T, some cloning sequencing is randomly selected to verify the correct antibody gene, the mouse single-antibody heavy chain variable region gene sequence is obtained, the heavy chain variable region sequence of the antibody gene is amplified by using primers H3: AGTCCGAATTCGAGGTGCAGCTGGTGGAGTC and H4: GCTAAGATATCCACGGTCACCAGGTACC, and EcoRI and EcoRV are inserted into the constructed expression vector by double enzyme digestion.
construction of vector III containing baculovirus very early promoter ie1 and human alpha-2, 3-sialylglycosyltransferase ST3
Promoter exchange: pFAST Bac1 vector plasmid is used as template, the part of the vector not containing pPH promoter is amplified by primers, pfu enzyme is used, the amplification conditions are 94 ℃ for 2min, 94 ℃ for 15s, 60 ℃ for 30s and 72 ℃ for 90s, 35 cycles of amplification are carried out, 72 ℃ for 7min, and the length of the amplified fragment is 4647 bp. Meanwhile, a baculovirus very early promoter ie1 is synthesized and connected with the blunt end of the vector, and the virus expression vector containing the baculovirus very early weak promoter ie1 is obtained by selective cloning, PCR and sequencing verification.
construction of expression vector III: cloning a human alpha-2, 3-sialyl glycosyltransferase ST3 gene onto the vector, converting a human alpha-2, 3-sialyl glycosyltransferase ST3 protein sequence into a gene sequence suitable for expression in insect cells according to codon preference, synthesizing the sequence, carrying out enzyme cutting sites BamH I and Hind III on two ends during synthesis, carrying out double enzyme cutting on the synthesized ST3 gene fragment and a vector containing an ie1 promoter by BamH I and Hind III respectively, mixing in a ratio of 2:1, adding T4DNA ligase for connection, converting escherichia coli DH10Bac, selecting clone, and carrying out PCR verification to obtain the expression vector for expressing the ST3 gene. Extracting the plasmid for later use.
transfection of the three viral vectors I, II, III (when expressing human glycoprotein)
Sf9 cells were taken and cultured in Grace's medium in a CO 2-free cell incubator at 27 ℃. Three recombinant baculovirus DNAs, namely a heavy chain expression vector, a light chain expression vector and an ST3 expression vector were transfected into sf9 cells in a logarithmic growth phase, i.e., with a fusion rate of 80% or more, respectively, in a 6-well culture plate using Cellfectin. The transfection method is as follows: respectively preparing solution A (LR reactant 8 mu l, serum-free and antibiotic-free Grace's culture medium 100 mu l) and solution B (6 mu l Cellffectin, Grace's serum-free and antibiotic-free Grace's culture medium 100 mu l), gently mixing the two solutions, standing at room temperature for 35min, adding 800 mu l serum-free and antibiotic-free Grace's culture medium, gently mixing; removing the culture medium in a six-hole plate, rinsing with serum-free antibiotic-free Grace's culture medium to remove residual serum, adding an AB mixture, incubating at 27 ℃ for 5 hours, removing the culture supernatant, adding 2ml of Grace's complete culture medium containing 50 units/ml of penicillin and 50ug/ml of streptomycin into each hole, culturing for 96 hours, centrifuging at 4500rpm for 10 minutes, collecting the culture supernatant to obtain the baculovirus of the recombinant antibody, which is a P1 strain, subpackaging, and storing at-80 ℃ in a dark place for later use.
amplification of the virus: on the day of infection, Sf9 and Sf21 cell supernatants and cell plates, 2X106 cells/well, were prepared. The cells were exposed to room temperature for 1 hour, after 1 hour the cells were examined by inverted microscope for adsorption, the appropriate amount of P1 strain was added to each well, the cells were incubated at 27 ℃ in a humidified incubator for 96 hours, and after 72 hours of infection, 2ml of virus-containing supernatant medium was collected from each well and transferred to a 15ml tube. Cells and debris were discarded by centrifugation at 500Xg for 5 minutes. The supernatant was transferred to a 15ml tube. This was the P2 strain, stored at 4 ℃ protected from light. The whole plant needs to be preserved for a long time at-80 ℃. The titer of your P2 strain was checked and the P3 strain was prepared in the same way. P3 virus transfected by the heavy chain vector, the light chain vector and the ST3 expression vector is collected respectively, and then SfSWT-3 cells modified by the Sf9 cell strain are mixed and infected, wherein the infection method is to add the venom into the cultured cells.
Detection experiment
Detection of antibodies and glycosylation Pattern detection of detection humanized antibodies
and a, taking SfSWT-3 cells after the 1 × 106 recombinant baculovirus is infected for 96h, taking uninfected SfSWT-3 cells as a negative control and taking SfSWT-3 cells infected with the pFastBacI-Gus baculovirus as a positive control. After the cells are respectively lysed, the cells are uniformly mixed by using equal 2 Xgel sample adding buffer solution, 20 mu l of sample adding electrophoresis is respectively carried out, 3 groups of cell lysates are respectively electrophoresed, and 3 PVDF membranes are transferred by utilizing a Bio-Rad protein transfer system, so that the existence of recombinant humanized antibody protein can be conveniently detected by various antibodies and proteins. 5% skimmed milk powder was blocked for 1h at room temperature with a 1: 5000 anti-human Kappa chain-HRP monoclonal antibody, 1: 200 rabbit anti-Kappa chain polyclonal antibody, and 1: 3 pieces of PVDF membrane were incubated with 2000 mouse anti-human Kappa chain monoclonal antibodies, respectively, overnight at 4 ℃. After PBST membrane washing, the PVDF membrane is respectively incubated with corresponding secondary HRP-labeled antibodies at room temperature, PBST membrane washing and DAB color development are carried out, and the result is shown in figure 1. In FIG. 1, from left to right, lane 1 is the electrophoresis of the full-length antibody after heat reduction, lanes 2 and 3 are the electrophoresis of the full-length antibody without heat reduction, and by the molecular weight control, it can be seen that the full-length antibody prepared in example 1 of the present application has a complete structure, and the heavy chain and the light chain are successfully assembled.
b. Insect cell lines were detected by ELISA. Coating an enzyme label plate with an anti-human KAPPA chain antibody at 4 ℃ overnight, and sealing with 5% milk sealing solution for 2 h; adding the supernatant (-) of the normal transfection insect cell, the human IgG standard (100ng/ml- +) and the expression supernatant of the insect cell respectively, incubating for 30min at 37 ℃ by 100 mul respectively, and washing for 5 times and 3 min/time by using an ELISA washing solution; diluting HRP-labeled recombinant HER2 protein with ELISA diluent, respectively adding into the wells, incubating at 37 ℃ for 30min, and washing with ELISA washing solution for 5 times and 3 min/time; adding 100 ul/hole of color development liquid, developing in dark at 37 ℃ for 10min, adding 50 mul/hole of 2mol/L sulfuric acid, and detecting with a microplate reader. And determining the antibody expression capacity of the antibiotic double-screened insect cell strain according to the detection result of the microplate reader. The results show significant binding of the antibody.
A humanized antibody affinity purified against HER2 protein. Humanized mouse hybrid antibodies can be isolated and purified from a cell disruption solution of insect cells. The main steps are collecting the culture supernatant, centrifuging at 4 ℃, 12000rpm multiplied by 10min, and discarding the precipitate. Filtering with 0.45 μm filter membrane to further remove cell impurities to avoid blocking the chromatographic column; using 10 times volume binding buffer
(20mM PBS, pH7.0) equilibration of Hitrap Protein A prepacked column: loading, and washing away the unbound protein by using a binding buffer with 10 times volume until the Bradford detection solution does not develop color; eluting with 5 volumes of elution buffer (0.1M citric acid solution, pH3.6), detecting the elution with Bradford assay solution, collecting the elution peak, and adjusting the pH to 7.0 with 1M Tris-HCI (pH 9.0); sampling from the collected product, performing SDS-PAGE detection, dialyzing the rest purified products by PBS liquid at 4 ℃ overnight, subpackaging, and storing at-80 ℃.
d. Collected IgG is subjected to enzymolysis by papain, purified by HPLC, and analyzed by MALDI-TOF technology for two glycoside types and specific N-glycosylation sites of the IgG. And the sugar chain structure was detected by mass spectrometry: the enzyme-cleaved and dried sample was fully dissolved in phase A solution (5% ACN, 0.1% formic acid), centrifuged at high speed, and the upper solution was added to the sample flask for on-line LC-MS analysis. The liquid chromatogram is a reversed phase high performance liquid chromatogram and is directly connected with an ion source interface of the mass spectrum. Mobile phase solution 95% ACN, 0.1% formic acid. The sample bottles were placed in an autosampler to sample at a flow rate of 25. mu.L/min, and after sampling, the samples were separated at a flow rate gradient of 500 nL/min. Mass spectrometry was performed on a nanoESI-LTQ-Orbitrap. Scanning in positive ion mode. First-level Orbitrap analysis, ion collection range m/z400-2000, resolution m/z400 60000 in DDA mode to take the ten first-level ion to carry out second-level analysis. And (4) secondary LTQ analysis, wherein the selected ions are fully scanned to enter LTQ for CID fragmentation, and a secondary fragmentation spectrum is obtained by scanning.
Analysis showed a conserved N-linked glycosylation site Asn297 in the CH2 region of the FC segment of the heavy chain. The glycosylation structure of the site is two N-linked two-branch biantennary compound oligosaccharides, which contain high mannose type (Hex4-6HexNAc2), heterozygote type (NeuAc0-1Fuc0-1Hex4-6HexNAc2-4) and complex type (Fuc0-1Hex3-4HexNAc3-6 sugar chain, the end of which is disialyl.
The technical scheme in the embodiment of the application at least has the following technical effects or advantages:
(1) Antibody detection experiments prove that the insect baculovirus expression vector can efficiently express the humanized antibody containing the heavy chain and the light chain.
(2) The glycosylation modification mode of the recombinant antibody obtained by the invention is consistent with the glycosylation modification mode in human body.
(3) The antibody preparation method of the invention has large expression quantity, low cost and high efficiency.
(4) The antibody dry powder prepared by the invention can be used as a diagnostic raw material for serological examination.
(5) The present invention can express active ST3 enzyme gene in SfSWT-3 cell line.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention. It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
SEQUENCE LISTING
<110> Wuhan Kingkurui bioengineering GmbH
<120> insect baculovirus expression vector, construction method and application thereof
<130> 2016
<160> 14
<170> PatentIn version 3.3
<210> 1
<211> 5035
<212> DNA
<213> Baculovirus
<400> 1
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat 1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg 2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat actggacttt 2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag aacgtaagcc 3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact gtacaaaaaa 3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc gcaaggtttc 3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc ggaatattaa 3900
tagatcatgg agataattaa aatgataacc atctcgcaaa taaataagta ttttactgtt 3960
ttcgtaacag ttttgtaata aaaaaaccta taaatattcc ggattattca taccgtccca 4020
ccatcgggcg cggatccgaa ttcaccggtc accatggaaa tcaaacgtac ggtggctgca 4080
ccatctgtct tcatcttccc gccatctgat gagcagttga aatctggaac tgcctctgtt 4140
gtgtgcctgc tgaataactt ctatcccaga gaggccaaag tacagtggaa ggtggataac 4200
gccctccaat cgggtaactc ccaggagagt gtcacagagc aggacagcaa ggacagcacc 4260
tacagcctca gcagcaccct gacgctgagc aaagcagact acgagaaaca caaagtctac 4320
gcctgcgaag tcacccatca gggcctgagc tcgcccgtca caaagagctt caacagggga 4380
gagtgttaga gggagaagct tgtcgagaag tactagagga tcataatcag ccataccaca 4440
tttgtagagg ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat 4500
aaaatgaatg caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa 4560
agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt 4620
ttgtccaaac tcatcaatgt atcttatcat gtctggatct gatcactgct tgagcctagg 4680
agatccgaac cagataagtg aaatctagtt ccaaactatt ttgtcatttt taattttcgt 4740
attagcttac gacgctacac ccagttccca tctattttgt cactcttccc taaataatcc 4800
ttaaaaactc catttccacc cctcccagtt cccaactatt ttgtccgccc acagcggggc 4860
atttttcttc ctgttatgtt tttaatcaaa catcctgcca actccatgtg acaaaccgtc 4920
atcttcggct actttttctc tgtcacagaa tgaaaatttt tctgtcatct cttcgttatt 4980
aatgtttgta attgactgaa tatcaacgct tatttgcagc ctgaatggcg aatgg 5035
<210> 2
<211> 5699
<212> DNA
<213> Baculovirus
<400> 2
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat 1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg 2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat actggacttt 2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag aacgtaagcc 3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact gtacaaaaaa 3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc gcaaggtttc 3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc ggaatattaa 3900
tagatcatgg agataattaa aatgataacc atctcgcaaa taaataagta ttttactgtt 3960
ttcgtaacag ttttgtaata aaaaaaccta taaatattcc ggattattca taccgtccca 4020
ccatcgggcg cggatccgaa ttcgatatct cgagtgctag caccaagggc ccatcggtct 4080
tccccctggc accctcctcc aagagcacct ctgggggcac agcggccctg ggctgcctgg 4140
tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc ctgaccagcg 4200
gcgtgcacac cttcccggct gtcctacagt cctcaggact ctactccctc agcagcgtgg 4260
tgaccgtgcc ctccagcagc ttgggcaccc agacctacat ctgcaacgtg aatcacaagc 4320
ccagcaacac caaggtggac aagaaagttg agcccaaatc ttgtgacaaa actcacacat 4380
gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtcttcctc ttccccccaa 4440
aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg gtggtggacg 4500
tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcgtg gaggtgcata 4560
atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc 4620
tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag gtctccaaca 4680
aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag ccccgagaac 4740
cacaggtgta caccctgccc ccatcccggg aggagatgac caagaaccag gtcagcctga 4800
cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag agcaatgggc 4860
agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc tccttcttcc 4920
tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc ttctcatgct 4980
ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc ctgtctccgg 5040
gtaaatgagt cctagctgga agcttgtcga gaagtactag aggatcataa tcagccatac 5100
cacatttgta gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa 5160
acataaaatg aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa 5220
ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 5280
tggtttgtcc aaactcatca atgtatctta tcatgtctgg atctgatcac tgcttgagcc 5340
taggagatcc gaaccagata agtgaaatct agttccaaac tattttgtca tttttaattt 5400
tcgtattagc ttacgacgct acacccagtt cccatctatt ttgtcactct tccctaaata 5460
atccttaaaa actccatttc cacccctccc agttcccaac tattttgtcc gcccacagcg 5520
gggcattttt cttcctgtta tgtttttaat caaacatcct gccaactcca tgtgacaaac 5580
cgtcatcttc ggctactttt tctctgtcac agaatgaaaa tttttctgtc atctcttcgt 5640
tattaatgtt tgtaattgac tgaatatcaa cgcttatttg cagcctgaat ggcgaatgg 5699
<210> 3
<211> 5245
<212> DNA
<213> Baculovirus
<400> 3
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat 1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg 2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat actggacttt 2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag aacgtaagcc 3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact gtacaaaaaa 3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc gcaaggtttc 3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc ggaatattaa 3900
tagtcgatgt ctttgtgatg cgcgcgacat ttttgtaggt tattgataaa atgaacggat 3960
acgttgcccg acattatcat taaatccttg gcgtagaatt tgtcgggtcc attgtccgtg 4020
tgcgctagca tgcccgtaac ggacctcgta cttttggctt caaaggtttt gcgcacagac 4080
aaaatgtgcc acacttgcag ctctgcatgt gtgcgcgtta ccacaaatcc caacggcgca 4140
gtgtacttgt tgtatgcaaa taaatctcga taaaggcgcg gcgcgcgaat gcagctgatc 4200
acgtacgctc ctcgtgttcc gttcaaggac ggtgttatcg acctcagatt aatgtttatc 4260
ggccgactgt tttcgtatcc gctcaccaaa cgcgtttttg cattaacatt gtatgtcggc 4320
ggatgttcta tatctaattt gaataaataa acgataaccg cgttggtttt agagggcata 4380
ataaaagaaa tattgttatc gtgttcgcca ttagggcagt ataaattgac gttcatgttg 4440
gatattgttt cagttgcaag ttgacactgg cggcgacaag atcgtgaaca accaagtgac 4500
tgatcccggt ccgaagcgcg cggaattcaa aggcctacgt cgacgagctc actagtcgcg 4560
gccgctttcg aatctagagc ctgcagtctc gaggcatgcg gtaccaagct tgtcgagaag 4620
tactagagga tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac 4680
ctcccacacc tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg 4740
tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa 4800
gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat 4860
gtctggatct gatcactgct tgagcctagg agatccgaac cagataagtg aaatctagtt 4920
ccaaactatt ttgtcatttt taattttcgt attagcttac gacgctacac ccagttccca 4980
tctattttgt cactcttccc taaataatcc ttaaaaactc catttccacc cctcccagtt 5040
cccaactatt ttgtccgccc acagcggggc atttttcttc ctgttatgtt tttaatcaaa 5100
catcctgcca actccatgtg acaaaccgtc atcttcggct actttttctc tgtcacagaa 5160
tgaaaatttt tctgtcatct cttcgttatt aatgtttgta attgactgaa tatcaacgct 5220
tatttgcagc ctgaatggcg aatgg 5245
<210> 4
<211> 33
<212> DNA
<213> artifical sequence
<400> 4
cgggcgcgga tccgaattca ccggtcacca tgg 33
<210> 5
<211> 32
<212> DNA
<213> artifical sequence
<400> 5
ttctcgacaa gcttctccct ctaacactct cc 32
<210> 6
<211> 33
<212> DNA
<213> artifical sequence
<400> 6
gcgcggatcc gaattcgata tctcgagtgc tag 33
<210> 7
<211> 31
<212> DNA
<213> artifical sequence
<400> 7
ctcgacaagc ttccagctag gactcattta c 31
<210> 8
<211> 1020
<212> DNA
<213> Homo sapiens
<400> 8
atggtgaccc tgcgtaagcg taccctgaag gtgctgacct tcctggtgct gttcatcttc 60
ctgacctcct tcttcctgaa ctactcccac accatggtgg ctaccacctg gttccccaag 120
cagatggtgc tggagctgtc cgagaacctg aagcgtctga tcaagcaccg tccctgcacc 180
tgcacccact gcatcggtca gcgtaagctg tccgcttggt tcgacgagcg tttcaaccag 240
accatgcagc ccctgctgac cgctcagaac gctctgctgg aggacgacac ctaccgttgg 300
tggctgcgtc tgcagcgtga gaagaagccc aacaacctga acgacaccat caaggagctg 360
ttccgtgtgg tgcccggtaa cgtggacccc atgctggaga agcgttccgt gggttgccgt 420
cgttgcgctg tggtgggtaa ctccggtaac ctgcgtgagt cctcctacgg tcccgagatc 480
gactcccacg acttcgtgct gcgtatgaac aaggctccca ccgctggttt cgaggctgac 540
gtgggtacca agaccaccca ccacctggtg taccccgagt ccttccgtga gctgggtgac 600
aacgtgtcca tgatcctggt gcccttcaag accatcgacc tggagtgggt ggtgtccgct 660
atcaccaccg gtaccatctc ccacacctac atccccgtgc ccgctaagat ccgtgtgaag 720
caggacaaga tcctgatcta ccaccccgct ttcatcaagt acgtgttcga caactggctg 780
cagggtcacg gtcgttaccc ctccaccggt atcctgtccg tgatcttctc catgcacgtg 840
tgcgacgagg tggacctgta cggtttcggt gctgactcca agggtaactg gcaccactac 900
tgggagaaca acccctccgc tggtgctttc cgtaagaccg gtgtgcacga cgctgacttc 960
gagtccaacg tgaccgctac cctggcttcc atcaacaaga tccgtatctt caagggtcgt 1020
<210> 9
<211> 324
<212> DNA
<213> Mus musculus
<400> 9
gacatccaga tgacccagtc cccctcctcc ctgtccgctt ccgtgggtga ccgtgtgacc 60
atcacctgca aggcttccca ggacgtgtcc atcggtgtgg cttggtacca gcagaagccc 120
ggtaaggctc ccaagctgct gatctactcc gcttcctacc gttacaccgg tgtgccctcc 180
cgtttctccg gttccggttc cggtaccgac ttcaccctga ccatctcctc cctgcagccc 240
gaggacttcg ctacctacta ctgccagcag tactacatct acccctacac cttcggtcag 300
ggtaccaagg tggagatcaa gcgt 324
<210> 10
<211> 351
<212> DNA
<213> Mus musculus
<400> 10
gaggtgcagc tggtggagtc cggtggtggt ctggtgcagc ccggtggttc cctgcgtctg 60
tcctgcgctg cttccggttt caccttcacc gactacacca tggactgggt gcgtcaggct 120
cccggtaagg gtctggagtg ggtggctgac gtgaacccca actccggtgg ttccatctac 180
aaccagcgtt tcaagggtcg tttcaccctg tccgtggacc gttccaagaa caccctgtac 240
ctgcagatga actccctgcg tgctgaggac accgctgtgt actactgcgc tcgtaacctg 300
ggtccctcct tctacttcga ctactggggt cagggtaccc tggtgaccgt g 351
<210> 11
<211> 31
<212> DNA
<213> artifical sequence
<400> 11
agtccgaatt cgacatccag atgacccagt c 31
<210> 12
<211> 32
<212> DNA
<213> artifical sequence
<400> 12
tgactgccat ggacgcttga tctccacctt gg 32
<210> 13
<211> 31
<212> DNA
<213> artifical sequence
<400> 13
agtccgaatt cgaggtgcag ctggtggagt c 31
<210> 14
<211> 28
<212> DNA
<213> artifical sequence
<400> 14
gctaagatat ccacggtcac caggtacc 28
Claims (12)
1. An insect baculovirus expression vector characterized by: the expression vector comprises an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence and an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region, wherein the sequence of the expression vector I is shown as a sequence table SEQ ID 1, and the sequence of the expression vector II is shown as a sequence table SEQ ID 2;
The insect baculovirus expression vector III containing alpha-2, 3-sialylglycosyltransferase ST3 is also included, and the sequence of the expression vector III is shown in a sequence table SEQ ID 3.
2. The insect baculovirus expression vector of claim 1, wherein: the expression vectors I, II and III are pFAST Bac1 vectors.
3. An insect baculovirus expression vector as claimed in claim 1or 2, wherein: the promoter of the expression vector III is a baculovirus very early weak promoter ie 1.
4. A method of constructing an insect baculovirus expression vector as claimed in any one of claims 1 to 3, wherein: the method comprises the following steps:
The construction method of the vector I comprises the following steps: designing primers to clone a Kappa conserved region fragment of a human antibody light chain from a pFUSE2ss-CLIg-hk vector and connecting the fragment to a pFAST Bac1 vector;
The construction method of the vector II comprises the following steps: designing a primer to clone a human antibody heavy chain IgG1 conserved region fragment from a pFUSs-CHIg-hG 1 vector, and connecting the fragment to a pFAST Bac1 vector;
The construction method of the vector III comprises the following steps: the PH promoter of the pFAST Bac1 vector was replaced with the viral very early weak promoter ie1, and the human α -2, 3-sialylglycosyltransferase ST3 gene was cloned into the pFAST Bac1 vector containing the promoter ie 1.
5. The method of claim 4, wherein the expression vector of the insect baculovirus is constructed by: in the construction method of the carrier I, the Kappa conserved region fragment of the human antibody light chain and the pFAST Bac1 carrier are subjected to double enzyme digestion respectively, mixed according to the molar ratio of 3:1 and then connected by ligase; in the construction method of the vector II, the human antibody heavy chain IgG1 conserved region fragment and the pFAST Bac1 vector are subjected to double enzyme digestion, mixed according to a molar ratio of 3:1 and then connected through ligase.
6. The method of claim 4, wherein the expression vector of the insect baculovirus is constructed by: in the construction method of the vector I, the primers are an upstream primer L1 and a downstream primer L2, the sequence of the upstream primer L1 is shown as SEQ ID 4, and the sequence of the downstream primer L2 is shown as SEQ ID 5; in the construction method of the vector II, the primers are an upstream primer H1 and a downstream primer H2, the sequence of the upstream primer H1 is shown as SEQ ID 6, and the sequence of the downstream primer H2 is shown as SEQ ID 7.
7. The method of claim 4, wherein the expression vector of the insect baculovirus is constructed by: in the construction method of the vector III, the substitution comprises the following steps: amplifying a part of pFAST Bac1 vector without pPH promoter by taking pFAST Bac1 vector plasmid as a template; synthesizing a baculovirus very early weak promoter ie1, and connecting the promoter ie1 with the amplified pFAST Bac1 vector to obtain a virus expression vector containing the baculovirus very early weak promoter ie 1.
8. the method of claim 5, wherein the expression vector of the insect baculovirus is constructed by: the human alpha-2, 3-sialylglycosyltransferase ST3 gene fragment and the pFAST Bac1 vector containing a promoter ie1 are subjected to double enzyme digestion, mixed according to a molar ratio of 2:1 and then connected through ligase.
9. The method of claim 8, wherein the expression vector of the insect baculovirus is constructed by: in the construction method of the vector I, the vector II and the vector III, the double enzyme cutting is BamHI and HindIII double enzyme cutting.
10. use of an insect baculovirus expression vector as defined in any one of claims 1 to 3 for the production of full length antibodies, wherein: the application method comprises the following steps:
Respectively cloning a hybridoma cell light chain variable region gene sequence and a hybridoma cell heavy chain variable region gene sequence secreting a mouse monoclonal antibody;
Linking the light chain variable region nucleic acid sequence to an insect baculovirus expression vector I containing a human antibody light chain Kappa conserved region sequence, and linking the heavy chain variable region nucleic acid sequence to an insect baculovirus expression vector II containing a human antibody heavy chain IgG1 conserved region;
Respectively adopting insect baculovirus expression vector I and insect baculovirus expression vector II to transfect and construct recombinant baculovirus particles to obtain two viruses;
And (3) infecting insect cells by mixing the two viruses to obtain the recombinant human-mouse chimeric antibody.
11. Use of an insect baculovirus expression vector as defined in claim 10 for the production of full length antibodies, wherein: the gene sequence of the light chain variable region is shown as SEQ ID 9, and the gene sequence of the heavy chain variable region is shown as SEQ ID 10.
12. Use of an insect baculovirus expression vector as defined in any one of claims 1 to 3 for expressing a glycoprotein of human origin, wherein: the application method comprises the following steps: and (3) constructing the characteristic protein gene on an expression vector III, and transfecting the insect cell by using the expression vectors I, II and III respectively to obtain three viruses, wherein the three viruses are mixed to infect the insect cell SfSWT-3 cell together.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334911.7A CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334911.7A CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925610A CN105925610A (en) | 2016-09-07 |
| CN105925610B true CN105925610B (en) | 2019-12-06 |
Family
ID=56840769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610334911.7A Active CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925610B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109384848A (en) * | 2017-08-10 | 2019-02-26 | 深圳市雅臣智能生物工程有限公司 | Double targeting antibodies of anti-human papilloma virus (anti-HPV) and anti-CD humanization and combinations thereof, preparation method and application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2401421T3 (en) * | 2000-08-11 | 2013-04-19 | Mmrgolbal, Inc. | Method and ocposition to alter a pathology mediated by B cells |
| WO2008127359A2 (en) * | 2006-10-10 | 2008-10-23 | University Of Wyoming | An insect cell line for production of recombinant glycoproteins with sulfated complex n-glycans |
| CN104829732A (en) * | 2015-03-25 | 2015-08-12 | 温州医科大学 | Recombinant protein and expressing method thereof in insect baculovirus expression system |
-
2016
- 2016-05-19 CN CN201610334911.7A patent/CN105925610B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925610A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101307880B1 (en) | Recombinant expression of multiprotein complexes using polygenes | |
| CN111825772B (en) | Adeno-associated virus with variant capsid protein and application thereof | |
| CN112666348A (en) | Detection proteome of novel coronavirus SARS-CoV-2 and application thereof | |
| CN111593072B (en) | Method for co-expressing four structural proteins of African swine fever virus in insect cells and application of method | |
| US6645724B1 (en) | Assays for endotoxin | |
| CN114262381B (en) | Recombinant baculovirus with surface displaying African swine fever virus antigen P30 protein, preparation method and application thereof | |
| CN105925610B (en) | Insect baculovirus expression vector, construction method and application thereof | |
| CN112250738B (en) | Preparation, purification and identification method of severe acute respiratory syndrome coronavirus 2 virus-like particles | |
| CN112501139B (en) | Recombinant Newcastle disease virus strain and preparation method and application thereof | |
| CN104328136B (en) | The preparation of Newcastle disease poison strain rClone30 fliC and its application in Newcastle disease prevention | |
| CN104357409B (en) | Express chicken IL2 recombinant Newcastle disease virus and its application in vaccine | |
| CN115247173A (en) | Gene editing system for constructing TMPRSS6 gene mutant iron deficiency anemia pig nuclear transplantation donor cells and application thereof | |
| CN111748034B (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
| CN106755105A (en) | One plasmid Rescue System is used for the preparation and application of influenza virus vaccine strain | |
| CN107354172B (en) | Recombinant expression vector and construction method and application thereof | |
| CN109082443A (en) | A method of preparing can the cell model that breaks up to mature hepatic lineage of real-time detection mescenchymal stem cell | |
| CN113234746B (en) | Method for pesticide induced protein interaction and induced gene expression | |
| CN114957406B (en) | Trivalent antigen and trivalent virus-like particle of canine parvovirus and application | |
| CN114231564B (en) | rAAV vector core plasmid and application thereof | |
| CN113755512B (en) | Method for preparing tandem repeat protein and application thereof | |
| CN116640801A (en) | COVID-19 virus genetic engineering preventive vaccine and preparation method thereof | |
| CN112662647A (en) | Method for preparing recombinant NcoI restriction enzyme | |
| CN116135882A (en) | Alpaca-derived nano antibody M112 and application thereof | |
| CN116135880A (en) | Alpaca-derived nano antibody S140 and application thereof | |
| CN115247174A (en) | Gene editing system for constructing congenital gamma globulin deficiency model pig nuclear transplantation donor cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |