CN105925610A - Insect baculovirus expression vector, and building method and application thereof - Google Patents
Insect baculovirus expression vector, and building method and application thereof Download PDFInfo
- Publication number
- CN105925610A CN105925610A CN201610334911.7A CN201610334911A CN105925610A CN 105925610 A CN105925610 A CN 105925610A CN 201610334911 A CN201610334911 A CN 201610334911A CN 105925610 A CN105925610 A CN 105925610A
- Authority
- CN
- China
- Prior art keywords
- carrier
- sequence
- construction method
- expression vector
- baculovirus transfer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
Abstract
The invention provides an insect baculovirus expression vector, and a building method and application thereof. The insect baculovirus expression vector includes a first insect baculovirus expression vector containing a human antibody light chain Kappa conservative region sequence and a second insect baculovirus expression vector containing a human antibody heavy chain IgG1 conservative region sequence; the sequence of the first expression vector is shown as SEQ ID 1 in a sequence table; the sequence of the second expression vector is shown as SEQ ID 2 in the sequence table; the insect baculovirus expression vector also includes a third insect baculovirus expression vector containing alpha-2,3-sialic acid glycosyltransferase ST3; and the sequence of the third expression vector is shown as SEQ ID 3 in the sequence table. The insect baculovirus expression vector has the advantage that a humanized antibody comprising heavy chains and light chains can be efficiently expressed.
Description
Technical field
The invention belongs to gene engineering technology field, particularly relate to baculovirus transfer vector, construction method
And application.
Background technology
Antibody molecule possesses the complicated molecule structure of tetramer glycoprotein, and its extracellular expression follows " secretory protein "
Universal law: after light, the heavy chain of whole antibody molecule is each translated, through fold, assemble, glycosylation modified after
Just have a biological activity.By the clinical research listing antibody is found, host cell " turning over recombinant antibodies
Modify after translating ", directly influence clinical efficacy and the immunogenicity of antibody drug, all IgG molecules are only often
There is a glycosylation modified site of conservative N-in individual C γ 2 region Asn-297.It is connected to the sugar in this site
Chain contributes to maintaining quarternary structure and the Fc stability of IgG, and the combination for IgG with lectin carries
For glycosylation modified site.The Fc oligosaccharide of normal human IgG is mainly the complicated double antenna of core fucosylation
Type, how heterogeneous because of galactosylation and the sialylated generation of end sugar.According to terminal galactose quantity, can
The double antenna 32 polysaccharide sugar chain that Asn-297 connects is divided into three different subtypes IgG-G0 ,-G1 ,-G2, point
Do not account for 35%, 35% and the 16% of whole human serum IgG sugar chain；Other 14% is sialylated
The sugar chain of G1 and G2 type.In addition, IgG there is also there is (or nothing) bisection acetylglucosamine on a small quantity
The sugar chain of Fc without fucose.
Insecticide produces the N-sugar chain of sialydated glycoproteins and is insecticide glycobiology and utilizes insect baculovirus table
Reach a problem of systematic comparison contradiction.A lot of evidences show do not have sialic acid and saliva in insect cell line
The activity of acid transporter enzyme, the sugar-chain end of the recombinant glycoprotein that baculovirus expression system is expressed does not has sialic acid
Change.All in standard insect baculovirus expression system, wherein with sf21, sf9 and
BTI-Tn-5B1-4 (High Five) cell is simply as host, the sugar chain of restructuring N-glycoprotein, does not has saliva
Sialylated being combined that the low mannose type of liquid acidifying rather than mammal produce at identical glycosylation position
Type sugar chain.
Cell line SfSWT-1 is (containing GnT1,5 mammalian cells such as GnT2, GalT, ST3, ST6
Glycosyltransferase gene) there is the ability that the sugar chain of recombinant glycoprotein can be made well sialylated.We know
Road Sf9 cell line does not have CMP-sialic acid, and this material is sialyltransferase enzymatic activity
Substrate.The sugar chain being subsequently found in SfSWT-1 the recombinant glycoprotein expressed is sialylated, needs this cell
It is placed on and cultivates containing in additional sialic culture medium, just as FBS to be added, show that these insecticides are thin
Born of the same parents have offset-type route of nutrition.But this problem is quickly resolved, that is, closed by coding sialic acid
It is intracellular that the mammalian genes of enzyme and cmp sialic acid synzyme inserts SfSWT-1, the SfSWT-3 obtained
Cell strain, it becomes possible at intracellular synthesis cmp sialic acid, the sugar chain of formation is double antenna, end list saliva
The compound N-sugar chain of acidifying, but this cell will be in the cultivation containing ManNAc sialic acid precursor thing
Base grows.Here want especially it is emphasized that the most all sugar chains produced by transgenic insect cell
All on α-1,6 side chain of end, there is no sialic acid.This is because while at SfSWT-1 and SfSWT-3 thin
In born of the same parents' strain introduce mouse ST3GalIV gene, but can't detect sialic acid transhipment enzymatic activity, although illustrate from
It is able to detect that the expression of this gene in mRNA level in-site, but it can not encode an active gene and produce
Thing, the end of the sugar chain of the recombinant glycoprotein why this possible explanation is expressed by these cell strains at present does not has
Two sialic reasons.The most current focus is to SfSWT-1 and SfSWT-3 cell line transfer
Enter and can express active ST3 enzyme gene.
Summary of the invention
For the problems referred to above of the prior art, present invention is primarily targeted at offer baculovirus expression
Carrier, construction method and application thereof, described baculovirus transfer vector can contain heavy chain and light chain by high efficient expression
Humanized antibody.
In order to achieve the above object, the present invention adopts the following technical scheme that
Baculovirus transfer vector, shaft-like including the insecticide containing human antibody light chain Kappa conserved region sequence
Virus expression carrier I and the baculovirus transfer vector II containing human antibody heavy chain IgG1 conserved region, institute
State the sequence of expression vector I as shown in sequence table SEQ ID 1, the sequence such as sequence table of described expression vector II
Shown in SEQ ID 2；
Also include containing α-2, the baculovirus transfer vector III of 3-sialic acid glycosyl transferase ST3, institute
State the sequence of expression vector III as shown in sequence table SEQ ID 3.
As the most preferably, described expression vector I, II, III are pFAST Bac1 carrier.
As the most preferably, the promoter of described expression vector III is baculovirus pole weak promoter in early days
ie1。
The construction method of baculovirus transfer vector, comprises the steps:
The construction method of described carrier I is: design primer is cloned people anti-from pFUSE2ss-CLIg-hk carrier
Body light chain Kappa conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier II is: design primer is cloned people from pFUSEss-CHIg-hG1 carrier
Heavy chain of antibody IgG1 conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier III is: the PH promoter replacement of pFAST Bac1 carrier becomes virus pole
Weak promoter ie1 in early days, and human cloning α-2,3-sialic acid glycosyl transferase ST3 gene is to containing promoter
On the described pFAST Bac1 carrier of ie1.
As the most preferably, in the construction method of described carrier I, described human antibody light chain Kappa guards
District's fragment and pFAST Bac1 carrier are respectively hung oneself after double digestion, by connecting after mixing with the molar ratio of 3:1
Enzyme connects.
As the most preferably, in the construction method of described carrier I, the method for clone includes: with
PFUSE2ss-CLIg-hk carrier is template, the Ig of design primer amplification pFUSE2ss-CLIg-hk carrier
Kappa light chain conserved region.
As further preferably, in the construction method of described carrier I, described primer be forward primer L1 and
Downstream primer L2, the sequence of described forward primer L1 as shown in SEQ ID 4, the sequence of described downstream primer L2
Row are as shown in SEQ ID 5.
As the most preferably, in the construction method of described carrier II, described human antibody heavy chain IgG1 guards
District's fragment and pFAST Bac1 carrier are respectively hung oneself after double digestion, by connecting after mixing with the molar ratio of 3:1
Enzyme connects.
As the most preferably, in the construction method of described carrier II, the method for clone includes: with
PFUSEss-CHIg-hG1 carrier is template, the IgG1 of design primer amplification pFUSEss-CHIg-hG1 carrier
Heavy chain conserved region.
As further preferably, in the construction method of described carrier II, described primer be forward primer H1 and
Downstream primer H2, the sequence of described forward primer H1 as shown in SEQ ID 6, described downstream primer H2's
Sequence is as shown in SEQ ID 7.
As amplified reaction body that is the most preferred, that use in the construction method of described carrier I and carrier II
System is: 94 DEG C of denaturations 5min, 94 DEG C of 45s, 58 DEG C of 1min, and 72 DEG C of 45s are carried out altogether
30 circulations, 72 DEG C extend 10min.
As further preferably, in the construction method of described carrier III, described displacement include the following: with
PFAST Bac1 vector plasmid is template, the amplification pFAST Bac1 carrier part without pPH promoter；
Synthesis baculovirus pole weak promoter ie1 in early days, by the described pFAST after described promoter ie1 and amplification
Bac1 carrier connects, and obtains the virus expression carrier containing baculovirus pole weak promoter ie1 in early days.
As further preferably, in the construction method of described carrier III, described amplification reaction system include as
Under: using pfu enzyme, amplification condition is: 94 DEG C of 2min, 94 DEG C of 15s, 60 DEG C of 30s, 72 DEG C of 90s, amplification
35 circulations, 72 DEG C of 7min, a length of 4647bp of am-plified fragments.
As further preferably, described people α-2,3-sialic acid glycosyl transferase ST3 genetic fragment and containing opening
The pFAST Bac1 carrier of mover ie1 is respectively hung oneself after double digestion, by even after mixing with the molar ratio of 2:1
Connect enzyme to connect.
As the most preferred, described people α-2,3-sialic acid glycosyl transferase ST3 gene order such as SEQ
Shown in ID 8.
As the most preferably, in the construction method of described carrier I, carrier II and carrier III, described double
Enzyme action is BamHI and HindIII double digestion.
The application in preparing full length antibody of the described baculovirus transfer vector, described application includes such as lower section
Method:
The hybridoma chain variable region gene sequence of difference clones secrete mouse monoclonal antibody and weight chain variable
District's gene order；
Described variable region of light chain nucleotide sequence is connected to the insecticide containing human antibody light chain Kappa conserved region sequence
Rhabdovirus expression vector I, is connected to described variable region of heavy chain nucleotide sequence protect containing human antibody heavy chain IgG1
The baculovirus transfer vector II of defending zone；
It is respectively adopted baculovirus transfer vector I and baculovirus transfer vector II transfection and builds weight
Group baculovirus particle, obtains two-strain；
The two virus mixed infection insect cell, obtains recombined human mouse chimeric antibody.
As further preferably, described chain variable region gene sequence as shown in SEQ ID 9, described heavy chain
Variable region gene sequence is as shown in SEQ ID 10.
As the most preferably, Ke Longshi, employing primer L3 and L4 expand Mus monoclonal antibody chain variable region gene
Sequence, employing primer H3 and H4 amplification Mus monoclonal antibody heavy chain variable region gene sequence, described primer sequence L3,
L4, H3, H4 are respectively as shown in SEQ ID 11,12,13,14.
The application in expressing people source glycoprotein of the described baculovirus transfer vector, described application includes as follows
Method: by gene constructed for characteristic protein on expression vector III, utilizes expression vector I, II and III to turn respectively
Dye insect cell, obtains three kinds of viruses, and described three kinds of virus mixing co-infection insect cell SfSWT-3 are thin
Born of the same parents.
As the most preferably, described infection method is for be added to cultured SfSWT-3 cell virus liquid
In.
The invention has the beneficial effects as follows:
(1) through antibody test it is demonstrated experimentally that baculovirus transfer vector of the present invention can contain by high efficient expression
Heavy chain and the humanized antibody of light chain.
(2) the glycosylation modified mode in the glycosylation modified mode of the recombinant antibodies that the present invention obtains and human body
Unanimously.
(3) the preparation method for antibody expression of the present invention is big, low cost, and efficiency is high.
(4) the antibody dry powder that prepared by the present invention can be as the diagnosis raw material of Serological testing.
(5) present invention can express active ST3 enzyme gene in SfSWT-3 cell line.
Accompanying drawing explanation
Fig. 1 is the Western Blot figure of recombinant full-lenght antibody prepared by the embodiment of the present invention.
Detailed description of the invention
The application is by providing baculovirus transfer vector, construction method and application, the described table obtained
Reach carrier and can contain heavy chain and the humanized antibody of light chain by high efficient expression.
The embodiment of the present application baculovirus transfer vector, including containing human antibody light chain Kappa conserved region sequence
The baculovirus transfer vector I of row and the insect baculovirus table containing human antibody heavy chain IgG1 conserved region
Reach carrier II, the sequence of described expression vector I as shown in sequence table SEQ ID 1, described expression vector II's
Sequence is as shown in sequence table SEQ ID 2；
Also include containing α-2, the baculovirus transfer vector III of 3-sialic acid glycosyl transferase ST3, institute
State the sequence of expression vector III as shown in sequence table SEQ ID 3；
Described expression vector I, II, III are pFAST Bac1 carrier.
The Expression element of described carrier I includes: PH promoter, SV40pA, Tn7L, f1ori, ampicillin,
PUC ori, Tn7R, Gentamicin, Kappa conserved region, multiple clone site etc..
The Expression element of described carrier II includes: PH promoter, SV40pA, Tn7L, f1ori, ampicillin,
PUC ori, Tn7R, Gentamicin, IgG1 heavy chain conserved region, multiple clone site etc..
The promoter of described expression vector III is baculovirus pole weak promoter ie1 in early days.
The construction method of the embodiment of the present application baculovirus transfer vector, comprises the steps:
The construction method of described carrier I is: design primer is cloned people anti-from pFUSE2ss-CLIg-hk carrier
Body light chain Kappa conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier II is: design primer is cloned people from pFUSEss-CHIg-hG1 carrier
Heavy chain of antibody IgG1 conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier III is: the PH promoter replacement of pFAST Bac1 carrier becomes virus pole
Weak promoter ie1 in early days, and human cloning α-2,3-sialic acid glycosyl transferase ST3 gene is to containing promoter
On the described pFAST Bac1 carrier of ie1.Described people α-2,3-sialic acid glycosyl transferase ST3 gene sequence
Row are as shown in SEQ ID 8.
The application in preparing full length antibody of the embodiment of the present application baculovirus transfer vector, described application bag
Include to adopt and prepare antibody with the following method:
The hybridoma chain variable region gene sequence of difference clones secrete mouse monoclonal antibody and weight chain variable
District's gene order；
Described variable region of light chain nucleotide sequence is connected to the insecticide containing human antibody light chain Kappa conserved region sequence
Rhabdovirus expression vector I, is connected to described variable region of heavy chain nucleotide sequence protect containing human antibody heavy chain IgG1
The baculovirus transfer vector II of defending zone；
It is respectively adopted baculovirus transfer vector I and baculovirus transfer vector II transfection and builds weight
Group baculovirus particle, obtains two-strain；
The two virus mixed infection insect cell, obtains recombined human mouse chimeric antibody.
Described chain variable region gene sequence is as shown in SEQ ID 9, and described heavy chain variable region gene sequence is such as
Shown in SEQ ID 10.
The application in expressing people source glycoprotein of the embodiment of the present application baculovirus transfer vector, described application
Glycoprotein is expressed with the following method: by gene constructed for characteristic protein on expression vector III, utilize table including adopting
Reaching carrier I, II and III transfection insect cell respectively, obtain three kinds of viruses, described three kinds of virus mixing are common
Infected insect cell SfSWT-3 cell.
In order to be better understood from technique scheme, below in conjunction with Figure of description and specific embodiment
Technique scheme is described in detail.
Embodiment 1
The expression of humanized antibody is carried out below as a example by mice HER2 monoclonal antibody.
The structure of recombinant antibodies variable region of light chain fusion expression vector I
With pFUSE2ss-CLIg-hk carrier as template, design pair of primers expands the Ig Kappa of this carrier
Light conserved region, specifically comprises the following steps that with forward primer L1:
CGGGCGCGGATCCGAATTCACCGGTCACCATGG and downstream primer L2:
TTCTCGACAAGCTTCTCCCTCTAACACTCTCC, with pFUSE2ss-CLIg-hk vector plasmid be
Template, 94 DEG C of denaturations 5min, 94 DEG C of 45s, 58 DEG C of 1min, 72 DEG C of 45s, carry out 30 altogether
Circulation, 72 DEG C extend 10min.PCR primer electrophoresis reclaims, and BamH I and Hind III double digestion are contained
The humanized antibody light chain Kappa conserved region fragment of multiple clone site.Cultivate the Bac1 carrier Han pFAST greatly
Enterobacteria, extracts plasmid, same BamH I and Hind III double digestion, reclaims endonuclease bamhi, with light chain Kappa
Conserved region fragment: pFAST Bac1 carrier ratio 3:1, mixing, add the link of T4DNA ligase, convert big
Enterobacteria DH10Bac, the bacterial strain of the anti-ampicillin of picking, for the carrier successfully constructed.
Fusion protein construction and express (when preparing antibody): 1. hybridoma recovery, cell cultivate and
The synthesis of cDNA, uses conventional method to extract mRNA from the hybridoma cell strain of secretion anti-HER2 monoclonal antibody,
And it being catalyzed (RT-PCR) for template through reverse transcriptase with it, reverse transcription becomes cDNA in vitro.Use two, variable region
General mix primer amplification, be then attached to cloning vehicle pMD18-T, some cloning and sequencings of random choose
Verify correct antibody gene, obtain Mus monoclonal antibody chain variable region gene sequence, with primer L3:
AGTCCGAATTCGACATCCAGATGACCCAGTC and L4:
TGACTGCCATGGACGCTTGATCTCCACCTTGG expands this gene variable region sequence, EcoRI and
NcoI double digestion inserts the above-mentioned expression vector built.
The structure of recombinant antibodies variable region of heavy chain fusion expression vector II
With pFUSEss-CHIg-hG1 carrier as template, design pair of primers expands the IgG1 heavy chain of this carrier
Conserved region.Specifically comprise the following steps that with forward primer H1:
GCGCGGATCCGAATTCGATATCTCGAGTGCTAG and downstream primer H2:
CTCGACAAGCTTCCAGCTAGGACTCATTTAC, with pFUSE2ss-CLIg-hk vector plasmid as mould
Plate, 94 DEG C of denaturations 5min, 94 DEG C of 45s, 58 DEG C of 1min, 72 DEG C of 45s, carry out 30 altogether
Circulation, 72 DEG C extend 10min.PCR primer electrophoresis reclaims, and double digestion obtains the people containing multiple clone site
Source IgG antibody 1 heavy chain conserved region fragment.Cultivate containing pFAST Bac1 carrier escherichia coli, extract matter
Grain, same BamHI and HindIII double digestion, reclaims endonuclease bamhi, with IgG1 heavy chain conserved region: pFAST
Bac1 carrier ratio 3:1, mixing, add the link of T4DNA ligase, convert escherichia coli DH10Bac,
The bacterial strain of the anti-ampicillin of picking, for the carrier successfully constructed.
Fusion protein construction and express (when preparing antibody): 1. hybridoma recovery, cell cultivate and
The synthesis of cDNA, uses conventional method to extract mRNA from the hybridoma cell strain of secretion anti-HER2 monoclonal antibody,
And it being catalyzed (RT-PCR) for template through reverse transcriptase with it, reverse transcription becomes cDNA in vitro.Use two, variable region
General mix primer amplification, be then attached to cloning vehicle pMD18-T, some cloning and sequencings of random choose
Verify correct antibody gene, obtain Mus monoclonal antibody heavy chain variable region gene sequence, with primer H3:
AGTCCGAATTCGAGGTGCAGCTGGTGGAGTC and
H4:GCTAAGATATCCACGGTCACCAGGTACC amplification changes antibody gene weight chain variabl area sequence,
EcoRI and EcoRV double digestion inserts the above-mentioned expression vector built.
Containing baculovirus pole early promoter ie1 and people α-2, the carrier III of 3-sialic acid glycosyl transferase ST3
Structure
Change promoter: with pFAST Bac1 vector plasmid as template, open without pPH with this carrier of primer amplification
The part of mover, uses pfu enzyme, and amplification condition is: 94 DEG C of 2min, 94 DEG C of 15s, 60 DEG C of 30s, 72 DEG C of 90s,
Expand 35 circulations, 72 DEG C of 7min, a length of 4647bp of am-plified fragments.Simultaneously synthesizing baculovirus pole is early
Phase promoter ie1, and the connection of carrier flush end, choose clone, PCR and sequence verification, obtain containing baculovirus pole
The virus expression carrier of weak promoter ie1 in early days.
The structure of expression vector III: by people α-2,3-sialic acid glycosyl transferase ST3 gene is cloned into this load
On body, people α-2,3-sialic acid glycosyl transferase ST3 protein sequence, it is converted into suitable according to codon preference
Being combined in insect cell the gene order expressed, synthesize this sequence, the when of synthesis, two ends bring enzyme action position respectively
Point BamH I and Hind III, the ST3 genetic fragment of synthesis and the carrier containing ie1 promoter are respectively with BamH
I and Hind III double digestion, mixes with the ratio of 2:1, adds T4 DNA ligase and connects, converts large intestine bar
Bacterium DH10Bac, chooses clone, and PCR verifies, obtains expressing the expression vector of ST3 gene.Extraction plasmid is standby
With.
The transfection respectively (when expressing people source glycoprotein) of above-mentioned three kinds of viral vector I, II, III
Take sf9 cell, with Grace ' s culture fluid in 27 DEG C without CO2Cell culture incubator is cultivated.Utilize
Cellfectin in 6 well culture plates by three kinds of i.e. heavy chain expression vector of recombinant baculovirus DNA, light chain table
Reaching carrier, ST3 expression vector transfects respectively and is in the exponential phase i.e. sf9 cell of fusion rate more than 80%.
Transfection method is as follows: (LR reactant 8 μ l, serum-free antibiotic-free Grace ' s cultivate to be respectively configured A liquid
Base 100 μ l) and B liquid (6 μ l Cellfectin, Grace ' s serum-free antibiotic-free Grace ' s culture medium
100 μ l), and softly mix two liquid, after room temperature places 35min, add 800 μ l serum-free antibiotic-frees
Grace ' s culture medium softly mixes；Culture medium in six orifice plates is abandoned in shifting, cultivates with serum-free antibiotic-free Grace ' s
Base rinse, to remove residual serum, adds AB mixture, hatches 5 hours for 27 DEG C, move and abandon culture supernatant,
Grace ' the s that addition 2ml contains 50 units/ml penicillin and 50ug/ml streptomycin in each hole trains completely
Supporting base, after cultivating 96h, 4500rpm is centrifuged 10min, collects culture supernatant, i.e. obtains the bar of recombinant antibodies
Shape virus, this is P1 strain, and after subpackage ,-80 DEG C keep in Dark Place standby.
The amplification of virus: infect the same day, preparation Sf9 and Sf21 cell conditioned medium and cell plates, 2X106 cell/
Hole.Contact cultivates cell room temperature 1 hour, the absorption situation of poor microscopic examination of cell, every hole after 1 hour
Add appropriate number of P1 strain, 27 degree of humidified incubator thymic nurse cells 96 hours, infect latter 72 hours,
Collect 2ml from each hole and contain virulent supernatant culture medium, forward the pipe of 15ml to.500Xg is centrifuged 5 points
Clock discards cell and fragment.Supernatant is forwarded to 15ml pipe.This is P2 strain, and 4 degree keep in Dark Place.For a long time
Preserve and need whole strain at-80 degree.Detecting the titre of your P2 strain, same method prepares P3 Strain.Point
Do not collect heavy chain vector, light chain vector, and P3 virus after the transfection of ST3 expression vector, remix infection by
SfSWT-3 cell after the improvement of Sf9 cell strain, infection method is for be added to venom inside cultured cell.
Test experience
The detection of antibody and glycosylation patterns detection detection humanized antibody
A, takes 1 × 10 respectively6SfSWT-3 cell after recombinate shape virus infection 96h, is uninfected by
SfSWT-3 cell is negative control and the SfSWT-3 cell conduct infecting pFastBacI-Gus baculovirus
Positive control.Cell mixes with 2 × gel loading buffer of equivalent after cracking respectively, respectively takes 20 μ l loadings
Electrophoresis, and 3 groups of cell pyrolysis liquids of electrophoresis respectively, utilize Bio-Rad albumen transferring system to transfer 3 PVDF
Film, in order to various antibody and the existence of Protein Detection recombinant humanized antibody protein.5% defatted milk powder room temperature envelope
Close 1h, with Anti-Human's Kappa chain-HRP monoclonal antibody of 1:5000, the anti-Kappa of 1:200 rabbit
Chain polyclonal antibody, and 1:2000 mouse-anti people's Kappa chain monoclonal antibody hatches 3 PVDF respectively
Film, 4 DEG C overnight.PBST washes after film respectively with two anti-incubated at room pvdf membranes of corresponding HRP labelling, PBST
Washing film, DAB develops the color, and result is shown in accompanying drawing 1.In Fig. 1, from left to right, what swimming lane 1 was full length antibody adds
Electrophoresis after thermal reduction, swimming lane 2,3 is the non-reducing electrophoresis of non-heated, is compareed by molecular weight, can see
The full length antibody structure going out the embodiment of the present application 1 preparation is complete, and heavy chain and light chain successfully assemble.
B. insect cell line is detected by ELISA.With anti-human KAPPA chain antibody coated elisa plate, 4 DEG C of bags
By overnight, 5% milk confining liquid closes 2h；, be separately added into normal transfection insect cell supernatant (-) and human IgG
Standard substance (100ng/ml---+) and insect cell expression supernatant, each 100 μ l, hatch 30min for 37 DEG C, use
ELISA cleaning mixture washes 5 times, 3min/ time；By the restructuring HER2 albumen ELISA diluent of HRP labelling
After dilution, it is separately added in hole, hatches 30min for 37 DEG C, wash 5 times with ELISA cleaning mixture, 3min/ time；
Add nitrite ion 100ul/ hole, 37 DEG C of lucifuge colour developing 10min, be eventually adding 50 μ l/ hole 2mol/L sulphuric acid
Terminate, with machine testing in microplate reader.The insect cell line of the double screening of antibiotic is determined according to microplate reader testing result
Antibody expression ability.Result display antibody has substantially combination.
The humanized antibody of c.ProteinA affinity purification anti-HER2 albumen.From the cell breakage of insect cell
Can be with isolated and purified humanized people's Mus hybrid antibody in liquid.Key step collects culture supernatant as follows, 4 DEG C from
The heart, 12000rpm × 10min, abandons precipitation.Cell impurities is removed further with 0.45 μm membrane filtration,
To avoid blocking chromatographic column；With the binding buffer of 10 times of volumes
(20mM PBS, pH7.0) balances Hitrap Protein A prepacked column: loading, after with 10 times of bodies
Long-pending binding buffer washes away unconjugated albumen, does not develops the color to Bradford detection solution；With 5 times of bodies
Long-pending elution buffer (0.1M citric acid solution, pH3.6) eluting, with Bradford detection solution detection
Elution process, collects eluting peak, and adjusts pH value to 7.0 with 1M Tris-HCI (pH9.0)；From collecting product
Middle sampling carries out SDS-PAGE detection, remaining purified product after 4 DEG C of dialysed overnight of PBS liquid, subpackage ,-80 DEG C
Preserve.
D. the IgG collected with papain enzymolysis, by HPLC purification, uses MALDI-TOF skill
Art analyzes two kinds of glucosides types and the specificity N-glycosylation site thereof of IgG.And by Mass Spectrometer Method sugar chain
Structure: fully dissolve, at a high speed with A phase solution (5%ACN, 0.1% formic acid) through enzyme action dry sample
Take top solution after Li Xin and add sample injection bottle, carry out online LC-MS analysis.Liquid chromatograph is reversed phase high performance liquid
Phase chromatograph is also directly connected with mass spectrographic ion source interface.Flowing phase phase solution 95%ACN, 0.1% formic acid.Will
Sample injection bottle is placed in automatic sampler sample with the 25 μ flow velocity sample introduction of L/ minute, after sample introduction, with 500nL/min
Current gradient separate.Mass spectral analysis is carried out on nanoESI-LTQ-Orbitrap.Use positive ion mode
Scanning.One-level Orbitrap is analyzed, and ion acquisition range m/z400-2000, resolution is at m/z400
60000 take the ion of intensity top ten with DDA pattern carries out secondary analysis.Two grades of LTQ analyze, full scan
Selected ion enters LTQ and carries out CID fragmentation, and scans two grades of fragmentation spectrograms of acquisition.
Analyzing display has a conservative N-to connect glycosylation site in the CH2 region of the FC section of heavy chain
Asn297.The glycosylation structure in this site is the double feeler complex type oligosaccharides of two branches that two N-connect, and contains
High mannose type (Hex4-6HexNAc2), heterozygous (NeuAc0-1Fuc0-1Hex4-6HexNAc2-4) and complexity
(Fuc0-1Hex3-4HexNAc3-6Sugar chain, its end is bifunctional sialyltransferase.Mass Spectrometer Method glycosylation process entrusts force
Han Jinkairui biological engineering company limited completes.Prove that ST3 gene has expression in course of infection.
Technical scheme in above-mentioned the embodiment of the present application, at least has the following technical effect that or advantage:
(1) through antibody test it is demonstrated experimentally that baculovirus transfer vector of the present invention can contain by high efficient expression
Heavy chain and the humanized antibody of light chain.
(2) the glycosylation modified mode in the glycosylation modified mode of the recombinant antibodies that the present invention obtains and human body
Unanimously.
(3) the preparation method for antibody expression of the present invention is big, low cost, and efficiency is high.
(4) the antibody dry powder that prepared by the present invention can be as the diagnosis raw material of Serological testing.
(5) present invention can express active ST3 enzyme gene in SfSWT-3 cell line.
Although preferred embodiments of the present invention have been described, but those skilled in the art once know substantially
Creative concept, then can make other change and amendment to these embodiments.So, claims are anticipated
It is intended to be construed to include preferred embodiment and fall into all changes and the amendment of the scope of the invention.Obviously, this area
Technical staff the present invention can be carried out various change and modification without departing from the spirit and scope of the present invention.This
Sample, if the present invention these amendment and modification belong to the claims in the present invention and equivalent technologies thereof scope it
In, then the present invention is also intended to comprise these change and modification.
SEQUENCE LISTING
<110>Wuhan Jin Kairui biological engineering company limited
<120>baculovirus transfer vector, construction method and application thereof
<130> 2016
<160> 14
<170> PatentIn version 3.3
<210> 1
<211> 5035
<212> DNA
<213> Baculovirus
<400> 1
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg
cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt
ctttaatagt 300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt
420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat
gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt
ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg
agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga
agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg
tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt
tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg
cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg
aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga
tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc
tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc
ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc
ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg
cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac
gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc
actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt
aaaacttcat 1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac
caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct
1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc
accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt
aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg
ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc
agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt
accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga
gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct
tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca
cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa
cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt
ctttcctgcg 2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc
cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg
tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt
cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat actggacttt
2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc
gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa
tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc
ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag
agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc
gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc
gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag
aacgtaagcc 3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa
tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt
ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg
gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt
agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata
acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact gtacaaaaaa
3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc
gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac
gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc
acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc
gcaaggtttc 3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca
aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc
gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg
agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc
ggaatattaa 3900
tagatcatgg agataattaa aatgataacc atctcgcaaa taaataagta
ttttactgtt 3960
ttcgtaacag ttttgtaata aaaaaaccta taaatattcc ggattattca
taccgtccca 4020
ccatcgggcg cggatccgaa ttcaccggtc accatggaaa tcaaacgtac
ggtggctgca 4080
ccatctgtct tcatcttccc gccatctgat gagcagttga aatctggaac
tgcctctgtt 4140
gtgtgcctgc tgaataactt ctatcccaga gaggccaaag tacagtggaa
ggtggataac 4200
gccctccaat cgggtaactc ccaggagagt gtcacagagc aggacagcaa
ggacagcacc 4260
tacagcctca gcagcaccct gacgctgagc aaagcagact acgagaaaca
caaagtctac 4320
gcctgcgaag tcacccatca gggcctgagc tcgcccgtca caaagagctt caacagggga
4380
gagtgttaga gggagaagct tgtcgagaag tactagagga tcataatcag
ccataccaca 4440
tttgtagagg ttttacttgc tttaaaaaac ctcccacacc tccccctgaa
cctgaaacat 4500
aaaatgaatg caattgttgt tgttaacttg tttattgcag cttataatgg
ttacaaataa 4560
agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc
tagttgtggt 4620
ttgtccaaac tcatcaatgt atcttatcat gtctggatct gatcactgct
tgagcctagg 4680
agatccgaac cagataagtg aaatctagtt ccaaactatt ttgtcatttt
taattttcgt 4740
attagcttac gacgctacac ccagttccca tctattttgt cactcttccc
taaataatcc 4800
ttaaaaactc catttccacc cctcccagtt cccaactatt ttgtccgccc
acagcggggc 4860
atttttcttc ctgttatgtt tttaatcaaa catcctgcca actccatgtg
acaaaccgtc 4920
atcttcggct actttttctc tgtcacagaa tgaaaatttt tctgtcatct cttcgttatt
4980
aatgtttgta attgactgaa tatcaacgct tatttgcagc ctgaatggcg
aatgg 5035
<210> 2
<211> 5699
<212> DNA
<213> Baculovirus
<400> 2
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg
cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
acaaaaattt 420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat
gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt
ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg
agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga
agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg
tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt
tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg
cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg
aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga
tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc
tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc
ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc
ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg
cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac
gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc
actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat
1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac
caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa
aggatcttct 1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc
accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt
aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg
ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc
agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt
accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga
gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct
tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca
cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa
cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg
2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc
cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg
tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt
cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat
actggacttt 2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc
gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa
tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc
ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag
agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc
gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc
gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag aacgtaagcc
3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa
tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt
ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg
gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt
agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata
acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact
gtacaaaaaa 3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc
gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac
gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc
acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc gcaaggtttc
3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca
aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc
gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg
agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc
ggaatattaa 3900
tagatcatgg agataattaa aatgataacc atctcgcaaa taaataagta
ttttactgtt 3960
ttcgtaacag ttttgtaata aaaaaaccta taaatattcc ggattattca
taccgtccca 4020
ccatcgggcg cggatccgaa ttcgatatct cgagtgctag caccaagggc
ccatcggtct 4080
tccccctggc accctcctcc aagagcacct ctgggggcac agcggccctg
ggctgcctgg 4140
tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc
ctgaccagcg 4200
gcgtgcacac cttcccggct gtcctacagt cctcaggact ctactccctc
agcagcgtgg 4260
tgaccgtgcc ctccagcagc ttgggcaccc agacctacat ctgcaacgtg
aatcacaagc 4320
ccagcaacac caaggtggac aagaaagttg agcccaaatc ttgtgacaaa
actcacacat 4380
gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtcttcctc
ttccccccaa 4440
aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg
gtggtggacg 4500
tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcgtg
gaggtgcata 4560
atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg
gtcagcgtcc 4620
tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag
gtctccaaca 4680
aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag
ccccgagaac 4740
cacaggtgta caccctgccc ccatcccggg aggagatgac caagaaccag
gtcagcctga 4800
cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag
agcaatgggc 4860
agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc
tccttcttcc 4920
tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc
ttctcatgct 4980
ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc ctgtctccgg
5040
gtaaatgagt cctagctgga agcttgtcga gaagtactag aggatcataa
tcagccatac 5100
cacatttgta gaggttttac ttgctttaaa aaacctccca cacctccccc
tgaacctgaa 5160
acataaaatg aatgcaattg ttgttgttaa cttgtttatt gcagcttata
atggttacaa 5220
ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc
attctagttg 5280
tggtttgtcc aaactcatca atgtatctta tcatgtctgg atctgatcac
tgcttgagcc 5340
taggagatcc gaaccagata agtgaaatct agttccaaac tattttgtca
tttttaattt 5400
tcgtattagc ttacgacgct acacccagtt cccatctatt ttgtcactct
tccctaaata 5460
atccttaaaa actccatttc cacccctccc agttcccaac tattttgtcc
gcccacagcg 5520
gggcattttt cttcctgtta tgtttttaat caaacatcct gccaactcca
tgtgacaaac 5580
cgtcatcttc ggctactttt tctctgtcac agaatgaaaa tttttctgtc atctcttcgt
5640
tattaatgtt tgtaattgac tgaatatcaa cgcttatttg cagcctgaat
ggcgaatgg 5699
<210> 3
<211> 5245
<212> DNA
<213> Baculovirus
<400> 3
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg
cagcgtgacc 60
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
ctttctcgcc 120
acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
gttccgattt 180
agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
acgtagtggg 240
ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
300
ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
ttttgattta 360
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
acaaaaattt 420
aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
tcggggaaat 480
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
tccgctcatg 540
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat
gagtattcaa 600
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt
ttttgctcac 660
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg
agtgggttac 720
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga
agaacgtttt 780
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg
tattgacgcc 840
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt
tgagtactca 900
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg
cagtgctgcc 960
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg
aggaccgaag 1020
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga
tcgttgggaa 1080
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc
tgtagcaatg 1140
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc
ccggcaacaa 1200
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc
ggcccttccg 1260
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg
cggtatcatt 1320
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac
gacggggagt 1380
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc
actgattaag 1440
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat
1500
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac
caaaatccct 1560
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa
aggatcttct 1620
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc
accgctacca 1680
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt
aactggcttc 1740
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg
ccaccacttc 1800
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc
agtggctgct 1860
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt
accggataag 1920
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga
gcgaacgacc 1980
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct
tcccgaaggg 2040
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
cacgagggag 2100
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca
cctctgactt 2160
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa
cgccagcaac 2220
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg
2280
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
taccgctcgc 2340
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
gcgcctgatg 2400
cggtattttc tccttacgca tctgtgcggt atttcacacc gcagaccagc
cgcgtaacct 2460
ggcaaaatcg gttacggttg agtaataaat ggatgccctg cgtaagcggg
tgtgggcgga 2520
caataaagtc ttaaactgaa caaaatagat ctaaactatg acaataaagt
cttaaactag 2580
acagaatagt tgtaaactga aatcagtcca gttatgctgt gaaaaagcat
actggacttt 2640
tgttatggct aaagcaaact cttcattttc tgaagtgcaa attgcccgtc
gtattaaaga 2700
ggggcgtggc caagggcatg gtaaagacta tattcgcggc gttgtgacaa
tttaccgaac 2760
aactccgcgg ccgggaagcc gatctcggct tgaacgaatt gttaggtggc
ggtacttggg 2820
tcgatatcaa agtgcatcac ttcttcccgt atgcccaact ttgtatagag
agccactgcg 2880
ggatcgtcac cgtaatctgc ttgcacgtag atcacataag caccaagcgc
gttggcctca 2940
tgcttgagga gattgatgag cgcggtggca atgccctgcc tccggtgctc
gccggagact 3000
gcgagatcat agatatagat ctcactacgc ggctgctcaa acctgggcag aacgtaagcc
3060
gcgagagcgc caacaaccgc ttcttggtcg aaggcagcaa gcgcgatgaa
tgtcttacta 3120
cggagcaagt tcccgaggta atcggagtcc ggctgatgtt gggagtaggt
ggctacgtct 3180
ccgaactcac gaccgaaaag atcaagagca gcccgcatgg atttgacttg
gtcagggccg 3240
agcctacatg tgcgaatgat gcccatactt gagccaccta actttgtttt
agggcgactg 3300
ccctgctgcg taacatcgtt gctgctgcgt aacatcgttg ctgctccata
acatcaaaca 3360
tcgacccacg gcgtaacgcg cttgctgctt ggatgcccga ggcatagact
gtacaaaaaa 3420
acagtcataa caagccatga aaaccgccac tgcgccgtta ccaccgctgc
gttcggtcaa 3480
ggttctggac cagttgcgtg agcgcatacg ctacttgcat tacagtttac
gaaccgaaca 3540
ggcttatgtc aactgggttc gtgccttcat ccgtttccac ggtgtgcgtc
acccggcaac 3600
cttgggcagc agcgaagtcg aggcatttct gtcctggctg gcgaacgagc gcaaggtttc
3660
ggtctccacg catcgtcagg cattggcggc cttgctgttc ttctacggca
aggtgctgtg 3720
cacggatctg ccctggcttc aggagatcgg aagacctcgg ccgtcgcggc
gcttgccggt 3780
ggtgctgacc ccggatgaag tggttcgcat cctcggtttt ctggaaggcg
agcatcgttt 3840
gttcgcccag gactctagct atagttctag tggttggcta cgtatactcc
ggaatattaa 3900
tagtcgatgt ctttgtgatg cgcgcgacat ttttgtaggt tattgataaa
atgaacggat 3960
acgttgcccg acattatcat taaatccttg gcgtagaatt tgtcgggtcc
attgtccgtg 4020
tgcgctagca tgcccgtaac ggacctcgta cttttggctt caaaggtttt
gcgcacagac 4080
aaaatgtgcc acacttgcag ctctgcatgt gtgcgcgtta ccacaaatcc
caacggcgca 4140
gtgtacttgt tgtatgcaaa taaatctcga taaaggcgcg gcgcgcgaat
gcagctgatc 4200
acgtacgctc ctcgtgttcc gttcaaggac ggtgttatcg acctcagatt
aatgtttatc 4260
ggccgactgt tttcgtatcc gctcaccaaa cgcgtttttg cattaacatt
gtatgtcggc 4320
ggatgttcta tatctaattt gaataaataa acgataaccg cgttggtttt
agagggcata 4380
ataaaagaaa tattgttatc gtgttcgcca ttagggcagt ataaattgac
gttcatgttg 4440
gatattgttt cagttgcaag ttgacactgg cggcgacaag atcgtgaaca
accaagtgac 4500
tgatcccggt ccgaagcgcg cggaattcaa aggcctacgt cgacgagctc
actagtcgcg 4560
gccgctttcg aatctagagc ctgcagtctc gaggcatgcg gtaccaagct
tgtcgagaag 4620
tactagagga tcataatcag ccataccaca tttgtagagg ttttacttgc
tttaaaaaac 4680
ctcccacacc tccccctgaa cctgaaacat aaaatgaatg caattgttgt
tgttaacttg 4740
tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt
cacaaataaa 4800
gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat
4860
gtctggatct gatcactgct tgagcctagg agatccgaac cagataagtg
aaatctagtt 4920
ccaaactatt ttgtcatttt taattttcgt attagcttac gacgctacac
ccagttccca 4980
tctattttgt cactcttccc taaataatcc ttaaaaactc catttccacc
cctcccagtt 5040
cccaactatt ttgtccgccc acagcggggc atttttcttc ctgttatgtt
tttaatcaaa 5100
catcctgcca actccatgtg acaaaccgtc atcttcggct actttttctc
tgtcacagaa 5160
tgaaaatttt tctgtcatct cttcgttatt aatgtttgta attgactgaa
tatcaacgct 5220
tatttgcagc ctgaatggcg aatgg
5245
<210> 4
<211> 33
<212> DNA
<213> artifical sequence
<400> 4
cgggcgcgga tccgaattca ccggtcacca
tgg
33
<210> 5
<211> 32
<212> DNA
<213> artifical sequence
<400> 5
ttctcgacaa gcttctccct ctaacactct
cc
32
<210> 6
<211> 33
<212> DNA
<213> artifical sequence
<400> 6
gcgcggatcc gaattcgata tctcgagtgc
tag
33
<210> 7
<211> 31
<212> DNA
<213> artifical sequence
<400> 7
ctcgacaagc ttccagctag gactcattta
c
31
<210> 8
<211> 1020
<212> DNA
<213> Homo sapiens
<400> 8
atggtgaccc tgcgtaagcg taccctgaag gtgctgacct tcctggtgct
gttcatcttc 60
ctgacctcct tcttcctgaa ctactcccac accatggtgg ctaccacctg
gttccccaag 120
cagatggtgc tggagctgtc cgagaacctg aagcgtctga tcaagcaccg
tccctgcacc 180
tgcacccact gcatcggtca gcgtaagctg tccgcttggt tcgacgagcg
tttcaaccag 240
accatgcagc ccctgctgac cgctcagaac gctctgctgg aggacgacac
ctaccgttgg 300
tggctgcgtc tgcagcgtga gaagaagccc aacaacctga acgacaccat
caaggagctg 360
ttccgtgtgg tgcccggtaa cgtggacccc atgctggaga agcgttccgt
gggttgccgt 420
cgttgcgctg tggtgggtaa ctccggtaac ctgcgtgagt cctcctacgg
tcccgagatc 480
gactcccacg acttcgtgct gcgtatgaac aaggctccca ccgctggttt
cgaggctgac 540
gtgggtacca agaccaccca ccacctggtg taccccgagt ccttccgtga
gctgggtgac 600
aacgtgtcca tgatcctggt gcccttcaag accatcgacc tggagtgggt ggtgtccgct
660
atcaccaccg gtaccatctc ccacacctac atccccgtgc ccgctaagat
ccgtgtgaag 720
caggacaaga tcctgatcta ccaccccgct ttcatcaagt acgtgttcga
caactggctg 780
cagggtcacg gtcgttaccc ctccaccggt atcctgtccg tgatcttctc
catgcacgtg 840
tgcgacgagg tggacctgta cggtttcggt gctgactcca agggtaactg
gcaccactac 900
tgggagaaca acccctccgc tggtgctttc cgtaagaccg gtgtgcacga
cgctgacttc 960
gagtccaacg tgaccgctac cctggcttcc atcaacaaga tccgtatctt
caagggtcgt 1020
<210> 9
<211> 324
<212> DNA
<213> Mus musculus
<400> 9
gacatccaga tgacccagtc cccctcctcc ctgtccgctt ccgtgggtga
ccgtgtgacc 60
atcacctgca aggcttccca ggacgtgtcc atcggtgtgg cttggtacca
gcagaagccc 120
ggtaaggctc ccaagctgct gatctactcc gcttcctacc gttacaccgg
tgtgccctcc 180
cgtttctccg gttccggttc cggtaccgac ttcaccctga ccatctcctc
cctgcagccc 240
gaggacttcg ctacctacta ctgccagcag tactacatct acccctacac
cttcggtcag 300
ggtaccaagg tggagatcaa
gcgt
324
<210> 10
<211> 351
<212> DNA
<213> Mus musculus
<400> 10
gaggtgcagc tggtggagtc cggtggtggt ctggtgcagc ccggtggttc
cctgcgtctg 60
tcctgcgctg cttccggttt caccttcacc gactacacca tggactgggt
gcgtcaggct 120
cccggtaagg gtctggagtg ggtggctgac gtgaacccca actccggtgg
ttccatctac 180
aaccagcgtt tcaagggtcg tttcaccctg tccgtggacc gttccaagaa
caccctgtac 240
ctgcagatga actccctgcg tgctgaggac accgctgtgt actactgcgc
tcgtaacctg 300
ggtccctcct tctacttcga ctactggggt cagggtaccc tggtgaccgt
g 351
<210> 11
<211> 31
<212> DNA
<213> artifical sequence
<400> 11
agtccgaatt cgacatccag atgacccagt
c
31
<210> 12
<211> 32
<212> DNA
<213> artifical sequence
<400> 12
tgactgccat ggacgcttga tctccacctt
gg
32
<210> 13
<211> 31
<212> DNA
<213> artifical sequence
<400> 13
agtccgaatt cgaggtgcag ctggtggagt
c
31
<210> 14
<211> 28
<212> DNA
<213> artifical sequence
<400> 14
gctaagatat ccacggtcac caggtacc
28
Claims (12)
1. baculovirus transfer vector, it is characterised in that: include containing human antibody light chain Kappa conserved region
The baculovirus transfer vector I of sequence and the insect baculovirus containing human antibody heavy chain IgG1 conserved region
Expression vector II, the sequence of described expression vector I as shown in sequence table SEQ ID 1, described expression vector II
Sequence as shown in sequence table SEQ ID 2；
Also include containing α-2, the baculovirus transfer vector III of 3-sialic acid glycosyl transferase ST3, institute
State the sequence of expression vector III as shown in sequence table SEQ ID 3.
Baculovirus transfer vector the most according to claim 1, it is characterised in that: described expression
Carrier I, II, III are pFAST Bac1 carrier.
Baculovirus transfer vector the most according to claim 1 and 2, it is characterised in that: described
The promoter of expression vector III is baculovirus pole weak promoter ie1 in early days.
4. the construction method of the baculovirus transfer vector as described in any one of claim 1-3, it is special
Levy and be: described method includes:
The construction method of described carrier I is: design primer is cloned people anti-from pFUSE2ss-CLIg-hk carrier
Body light chain Kappa conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier II is: design primer is cloned people from pFUSEss-CHIg-hG1 carrier
Heavy chain of antibody IgG1 conserved region fragment, and be connected on pFAST Bac1 carrier；
The construction method of described carrier III is: the PH promoter replacement of pFAST Bac1 carrier becomes virus pole
Weak promoter ie1 in early days, and human cloning α-2,3-sialic acid glycosyl transferase ST3 gene is to containing promoter
On the described pFAST Bac1 carrier of ie1.
The construction method of baculovirus transfer vector the most according to claim 4, it is characterised in that:
In the construction method of described carrier I, described human antibody light chain Kappa conserved region fragment and pFAST Bac1 carry
Body is respectively hung oneself after double digestion, is connected by ligase after mixing with the molar ratio of 3:1；Described carrier II's
In construction method, described human antibody heavy chain IgG1 conserved region fragment and pFAST Bac1 carrier are respectively hung oneself double enzyme
After cutting, connected by ligase after mixing with the molar ratio of 3:1.
The construction method of baculovirus transfer vector the most according to claim 4, it is characterised in that:
In the construction method of described carrier I, described primer is forward primer L1 and downstream primer L2, and described upstream is drawn
The sequence of thing L1 is as shown in SEQ ID 4, and the sequence of described downstream primer L2 is as shown in SEQ ID 5；Institute
Stating in the construction method of carrier II, described primer is forward primer H1 and downstream primer H2, and described upstream is drawn
The sequence of thing H1 is as shown in SEQ ID 6, and the sequence of described downstream primer H2 is as shown in SEQ ID 7.
The construction method of baculovirus transfer vector the most according to claim 4, it is characterised in that:
In the construction method of described carrier III, described displacement includes the following: with pFAST Bac1 vector plasmid as mould
Plate, the amplification pFAST Bac1 carrier part without pPH promoter；The weak startup in early days of synthesis baculovirus pole
Sub-ie1, is connected described promoter ie1 with the described pFAST Bac1 carrier after amplification, obtains containing shaft-like disease
The virus expression carrier of poison pole weak promoter ie1 in early days.
The construction method of baculovirus transfer vector the most according to claim 4, it is characterised in that:
Described people α-2,3-sialic acid glycosyl transferase ST3 genetic fragment and the pFAST Bac1 containing promoter ie1
Carrier is respectively hung oneself after double digestion, is connected by ligase after mixing with the molar ratio of 2:1.
9. according to the construction method of the baculovirus transfer vector described in claim 5 or 8, its feature
Be: in the construction method of described carrier I, carrier II and carrier III, described double digestion be BamHI and
HindIII double digestion.
10. the baculovirus transfer vector as described in any one of claim 1-3 is in preparing full length antibody
Application, it is characterised in that: described application process includes:
The hybridoma chain variable region gene sequence of difference clones secrete mouse monoclonal antibody and weight chain variable
District's gene order；
Described variable region of light chain nucleotide sequence is connected to the insecticide containing human antibody light chain Kappa conserved region sequence
Rhabdovirus expression vector I, is connected to described variable region of heavy chain nucleotide sequence protect containing human antibody heavy chain IgG1
The baculovirus transfer vector II of defending zone；
It is respectively adopted baculovirus transfer vector I and baculovirus transfer vector II transfection and builds weight
Group baculovirus particle, obtains two-strain；
The two virus mixed infection insect cell, obtains recombined human mouse chimeric antibody.
11. baculovirus transfer vectors according to claim 10 answering in preparing full length antibody
With, it is characterised in that: described chain variable region gene sequence as shown in SEQ ID 9, described variable region of heavy chain
Gene order is as shown in SEQ ID 10.
12. baculovirus transfer vectors as described in any one of claim 1-3 are expressing people source glycoprotein
In application, it is characterised in that: described application process includes: by gene constructed for characteristic protein to expression vector
On III, utilize expression vector I, II and III respectively transfection insect cell, obtain three kinds of viruses, described three kinds
Virus mixing co-infection insect cell SfSWT-3 cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334911.7A CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334911.7A CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925610A true CN105925610A (en) | 2016-09-07 |
| CN105925610B CN105925610B (en) | 2019-12-06 |
Family
ID=56840769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610334911.7A Active CN105925610B (en) | 2016-05-19 | 2016-05-19 | Insect baculovirus expression vector, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925610B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109384848A (en) * | 2017-08-10 | 2019-02-26 | 深圳市雅臣智能生物工程有限公司 | Double targeting antibodies of anti-human papilloma virus (anti-HPV) and anti-CD humanization and combinations thereof, preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1468123A (en) * | 2000-08-11 | 2004-01-14 | 法弗里尔公司 | Method and composition for altering a b cell mediated pathology |
| WO2008127359A2 (en) * | 2006-10-10 | 2008-10-23 | University Of Wyoming | An insect cell line for production of recombinant glycoproteins with sulfated complex n-glycans |
| CN104829732A (en) * | 2015-03-25 | 2015-08-12 | 温州医科大学 | Recombinant protein and expressing method thereof in insect baculovirus expression system |
-
2016
- 2016-05-19 CN CN201610334911.7A patent/CN105925610B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1468123A (en) * | 2000-08-11 | 2004-01-14 | 法弗里尔公司 | Method and composition for altering a b cell mediated pathology |
| WO2008127359A2 (en) * | 2006-10-10 | 2008-10-23 | University Of Wyoming | An insect cell line for production of recombinant glycoproteins with sulfated complex n-glycans |
| CN104829732A (en) * | 2015-03-25 | 2015-08-12 | 温州医科大学 | Recombinant protein and expressing method thereof in insect baculovirus expression system |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109384848A (en) * | 2017-08-10 | 2019-02-26 | 深圳市雅臣智能生物工程有限公司 | Double targeting antibodies of anti-human papilloma virus (anti-HPV) and anti-CD humanization and combinations thereof, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925610B (en) | 2019-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101307880B1 (en) | Recombinant expression of multiprotein complexes using polygenes | |
| CN111825772B (en) | Adeno-associated virus with variant capsid protein and application thereof | |
| CN112666348A (en) | Detection proteome of novel coronavirus SARS-CoV-2 and application thereof | |
| US6645724B1 (en) | Assays for endotoxin | |
| CN111593072B (en) | Method for co-expressing four structural proteins of African swine fever virus in insect cells and application of method | |
| CN114262381B (en) | Recombinant baculovirus with surface displaying African swine fever virus antigen P30 protein, preparation method and application thereof | |
| CN105925610B (en) | Insect baculovirus expression vector, construction method and application thereof | |
| CN110108884A (en) | A kind of ELISA detection method for canine distemper virus and antibody | |
| CN112501139B (en) | Recombinant Newcastle disease virus strain and preparation method and application thereof | |
| CN112250738B (en) | Preparation, purification and identification method of severe acute respiratory syndrome coronavirus 2 virus-like particles | |
| CN104328136B (en) | The preparation of Newcastle disease poison strain rClone30 fliC and its application in Newcastle disease prevention | |
| CN111748034B (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
| CN106755105A (en) | One plasmid Rescue System is used for the preparation and application of influenza virus vaccine strain | |
| CN104357409B (en) | Express chicken IL2 recombinant Newcastle disease virus and its application in vaccine | |
| CN115247173A (en) | Gene editing system for constructing TMPRSS6 gene mutant iron deficiency anemia pig nuclear transplantation donor cells and application thereof | |
| CN108949691B (en) | A method of prepare can real-time detection mescenchymal stem cell aging cell model | |
| CN107354172B (en) | Recombinant expression vector and construction method and application thereof | |
| CN114957406B (en) | Trivalent antigen and trivalent virus-like particle of canine parvovirus and application | |
| CN109082443A (en) | A method of preparing can the cell model that breaks up to mature hepatic lineage of real-time detection mescenchymal stem cell | |
| CN108949690A (en) | A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model | |
| CN113234746B (en) | Method for pesticide induced protein interaction and induced gene expression | |
| CN103352042B (en) | The cDNA of coding recombinant Newcastle disease virus, the virus of being saved by this cDNA and the application in treatment malignant tumour thereof | |
| CN116640801A (en) | COVID-19 virus genetic engineering preventive vaccine and preparation method thereof | |
| CN116135882A (en) | Alpaca-derived nano antibody M112 and application thereof | |
| CN116135880A (en) | Alpaca-derived nano antibody S140 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |