CN114703067B

CN114703067B - Photosynthetic microorganism and application and plasmid thereof

Info

Publication number: CN114703067B
Application number: CN202210356811.XA
Authority: CN
Inventors: 邵慧; 阎冬; 郑集杨
Original assignee: Shanghai Guangyue Biotechnology Co ltd
Current assignee: Shanghai Guangyue Biotechnology Co ltd
Priority date: 2022-04-06
Filing date: 2022-04-06
Publication date: 2023-09-05
Anticipated expiration: 2042-04-06
Also published as: CN114703067A

Abstract

The invention discloses a photosynthetic microorganism, application and plasmid thereof, wherein the photosynthetic microorganism contains a plurality of exogenous genes, and the exogenous genes comprise a gene for encoding propionyl-coenzyme A transferase, a gene for encoding polyhydroxyalkanoate synthase and a gene for encoding d-lactate dehydrogenase. The genetically engineered blue algae provided by the invention can be used for efficiently producing polylactic acid (PLA) and lactic acid copolymer by directly utilizing greenhouse gas CO2 through photosynthesis, so that the consumption of carbohydrate and expensive precursors and the use of inducers are avoided. The invention also provides the application of the genetically engineered blue algae, in particular to the application in the production of PLA and copolymer, which opens up a new technology for the production of degradable plastics, reduces the production cost and has important application prospect.

Description

Photosynthetic microorganism and application and plasmid thereof

Technical Field

The invention relates to a method for genetically engineering modification of photosynthetic microorganisms to directly utilize CO through photosynthesis ₂ A technology for efficiently producing polylactic acid and a lactic acid copolymer belongs to the technical field of biology.

Background

The traditional plastic mainly uses petroleum as raw material, and generates high molecular compound through polymerization reaction, and is widely applied in industrial production and daily life. However, traditional plastics are almost difficult to degrade, and their use in large quantities causes a great "white pollution" to the ecological environment and a petroleum crisis. Polylactic acid (PLA) is a degradable plastic which is prepared by taking renewable resources as raw materials and fermenting, saccharifying and polymerizing. The material which is natural and is natural can meet the requirement of sustainable development, can replace the traditional petroleum-based material, and has great development potential. In recent years, PLA has been widely used in many fields such as packaging, medical materials, food engineering, and textile industry. Currently commercialized PLA production is mainly produced by fermentation-chemical polymerization, where lactic acid is produced by microbial fermentation and then chemically polymerized into a homopolymer or copolymer. In order to improve the brittleness of PLA, lactic acid copolymers such as poly (3-hydroxy propionate) (P (3 HP-co-LA)) can be produced by adding 3-hydroxy propionate (3 HP) and the like having good extensibility. However, the long chemical polymerization process consumes much solvent, results in lower yields of the product and environmental pollution, and can make it difficult to remove the chain coupling agent, limiting further applications of PLA and its copolymers.

With the rapid development of biotechnology such as synthetic biology and metabolic engineering, new opportunities have appeared in the preparation of PLA by a full biological method, and direct polymerization of lactic acid in cells can be realized. In 2010, jung et al directly converted glucose to PLA using genetically engineered E.coli, and synthesized PLA was up to 11% of the dry cell weight (Jung, Y.K., kim, T.Y., park, S.J., lee, S.Y., metabolic engineering of Escherichia coli for the production of polylactic acid and its copolymers, biotechnol, bioeng, 2010, 105:161-171); in 2016, choi et al utilized engineered E.coli to convert glucose and xylose to a poly (lactic acid) co-glycolate, with fermentation yields up to 40% of the dry cell weight (Choi, S.Y., et al, one-step fermentative production of poly (lactate-co-glycolate) from carbohydrates in Escherichia coll. Nat. Biotechnol. 2016, 34:435-440); in 2019, hori et al utilized engineered E.coli to convert glucose and xylose to poly-3-hydroxypropionate lactate copolymer in a fermentation yield of 44% of the dry cell weight (Hori, C., et al, high-cell density culture of poly (lactate-co-3-hydroxybutyrate) -producing Escherichia coli by using glucose/xylose-switching fed-batch jar reference J. Biosci. Bioeng. 2019, 127:721-725). Although these studies have successfully introduced synthetic routes to PLA or its copolymers in microorganisms, the production process emits greenhouse gases and requires the addition of large amounts of carbohydrates or expensive precursor materials, which are costly to produce and are a long distance from commercial applications. Thus, it remains a great challenge to find an economically sustainable green production process for PLA and its copolymers.

Disclosure of Invention

In view of the above-mentioned deficiencies of the prior art, the present invention provides a photosynthetic microorganism and its use and plasmid, avoiding the use of carbohydrates, expensive precursor materials and inducers.

The technical scheme adopted by the invention is as follows:

a photosynthetic microorganism comprising a plurality of exogenous genes including a gene encoding propionyl-coa transferase, a gene encoding polyhydroxyalkanoate synthase, and a gene encoding d-lactate dehydrogenase.

Further improvement, the nucleotide sequence of the coding gene of the propionyl-coenzyme A transferase is shown as SEQ ID NO. 1, the nucleotide sequence of the coding gene of the polyhydroxyalkanoate synthase is shown as SEQ ID NO. 2, and the nucleotide sequence of the coding gene of the d-lactate dehydrogenase is shown as SEQ ID NO. 3.

Further improvements, the exogenous genes include genes encoding pyruvate dehydrogenase and acetyl CoA synthase; the nucleotide sequence of the coding gene of the pyruvate dehydrogenase is shown as SEQ ID NO. 4; the nucleotide sequence of the coding gene of the acetyl-CoA synthase is shown as SEQ ID NO. 5.

Further improvements, the exogenous genes include a gene encoding beta-ketothiolase and a gene encoding acetoacetyl-CoA reductase; the nucleotide sequence of the coding gene of the beta-ketothiolase is shown as SEQ ID NO. 6, and the nucleotide sequence of the coding gene of the acetoacetyl-CoA reductase is shown as SEQ ID NO. 7.

Further improvements, the exogenous genes include genes encoding pyruvate dehydrogenase and acetyl CoA synthase; the nucleotide sequence of the coding gene of the pyruvate dehydrogenase is shown as SEQ ID NO. 4, and the nucleotide sequence of the coding gene of the acetyl-CoA synthase is shown as SEQ ID NO. 5.

Further improvement, the exogenous genes include a gene encoding malonyl-coa reductase and a gene encoding ACS region of propionyl-coa synthase; the nucleotide sequence of the coding gene of malonyl-coenzyme A reductase is shown as SEQ ID NO. 8; the nucleotide sequence of the coding gene of the ACS region of the propionyl coenzyme A synthetase gene is shown as SEQ ID NO. 9.

Further improvements, the photosynthetic microorganism is selected from the group consisting of Synechococcus, anabaena, nostoc, oscillatoria, chlorella, alternaria, bifidobacterium, verbena, chlamydomonas, chlorella and Nannochloropsis.

Further improvement, the wild photosynthetic microorganism is Synechococcus spSynechococcus elongatus PCC7942）。

The photosynthetic microorganism is used for CO ₂ Is converted into PLA and lactic acid copolymer.

A plasmid comprising the nucleotide sequence of the exogenous gene or a nucleotide sequence complementary to the exogenous gene; the exogenous genes on the plasmids are connected in series to form a serial structure; a constitutive promoter operably linked to a first gene in a tandem, or each gene in said tandem independently carrying a constitutive promoter operably linked to each other; the constitutive promoter is the psbA2 promoter. .

The exogenous gene is introduced into the genome DNA of the wild blue algae by tandem connection in the plasmid.

Further improvements are that the tandem expressed exogenous gene construct comprises a promoter operably linked to the first gene in the tandem construct, or that each gene in the tandem construct independently carries a promoter operably linked thereto.

Further improvements, the promoter is the psbA2 promoter.

Wherein said PCT is derived from clostridium propionicum;

the PhaC is derived from Pseudomonas;

the d-LDH is derived from lactobacillus delbrueckii;

the PdhA is derived from Synechococcus;

the ACS is derived from Synechococcus;

the PhaB is derived from copper greedy fungus;

the PhaA is derived from copper greedy fungus;

the MCR is derived from orange green flexor;

the PCSa is derived from green-forming bacteria.

The invention also provides application of the genetically engineered blue algae in producing PLA and lactic acid copolymer.

The beneficial effects of the invention are as follows: the invention carries out genetic modification on blue algae, reconstructs the synthetic route of PLA or the copolymer thereof in the blue algae, and the obtained genetically engineered bacteria can carry out inexhaustible solar energy and greenhouse gas CO ₂ Direct conversion to PLA and lactic acid copolymers avoids the consumption of carbohydrates and compounds and the use of expensive precursors. In a specific embodiment of the invention, genetically engineered cyanobacteria can produce up to 264 mg/l PLA,130 mg/l P (3 HB-co-LA), 162 mg/l P (3 HP-co-LA) after cultivation. The high-performance bio-based degradable materials of the substances have wide industrial application prospect. The invention provides an application method which reduces the substrate cost and can absorb the greenhouse gas CO ₂ Has important practical significance and industrial application value.

The conception, specific structure, and technical effects of the present invention will be further described with reference to the accompanying drawings to fully understand the objects, features, and effects of the present invention.

Drawings

FIG. 1 is a schematic diagram showing the integration of exogenous genes in example 5 of the present invention.

FIG. 2 is a schematic representation of the synthetic pathways of PLA and lactic acid copolymers in engineering strains in examples 6, 7 and 8 of the invention.

Detailed Description

The technical contents of the present invention are further described below with reference to examples: the following examples are illustrative, not limiting, and are not intended to limit the scope of the invention. The test methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The strains and growth conditions used in the present invention are as follows:

the cloning host DH 5. Alpha. Was purchased from Invitrogen, all E.coli were cultivated at 37℃in LB medium containing 100 mg/l spectinomycin.

Chlorella (Chlorella) and its preparation methodSynechococcus elongatus) PCC7942 was purchased from American type culture Collection (American type culture collection). In the construction stage, the Synechococcus PCC7942 grows in BG11 liquid medium, 1.5% agar powder is added into solid medium, and the culture conditions are as follows: 32 ^° C, light intensity 100. Mu.E.s ^-1 ·m ^-2 And continuously introducing 1% by volume of CO ₂ And (3) gas. Culturing the transformed engineering bacteria in a 5xBG culture medium when producing PLA and lactic acid copolymer, adding 20 mg/l spectinomycin, and culturing under the conditions that: 32 ^° C, continuously introducing 3% of CO by volume ₂ Gas, light intensity of initial 80. Mu.E.s ^-1 ·m ^-2 150 μE.s after 1 day ^-1 ·m ^-2 After 2 days, the temperature is increased to 400 mu E.s ^-1 ·m ^-2 。

Wherein, the formula of the LB culture medium is as follows: peptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, pH 7.0;

the formula of the BG11 liquid culture medium is as follows: 10 ml BG11 mother liquor, 1ml ferric ammonium citrate solution (6 g/L), 1ml Na ₂ CO ₃ Solution (20 g/L), 1ml K ₂ HPO ₄ Solution (30.5 g/L), water to volume to 1L;

the formula of the BG11 mother liquor is as follows: 149.6 g NaNO ₃ ，7.5 g MgSO ₄ ·7H ₂ O，3.6 g CaCl ₂ ·2H ₂ O, 0.6. 0.6 g citric acid, 1.12 ml Na ₂ EDTA solution (pH 8.0, concentration 0.25. 0.25M), 100 ml trace element solution, water to 1L;

the formula of the BG11 trace element solution is as follows: 2.86 g H ₃ BO ₃ ，1.81 g MnCl ₂ ·7H ₂ O，0.22 g ZnSO ₄ ·7H ₂ O，0.39 g Na ₂ MoO ₄ ·2H ₂ O，0.079 g CuSO ₄ ·5H ₂ O，0.049 g Co(NO ₃ ) ₂ ·6H ₂ O, water constant volume to 1L;

the formula of the 5xBG liquid culture medium is as follows: 50 ml BG11 mother liquor, 1ml ferric ammonium citrate solution (60 g/L), 2 ml Na ₂ CO ₃ Solution (100 g/L), 1ml K ₂ HPO ₄ Solution (152.5 g/L), water to volume to 1L;

all plasmids were pSyn_6 (purchased from Invitrogen corporation) derived plasmids for expression of the gene of interest by integration into the Synechocystis PCC7942 genome by homologous recombination.

Example 1

Construction of expression plasmid pSynpct-phaC-ldh：

(1) Extracting pSyn_6 plasmid:

coli DH 5. Alpha. Containing pSyn_6 plasmid was inoculated at an inoculum size of 2% into 5mL LB liquid medium containing 100 mg/l spectinomycin at 37 ^° Culturing 12 h in a C incubator. The cultured cells were subjected to plasmid extraction using a common plasmid miniprep kit (Tiangen Biochemical technologies Co., ltd.) by referring to the method described in the specification.

(2) Synthesis of propionyl-CoA transferase Genepct) Fragment and polyhydroxyalkanoate synthase gene ]phaC) Fragment and d-lactate dehydrogenase Geneldh) Fragments:

clostridium propionicum is treated according to the codon preference of Synechococcus PCC7942 by utilizing on-line software JCatClostridium propionicum) Coding gene of medium PCTpctCodon optimization is carried out, and after optimizationpctThe nucleotide sequence of (2) is shown as SEQ ID NO. 1; the pseudomonas is treatedPseudomonas sp.) encoding gene of PhaCphaCCodon optimization is carried out, and after optimizationphaCThe nucleotide sequence of (2) is shown as SEQ ID NO; lactobacillus delbrueckii is treatedLactobacillus delbrueckii) Coding gene of medium d-LDHldhCodon optimization is carried out, and after optimizationldhThe nucleotide sequence of (2) is shown as SEQ ID NO. 3. At the position ofphaCThe sd sequence 5'-aaagaggagaaatactag-3' is added at the front endldhThe sd sequence 5'-attaaagaggagaatctaga-3' was added to the front end, and these sequences were sent to the gene synthesis company of gold wisdom (GENEWIZ).

(3) Amplification ofpct-phaC-ldhGene fragment:

by using the synthesis in step (2)pctThe gene was used as a template for recombinant PCR amplification according to the method described in the guidelines for molecular cloning experiments (third edition).

PCR primer: upstream primerpct-F:5'-aaggagcgtcagatctcatatgcgcaaggttccgattat-3', downstream primerpct-R：5′-catctagtatttctcctctttttaggacttcatttccttcagacc-3′。

By using the synthesis in step (2)phaCThe gene was used as a template for recombinant PCR amplification according to the method described in the guidelines for molecular cloning experiments (third edition).

PCR primer: upstream primerphaC-F:5'-taaaaagaggagaaatactagatgtctaacaag-3', downstream primerphaC-R：5′-cattctagattctcctctttaatttaacgttcgtgcacgtaggtg-3′。

By using the synthesis in step (2)ldhThe gene was used as a template for recombinant PCR amplification according to the method described in the guidelines for molecular cloning experiments (third edition).

PCR primer: upstream primerldh-F:5'-taaattaaagaggagaatctagatgactaaaatt-3', downstream primerldh-R：5′-ccgcggatccgggaattcgaagcttttagccaaccttaaccggagttt-3′。

The obtained PCR product was subjected to gel cutting and recovery by AxyPrep DNA Gel Extraction Kit of Axygen, inc., and the method described in the specification was used.

Obtained by the amplificationpct, phaCAndldhthe gene fragment was used as a template for recombinant PCR amplification according to the method described in the guidelines for molecular cloning experiments (third edition).

PCR primer: upstream primerpct-F:5'-aaggagcgtcagatctcatatgcgcaaggttccgattat-3', downstream primerldh-R：5′-ccgcggatccgggaattcgaagcttttagccaaccttaaccggagttt-3′。

The obtained PCR product was subjected to gel cutting and recovery by AxyPrep DNA Gel Extraction Kit of Axygen, inc., and the DNA fragment was recovered by the method described in the specification to obtainpct-phaC-ldhA gene fragment.

(4) The pSyn_6 plasmid extracted in the step (1) was double digested with NEB restriction enzymes NdeI and HindIII, and the digested plasmid was recovered by the method described in the specification by reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (3) is followed bypct-phaC-ldhGene fragment and recovered pSyn_6 plasmid were subjected to seamless cloning by ClonExpress Ultra One Step Cloning Kit of the company of Norwegian (Vazyme) with reference to the method described in the specification to obtain a recombinant plasmid pSyn-pct-phaC-ldh。

Example 2

Construction of expression plasmid pSynpct-phaC-ldh-pdhA-acs：

(1) Amplification of pyruvate dehydrogenase Gene [ (]pdhA) Fragment and acetyl-CoA synthase Geneacs) Fragments:

the genome DNA of the Synechococcus PCC7942 is prepared by adopting a conventional method, and the process can refer to a small preparation method of bacterial genome in the 'fine programming molecular biology guide' published by scientific publishing society;

PCR amplification was performed according to the method described in the guidelines for molecular cloning experiments (third edition) using the Synechococcus PCC7942 genome as a template.

PCR primer:pdhAgene upstream primerpdhA-F:5'-gagcgtcagatctcatatggttcaggaacgtacactgc-3', downstream primerpdhA-R：5′-cattctagattctcctctttaatttagtcttctgcccagatgtagc-3′；acsGene upstream primeracs-F:5'-taaattaaagaggagaatctagaatgagccagccaacgatcg-3', downstream primeracs-R：5′-gggtttgcctggtaccgcggttaagtgccttgacgcagctta-3′。

PCR was performedpdhAGene fragmentacsThe gene fragment was excised and recovered by the method described in the specification using AxyPrep DNA Gel Extraction Kit of Axygen.

(2) Amplification of the psbA2 promoter:

PCR amplification was performed according to the method described in the "molecular cloning Experimental guidelines (third edition)", using the pSyn_6 plasmid as a template.

PCR primer: psbA2 promoter upstream primer psbA2-F: psbA2-F:5'-gttggctaaaagcttcgaattcggctggctatttagcgtcttcta-3', downstream primer psbA2-R:5'-tacgttcctgaaccatatgagatctgacgctccttcgag-3'.

(3) Amplified by step (1)pdhAGene fragment,acsThe gene fragment and the psbA2 promoter obtained by the amplification in the step (2) are used as templates for recombinant PCR amplification according to the method described in the molecular cloning Experimental guidelines (third edition).

PCR primer: the upstream primer psbA2-F:5'-gttggctaaaagcttcgaattcggctggctatttagcgtcttcta-3', downstream primeracs-R：5′-gggtttgcctggtaccgcggttaagtgccttgacgcagctta-3′。

The obtained PCR product was subjected to gel cutting and recovery by AxyPrep DNA Gel Extraction Kit of Axygen, inc., and the DNA fragment was recovered by the method described in the specification to obtainpdhA-acsA gene fragment.

(4) The recombinant plasmid pSyn in step (4) of example 1 was transformed into a plasmid pSynpct-phaC-ldhDouble digestion with NEB restriction enzymes EcoRI and BamHI was performed, and the digested plasmid was recovered by the method described in the specification with reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (3) is followed bypdhA-acsGene fragment and recovery of pSynpct-phaC-ldhClonExpress Ultra One Step Cloning Kit of the plasmid Novozan company (Vazyme) is described in the specificationThe method carries out seamless cloning to obtain recombinant plasmid pSyn-pct-phaC-ldh-pdhA-acs。

Example 3

Construction of expression plasmid pSynpct-phaC-ldh-phaABAnd pSyn-pct-phaC-ldh-phaAB-pdhA-acs：

(1) Synthesis of acetoacetyl-CoA reductase Gene and beta-ketothiolase Gene fragment [. Sup.phaAB）：

Copper bacteria of the uncinate worm are prepared according to the codon preference of the Synechococcus PCC7942 by utilizing online software JCatCupriavidus necator) Coding gene of ZhongPhaBphaBCodon optimization is carried out, and after optimizationphaBThe nucleotide sequence of (2) is shown as SEQ ID NO. 6; the copper bacteria of the ancylostoma is treatedCupriavidus necator) In (a)phaAIs encoded by the gene encoding (A)phaACodon optimization is carried out, and after optimizationphaAThe nucleotide sequence of (2) is shown as SEQ ID NO. 7. Will bephaAAndphaBthe sequences were joined together and a psbA2 sequence 5'-ttaaggttggctaaaagcttggctggctatttagcgtcttctaatccagtgtagacagtagttttggctccgttgagcactgtagccttgggcgatcgctctaaacattacataaattcacaaaagttttcgttacataaaaatagtgtctacttagctaaaaattaagggttttttacacctttttgacagttaatctcctagcctaaaaagcaagagtttttaactaagactcttgccctttacaacctcgaaggagcgtcagatctcat-3' was added at the front end and 5'-gaattcccggatccgcggta-3' at the rear end, and the combined sequence was synthesized by the gene delivered to the Kingwei corporation (GENEWIZ)phaAB。

(2) The recombinant plasmid pSyn in step (4) of example 1 was transformed into a plasmid pSynpct-phaC-ldhDouble digestion with NEB restriction enzymes HindIII and EcoRI was performed, and the digested plasmid was recovered by the method described in the specification with reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (1) is followed byphaABGene fragment and recovery of pSynpct-phaC-ldhThe plasmid was subjected to seamless cloning by ClonExpress Ultra One Step Cloning Kit from the company of Norwezan (Vazyme) and the method described in the specification to obtain a recombinant plasmid pSynpct-phaC-ldh-phaAB。

(3) By using the real worldExample 2 in step (3)pdhA-acsThe fragments were used as templates for PCR amplification according to the methods described in the guidelines for molecular cloning experiments (third edition).

PCR primer: the upstream primer psbA22-F:5'-tctgcacatgggttaagaattcggctggctatttagcgtcttcta-3', downstream primeracs-R：5′-gggtttgcctggtaccgcggttaagtgccttgacgcagctta-3′。

The obtained PCR product was subjected to gel cutting and recovery by AxyPrep DNA Gel Extraction Kit of Axygen, inc., and the DNA fragment was recovered by the method described in the specification to obtainpdhA-acs2 fragment.

(4) The recombinant plasmid pSyn in the step (2) is preparedpct-phaC-ldh-phaABDouble digestion with NEB restriction enzymes EcoRI and BamHI was performed, and the digested plasmid was recovered by the method described in the specification with reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (3) is followed bypdhA-acs2 Gene fragment and recovery of pSynpct-phaC-ldh-phaABThe plasmid was subjected to seamless cloning by ClonExpress Ultra One Step Cloning Kit from the company of Norwezan (Vazyme) and the method described in the specification to obtain a recombinant plasmid pSynpct-phaC-ldh-phaAB-pdhA-acs。

Example 4

Construction of expression plasmid pSynpct-phaC-ldh-mcr-pcs'And pSyn-pct-phaC-ldh-mcr-pcs'-pdhA-acs：

(1) Synthesis of malonyl-CoA reductase and malonyl-CoA synthetase ACS regionmcr- pcs') Fragments:

utilizing online software JCat to treat green-scratching bacteria according to codon preference of Synechococcus PCC7942Chloroflexus aurantiacus) Coding gene of middle MCRmcrAnd PCSa encoding genespcs'Codon optimization is carried out, and after optimizationmcrThe nucleotide sequence of (2) is shown as SEQ ID NO. 8, and after optimizationpcs'The nucleotide sequence of (2) is shown as SEQ ID NO. 9. Will bemcrAndpcs'the sequences are connected and psbA2 is added at the front endSequence 5'-ttaaggttggctaaaagcttggctggctatttagcgtcttctaatccagtgtagacagtagttttggctccgttgagcactgtagccttgggcgatcgctctaaacattacataaattcacaaaagttttcgttacataaaaatagtgtctacttagctaaaaattaagggttttttacacctttttgacagttaatctcctagcctaaaaagcaagagtttttaactaagactcttgccctttacaacctcgaaggagcgtcagatctcat-3', adding 5'-gaattcccggatccgcggta-3' to the rear end, gene synthesis combining sequence by gold-only company (GENEWIZ)mcr-pcs'。

(2) The recombinant plasmid pSyn in step (4) of example 1 was transformed into a plasmid pSynpct-phaC-ldhDouble digestion with NEB restriction enzymes HindIII and EcoRI was performed, and the digested plasmid was recovered by the method described in the specification with reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (1) is followed bymcr-pcs'Gene fragment and recovery of pSynpct-phaC-ldhThe plasmid was subjected to seamless cloning by ClonExpress Ultra One Step Cloning Kit from the company of Norwezan (Vazyme) and the method described in the specification to obtain a recombinant plasmid pSynpct-phaC-ldh-mcr-pcs'。

(3) Using the procedure of example 2, step (3)pdhA-acsThe fragments were used as templates for PCR amplification according to the methods described in the guidelines for molecular cloning experiments (third edition).

PCR primer: the upstream primer psbA23-F:5'-caagatcgctgagtaagaattcggctggctatttagcgtcttcta-3', downstream primeracs-R：5′-gggtttgcctggtaccgcggttaagtgccttgacgcagctta-3′。

(4) The recombinant plasmid pSyn in the step (2) is preparedpct-phaC-ldh-phaABDouble digestion with NEB restriction enzymes EcoRI and BamHI was performed, and the digested plasmid was recovered by the method described in the specification with reference to AxyPrep DNA Gel Extraction Kit of Axygen. The step (3) is followed bypdhA-acs2 Gene fragment and recovery of pSynpct-phaC-ldh-phaABThe plasmid was subjected to seamless cloning by ClonExpress Ultra One Step Cloning Kit from the company of Norwezan (Vazyme) and the method described in the specification to obtain a recombinant plasmid pSynpct-phaC-ldh-mcr-pcs'-pdhA-acs。

Example 5

Blue algae transformation and obtaining of genetically engineered blue algae:

(1) Blue algae strain transformation:

take a phase of logarithmic growth (OD) ₇₃₀ To 0.4-0.8), the cells were collected after centrifugation at 5000 rpm for 5 min, washed once with sterile 10 mM NaCl, and resuspended in 5ml fresh BG11 medium. Taking 500 ul bacterial liquid into an EP tube, adding recombinant plasmid with the final concentration of 100 ng/ml, uniformly mixing, and culturing at 30 ℃ in a dark place for 12-18 hours. A mixture of blue algae cells and recombinant plasmid DNA was spread on BG11 solid medium (containing 20. Mu.g/mL spectinomycin) and placed at 32℃for 100. Mu.E.s ^-1 ·m ^-2 Is cultured under continuous illumination for 10-14 days until single colonies appear on the solid medium.

(2) Obtaining genetically engineered blue algae:

picking up the transformant from the solid medium after transformation in the step (1), inoculating 5mL fresh BG11 liquid medium (containing 20 mug/mL spectinomycin), and placing at 32 ℃ and 100 mug.s ^-1 ·m ^-2 Is cultured under continuous illumination for 7-10 days under the light intensity of (C). The genome DNA of the genetically engineered blue algae is prepared by adopting a conventional method, and the process can refer to a small preparation method of bacterial genome in the 'fine programming molecular biology guide' published by scientific publishing society; PCR amplification verification is carried out by taking a genetically engineered blue algae genome as a template and transferring an amplification primer of an exogenous gene on a recombinant plasmid according to a method described in a molecular cloning experiment guideline (third edition).

Recombinant plasmid pSynpct-phaC-ldh，pSyn-pct-phaC-ldh-pdhA-acs，pSyn-pct-phaC-ldh-phaAB， pSyn-pct-phaC-ldh-phaAB-pdhA-acs，pSyn-pct-phaC-ldh-mcr-pcs'And pSyn-pct-phaC-ldh-mcr-pcs'-pdhA-acsThe exogenous genes are integrated on neutral site 1 (NSI) of the genome of the synechocystis PCC7942 through homologous recombination, and as shown in figure 1, genetically engineered cyanobacteria S-PLA1, S-PLA2, S-PLA3, S-PLA4, S-PLA5 and S-PLA6 are respectively obtained.

(3) Preservation of genetically engineered blue algae:

inoculating the genetically engineered blue algae obtained in the step (2) into BG11 liquid culture medium containing 20 mug/mL spectinomycin, and placing at 32 ℃ and 100 mug.s ^-1 ·m ^-2 Continuous light culture for 7-10 days under the light intensity of (3); under aseptic conditions, 1mL of overnight culture was added to a sterilized 1.5mL centrifuge tube and centrifuged at 5000 rpm for 3min. The supernatant was discarded, and the bacterial pellet was resuspended with a sterilized 15% glycerol solution to prepare a glycerol storage tube which was stored for half a year to one year in a-20℃refrigerator. And taking out the genetically engineered blue algae stored in the glycerol storage tube every half year for activating and re-storing the glycerol storage tube.

Example 6

Producing PLA by using genetically engineered blue algae S-PLA1 or S-PLA 2:

(1) Solid culture: inoculating genetically engineered blue algae S-PLA1 or S-PLA2 onto BG11 solid medium containing 20 μg/mL spectinomycin, at 32deg.C and 100deg.C, at 100 μE.s ^-1 ·m ^-2 Is cultured under continuous illumination for 10-15 days under the light intensity of (C).

(2) Seed culture: inoculating the strain S-PLA1 or S-PLA2 cultured in step (1) into 50 mL 5xBG liquid culture medium (containing 20 mug/mL spectinomycin) for strain activation, at 30deg.C, 100 mug.s ^-1 ·m ^-2 Culturing for 7-10 days under continuous illumination under light intensity to obtain seed.

(3) Fermentation culture: inoculating the seeds obtained in the step (2) into a flat plate type illumination reactor according to an inoculum size of 1% (volume ratio), and performing expansion culture in a 5xBG liquid medium (containing 20 mug/mL spectinomycin), wherein the culture conditions are as follows: 32 ^° C, continuously introducing 3% of CO by volume ₂ Gas, light intensity of initial 80. Mu.E.s ^-1 ·m ^-2 150 μE.s after 1 day ^-1 ·m ^-2 After 2 days, the temperature is increased to 400 mu E.s ^-1 ·m ^-2 Culturing for 5-8 days.

(4) Sample processing and detection: as shown in FIG. 2, PLA can be produced with a synthetic pathway for PLA in S-PLA1 or S-PLA 2. Centrifuging the culture solution of the step (3) at 8000 rpm/min for 10 min to collect thalli, and then washing and centrifuging the thalli by deionized water. The obtained pellet was freeze-dried under vacuum to a constant weight, and the dry Cell weight (CDW) was measured, and the dry Cell weight in the culture system was 7.2. 7.2 g/L. 50 mg stem cells were placed in an esterifying tube, and 2 mL chloroform and 2 mL esterification solution (2 g/L benzoic acid, 3% (V/V) concentrated sulfuric acid in methanol) were added to esterify 4 h. Adding 1mL deionized water, fully oscillating and uniformly mixing, taking chloroform phase for GC-MS analysis, and calculating the composition and content of the polymer in the stem cells by using an internal standard method. The highest yield of PLA can reach 264 mg/L (36.7 mg/g DCW), and the weight average molecular weight of the photosynthetic production PLA reaches more than 50 kDa.

Example 7

Production of P (3 HB-co-LA) using genetically engineered cyanobacteria S-PLA3 or S-PLA 4:

(1) Solid culture: inoculating genetically engineered blue algae S-PLA3 or S-PLA4 onto BG11 solid medium containing 20 μg/mL spectinomycin, at 32deg.C and 100deg.C, and allowing the strain to stand for 100deg.C ^-1 ·m ^-2 Is cultured under continuous illumination for 10-15 days under the light intensity of (C).

(3) Fermentation culture: inoculating the seeds obtained in the step (2) into a flat plate type illumination reactor according to an inoculum size of 1% (volume ratio), and performing expansion culture in a 5xBG liquid medium (containing 20 mug/mL spectinomycin), wherein the culture conditions are as follows: 32 ^° C, continuously introducing 3% of CO by volume ₂ Gas, light intensity of initial 80. Mu.E.s ^-1 ·m ^-2 After 1 day150 μE·s ^-1 ·m ^-2 After 2 days, the temperature is increased to 400 mu E.s ^-1 ·m ^-2 Culturing for 5-8 days.

(4) Sample processing and detection: centrifuging the culture solution of the step (3) at 8000 rpm/min for 10 min to collect thalli, and then washing and centrifuging the thalli by deionized water. The obtained pellet was freeze-dried under vacuum to a constant weight, and the dry Cell weight (CDW) was measured, and the dry Cell weight in the culture system was 6.9. 6.9 g/L. 50 mg stem cells were placed in an esterifying tube, and 2 mL chloroform and 2 mL esterification solution (2 g/L benzoic acid, 3% (V/V) concentrated sulfuric acid in methanol) were added to esterify 4 h. Adding 1mL deionized water, fully oscillating and uniformly mixing, taking chloroform phase for GC-MS analysis, and calculating the composition and content of the polymer in the stem cells by using an internal standard method. The highest yield of P (3 HB-co-LA) can reach 130 mg/L (18.9 mg/g DCW), the weight average molecular weight of P (3 HB-co-LA) reaches more than 100 kDa, and the proportion of lactic acid monomers is close to 40 mol percent.

Example 8

Production of P (3 HP-co-LA) by using genetically engineered cyanobacteria S-PLA5 or S-PLA 6:

(4) Sample processing and detection: centrifuging the culture solution of the step (3) at 8000 rpm/min for 10 min to collect thalli, and then washing and centrifuging the thalli by deionized water. The obtained pellet was freeze-dried under vacuum to a constant weight, and the dry Cell weight (CDW) was measured, and the dry Cell weight in the culture system was 6.6. 6.6 g/L. 50 mg stem cells were placed in an esterifying tube, and 2 mL chloroform and 2 mL esterification solution (2 g/L benzoic acid, 3% (V/V) concentrated sulfuric acid in methanol) were added to esterify 4 h. Adding 1mL deionized water, fully oscillating and uniformly mixing, taking chloroform phase for GC-MS analysis, and calculating the composition and content of the polymer in the stem cells by using an internal standard method. The highest yield of P (3 HP-co-LA) can reach 162 mg/L (24.5 mg/g DCW), the weight average molecular weight of P (3 HP-co-LA) reaches more than 70 kDa, and the proportion of lactic acid monomers is close to 60 mol percent.

The foregoing describes in detail preferred embodiments of the present invention. It should be understood that numerous modifications and variations can be made in accordance with the concepts of the invention without requiring creative effort by one of ordinary skill in the art. Therefore, all technical solutions which can be obtained by logic analysis, reasoning or limited experiments based on the prior art by the person skilled in the art according to the inventive concept shall be within the scope of protection defined by the claims.

Sequence listing

<110> Shanghai optical Yue Biotech Co., ltd

<120> a photosynthetic microorganism, use thereof and plasmid

<130> 2022-03-27

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1575

<212> DNA

<213> Synthetic sequence

<400> 1

atgcgcaagg ttccgattat taccgcagat gaggctgcaa agctgattaa agacggtgat 60

accgttacca cctctggttt cgttggcaac gcaatcccgg aggctctgga tcgcgctgtg 120

gaaaaacgct tcctggaaac cggcgaaccg aaaaacatta cctatgttta ttgtggttct 180

caaggtaacc gcgacggccg cggcgccgag cacttcgccc atgaaggcct gctgaaacgt 240

tacatcgctg gtcactgggc taccgttccg gctctgggta aaatggctat ggaaaacaaa 300

atggaagcat ataacgtgtc tcagggtgca ctgtgtcatc tgttccgtga tatcgcttct 360

cataagccgg gcgtgtttac caaggtgggt atcggtactt tcattgaccc gcgcaacggc 420

ggcggtaaag tgaacgatat taccaaagaa gatattgttg aactggtgga gattaagggt 480

caggaatatc tgttctaccc ggcttttccg attcatgtgg ctctgattcg tggtacttac 540

gctgatgaaa gcggcaacat cacctttgag aaagaagttg ctccgctgga aggcactagc 600

gtgtgccagg ctgttaaaaa ctctggcggt atcgttgtgg ttcaggttga acgcgtggtg 660

aaagctggta ctctggaccc gcgtcatgtg aaagttccgg gcatttatgt tgactatgtt 720

gttgttgctg acccggaaga tcatcagcaa tctctggatt gtgaatatga tccggcactg 780

agcggcgagc atcgccgccc ggaagttgtt ggcgaaccgc tgccgctgtc tgcaaagaaa 840

gttattggtc gtcgtggtgc cattgaactg gaaaaagatg ttgctgtgaa cctgggtgtt 900

ggtgcgccgg aatatgtggc atctgttgct gatgaagaag gtatcgttga ttttatgact 960

ctgactgctg aatctggtgc tattggtggt gttccggctg gtggcgttcg ctttggtgct 1020

tcttataacg cggatgcact gatcgatcaa ggttatcaat tcgattacta tgatggcggc 1080

ggcctggacc tgtgctatct gggcctggct gaatgcgatg aaaaaggcaa catcaacgtt 1140

agccgctttg gcccgcgtat cgctggttgc ggtggcttca tcaacattac tcagaacacc 1200

ccgaaggtgt tcttctgtgg tactttcacc gcaggtggcc tgaaggttaa aattgaagat 1260

ggcaaggtta ttattgttca agaaggcaag cagaaaaaat tcctgaaagc tgttgagcag 1320

attaccttca acggtgacgt tgcactggct aacaagcaac aagtgactta tattaccgaa 1380

cgctgcgtgt tcctgctgaa ggaggatggt ctgcacctgt ctgagattgc accgggtatt 1440

gatctgcaga cccagattct ggacgttatg gattttgcac cgattattga ccgcgatgca 1500

aacggccaaa tcaaactgat ggacgctgct ctgtttgcag aaggcctgat gggtctgaag 1560

gaaatgaagt cctaa 1575

<210> 2

<211> 1680

<212> DNA

<213> Synthetic sequence

<400> 2

atgtctaaca agtctaacga tgagctgaag tatcaagcct ctgaaaacac cctgggcctg 60

aacccggttg ttggcctgcg tggcaaggat ctgctggctt ctgctcgcat ggtgctgcgc 120

caggccatca agcaaccggt gcacagcgtt aaacatgttg cgcacttcgg cctggaactg 180

aagaacgtgc tgctgggtaa atccggcctg caaccgacca gcgatgaccg tcgcttcgcc 240

gatccggcct ggagccagaa cccgctgtat aaacgttatc tgcaaaccta cctggcgtgg 300

cgcaaggaac tgcacgactg gatcgatgaa tctaacctgg ccccgaagga tgtggcgcgt 360

ggccacttcg tgatcaacct gatgaccgac gccatggcgc cgaccaacac cgcggccaac 420

ccggcggcag ttaaacgctt tttcgaaacc ggtggcaaaa gcctgctgga cggcctgtct 480

cacctggcca aggatctggt gcacaacggc ggcatgccga gccaggttaa catgggtgca 540

ttcgaggttg gcaagagcct gggcgtgacc gaaggcgcgg tggtgtttcg caacgatgtg 600

ctggaactga tccagtacaa gccgaccacc gagcaggtgt acgaacgccc gctgctggtg 660

gtgccgccgc agatcaacaa gttctacgtt ttcgacctga gcccggacaa gagcctggcg 720

cgcttctgcc tgcgcaacaa cgtgcaaacc ttcatcgtta gctggcgcaa cccgaccaag 780

gaacagcgcg agtggggcct gtctacctac atcgaagccc tgaaggaagc ggttgacgtt 840

gttaccgcga tcaccggcag caaagacgtg aacatgctgg gcgcctgctc cggcggcatc 900

acttgcactg cgctgctggg ccattacgcg gcgattggcg aaaacaaggt taacgccctg 960

accctgctgg tgaccgtgct ggataccacc ctggacagcg acgttgccct gttcgttaac 1020

gaacagaccc tggaagccgc caagcgccac tcttaccagg ccggcgtgct ggaaggccgc 1080

gacatggcga aggttttcgc ctggatgcgc ccgaacgatc tgatctggaa ctactgggtt 1140

aacaactacc tgctgggcaa cgaaccgccg gtgttcgaca tcctgttctg gaacaacgac 1200

accacccgtc tgccggcggc gttccacggc gacctggttg aactgttcaa aaacaacccg 1260

ctgattcgcc cgaacgcact ggaagtgtgc ggcaccccga tcgacctgaa gcaggtgacc 1320

gccgacatct tttccctggc cggcaccaac gaccacatca ccccgtggaa gtcctgctac 1380

aagtctgcgc aactgtttgg cggcaacgtt gaatttgtgc tgtctagccg cggccatatc 1440

aagagcatcc tgaacccgcc gggcaacccg aaatctcgct acatgaccag caccgaagtg 1500

gcggaaaacg ccgatgaatg gcaagcgaac gccaccaagc ataccgattc ctggtggctg 1560

cactggcagg cctggcaggc ccaacgctct ggcgagctga aaaagtcccc gaccaaactg 1620

ggcagcaagg cgtatccggc aggtgaagcg gcgccgggca cctacgtgca cgaacgttaa 1680

<210> 3

<211> 1002

<212> DNA

<213> Synthetic sequence

<400> 3

atgactaaaa tttttgctta cgcaattcgt gaagatgaaa agccgttcct gaaggaatgg 60

gaagacgctc acaaggacgt tgaagttgaa tacactgaca agctgctgac cccggaaact 120

gctgctctgg caaagggtgc tgacggtgtt gttgtttacc aacaactgga ctacaccgct 180

gaaactctgc aagctctggc agacaacggc atcactaaga tgagcctgcg taacgttggt 240

gttgacaaca tcgacatggc taaggctaag gaactgggct tccaaatcac caacgttccg 300

gtttacagcc cgaacgccat cgcagaacat gctgctatcc aagctgcccg catcctgcgt 360

caagccaagg ctatggacga aaaggttgcc cgtcacgacc tgcgttgggc accgactatc 420

ggccgtgaag ttcgcgacca agttgttggt gttgtgggta ctggtcacat cggccaagtg 480

ttcatgcaaa tcatggaagg cttcggcgct aaggttatcg cttacgacat cttccgcaac 540

ccggaactgg aaaagaaggg ctactacgtg gacagcctgg acgacctgta caagcaagct 600

gacgttattt ccctgcacgt tccggacgtt ccggctaacg ttcacatgat caacgacaag 660

agcatcgcta aaatgaagca agacgttgtt atcgttaacg tgagccgtgg tccgctggtt 720

gacactgacg cggttatccg tggtctggac agcggcaagg ttttcggtta cgcaatggac 780

gtttacgaag gtgaagttgg cgttttcaac gaagaccgcg aaggcaagga atttccggac 840

gcacgcctgg ctgacctgat cgctcgtccg aacgttctgg tgactccgca cactgctttc 900

tacactactc acgctgttcg caacatggtg gttaaggcct tcgacaacaa cctggaactg 960

gttgaaggca aggaagctga aactccggtt aaggttggct aa 1002

<210> 4

<211> 1029

<212> DNA

<213> Synthetic sequence

<400> 4

atggttcagg aacgtacact gcctagtttt caggcttctc aggcgcaaat cagccgagaa 60

gaaggcctcc gcgtgtatga ggacatggtc ctgggtcgca ccttcgaaga caagtgtgcg 120

gagatgtact accgcggcaa aatgtttggc tttgtccacc tctacaacgg acaggaagcc 180

gtcgccagcg gcattatcaa ggcgatgaga tcggacgatt acgtctgcag tacctatcgc 240

gatcacgtcc acgccttgag tgctggtgtt ccggctcgtc aagtaatggc ggaactcttt 300

ggtaaagaga ccggctgcag ccgcggtcgc ggtggctcga tgcacttgtt ctcatccgaa 360

cataatctgc tgggcggctt tgcgtttgtg gctgagggca ttccgatcgc aacgggtgct 420

gcatttacca cggcctaccg gcgtaatgcc ttgggcgata ctagtgccga ccaagtgacg 480

gcttgcttct tcggggatgg tgccgccaac aacggccagt tcttcgaatg ccttaacatg 540

gcgacgctct ggaagctgcc gatcctgttt gtcgtcgaga acaacaaatg ggcgatcggg 600

atgtcccacg agcgggcgac ttccgatccg gaaatctaca agaagggtcc cgctttcggc 660

atgcccggcg tggaagtcga tggcatggat gtcttggcag tccgcgctgt ggctcaagaa 720

gcggttgcac gggcacgagc tggcgaaggc ccgacgctga ttgaggcact aacctatcgc 780

ttccggggtc actcgctggc ggatccggat gaactgcgct cgaaggaaga gaaagagttc 840

tggttggctc gcgatccaat caaacggttt gcggctcacc tgacggagtt caatctggca 900

actcacgaag aactgaaggc gatcgacaag aagatcgaag ctttggttgc agaggcagtg 960

gagtttgcga tctccagccc cgagccgaag cccgaagaac tgactcgcta catctgggca 1020

gaagactaa 1029

<210> 5

<211> 1971

<212> DNA

<213> Synthetic sequence

<400> 5

atgagccagc caacgatcga gtcgatcctc caagagaagc gggtttttcc tccctcggca 60

gaatttgcca gtgcggcgcg aatcaatccc gaagcgtacg aagcgctctg ccagaaagcg 120

gcggccgatc cggtggcttt ttggggcgaa ttggcagctc aggagctgga ctggtttgag 180

ccttggcaac agacgctgga ctggagcaat ccgccgtttg cgaagtggtt tgtcggtggc 240

aaactcaata tttcccacaa ctgcctcgat cgccacttga cgacttggcg caaaaataaa 300

gcggcgatta tctgggaagg cgaacccggt gactcacgga cgctgaccta cgcgcaactg 360

catcgcgagg tctgtcagtt cgccaacgtg ctcaaatcct tgggcattca aaaaggtgat 420

gtcgttggcg tttacatgcc gatgattccc gaagcggcga tcgccatgct ggcctgtgcg 480

cggattggcg cagtgcatag cgttgtcttt gggggcttta gtgcggaagc actgcgcgat 540

cgcttggtgg atggccaagc caagctggtt gtcacggcgg atggtggctg gcgcaaagat 600

gcgatcgtgc ccctcaagga ttctgttgat caagccctgg aaggcaatgc ctgccccagc 660

gtccagcatg tcctcgtggt ggaacggacg aagcaagaca tccacatgga accggggcgc 720

gaccattggt ggcatgagct gcaacagacc gtcagcgcta cctgtccggc ggagccgatg 780

gacagcgaag atctgctctt cgtgctctac acctccggta gcaccggcaa acccaagggt 840

gtcgtccaca ccaccggcgg ctacaacctc tacgcccaca tcaccaccca gtggactttt 900

gacctgcagg ataccgatgt ctactggtgt acggcggacg tcggctggat taccggtcac 960

agctacatcg tctacgggcc gctctccaac ggtgcgacca cactgatgta tgagggtgcc 1020

ccccgcgctt ctaatcccgg ttgcttctgg gatgtgattg aaaagtatgg cgttacgacc 1080

ttctacacag ccccaacagc gatccgcgcc ttcatcaaaa tgggtgagca gcatcccgcc 1140

gctcgcgacc tctcctcatt gcgactgttg ggcaccgtcg gagagcccat caatcccgaa 1200

gcttggatct ggtatcaccg cgtcattggt ggcgatcgct gcccgattgt cgatacctgg 1260

tggcagaccg aaacgggcgg ccatatgatt acgtcgctgc cgggagccgt gccgaccaaa 1320

ccgggctctg ccactaaacc tttcccgggc atcttggcag acgttgtcga tctggatggg 1380

cgatcggtgc cggataacga aggtggctac ttggtgattc gccatccttg gccaggcatg 1440

atgcgcacgg tctacggcga tcccgatcgc ttccgtcgca cctattggga gcatattcct 1500

ccgcaaaatg gccagtatct ctacttcgcc ggcgatggcg cgcgccgcga tgccgatggc 1560

tatttctggg tgatggggcg cgtcgatgac gtgatcaatg tctcaggtca ccgtctcggc 1620

acgatggaaa ttgagtcggc cttggtctcc catccggcag ttgccgaagc tgcagttgtc 1680

ggtcggcctg acgatctcaa aggtgaaggc attgttgctt tcatcacgct ggaatcgggc 1740

attgagactg gcgatgagtt agttaaagac ctgaagaaac acgtcgccca agaaattggc 1800

gcgatcgctc gtcccgatga aattcgcttc agtgaggcgc tgcccaaaac gcgatcgggc 1860

aagattatgc gccgtctgtt gcgcagtctc gccgctggtc aagaagtttc gggcgacact 1920

tccaccttgg aagatcgctc ggtgctcgat aagctgcgtc aaggcactta a 1971

<210> 6

<211> 741

<212> DNA

<213> Synthetic sequence

<400> 6

atgacccagc gtatcgctta cgttaccggt ggtatgggtg gtatcggtac cgctatctgc 60

caacgtctgg ctaaggacgg cttccgtgtt gttgcgggtt gcggtccgaa ctctccgcgt 120

cgtgaaaaat ggctggaaca gcaaaaggct ctgggcttcg acttcatcgc gtctgaaggt 180

aacgttgctg actgggactc taccaaaacc gctttcgaca aagttaaatc tgaagttggt 240

gaagttgacg ttctgatcaa caacgctggt atcacccgtg acgttgtgtt ccgcaaaatg 300

actcgtgctg actgggacgc tgttatcgac accaacctga cctctctgtt caacgttacc 360

aaacaggtta tcgacggtat ggctgaccgt ggttggggtc gtatcgttaa catctcttct 420

gttaacggtc agaaaggtca gttcggtcag accaactact ctaccgctaa agctggtctg 480

cacggtttca ccatggctct ggctcaggaa gttgctacca aaggtgtgac cgtgaacacc 540

gtgagcccgg gttacatcgc taccgacatg gttaaagcta tccgtcagga cgttctggac 600

aaaatcgttg ctaccatccc ggttaaacgt ctgggtctgc cggaagaaat cgcttctatc 660

tgcgcttggc tgtcttctga agaatctggt ttctctaccg gtgctgactt ctctctgaac 720

ggtggtctgc acatgggtta a 741

<210> 7

<211> 1182

<212> DNA

<213> Synthetic sequence

<400> 7

atgaccgacg ttgttatcgt ttctgctgct cgtaccgctg ttggtaaatt cggtggttct 60

ctggctaaaa tcccggctcc ggaactgggt gctgttgtta tcaaagctgc tctggaacgt 120

gctggtgtta aaccggagca ggtgagcgaa gttatcatgg gtcaggttct gaccgctggt 180

tctggtcaga acccggctcg tcaggctgct atcaaagctg gtctgccggc tatggttccg 240

gctatgacca tcaacaaagt ttgcggttct ggtctgaaag ctgttatgct ggctgctaac 300

gctatcatgg ctggtgacgc tgaaatcgtt gttgctggtg gtcaggaaaa catgtctgct 360

gctccgcacg ttctgccggg ttctcgtgac ggtttccgta tgggtgacgc taaactggtt 420

gacaccatga tcgttgacgg cctgtgggac gtctacaacc aataccacat gggtatcacc 480

gctgaaaacg ttgctaaaga atacggtatc acccgtgaag ctcaggacga atttgctgtt 540

ggttctcaga acaaagctga agctgctcag aaagctggta aattcgacga agaaatcgtt 600

ccggttctga tcccgcagcg taaaggtgac ccggttgctt tcaaaaccga cgaatttgtt 660

cgtcagggtg ctaccctgga ctctatgtct ggtctgaagc cggcgttcga caaagctggc 720

accgttaccg ctgctaacgc ttctggtctg aacgacggtg ctgctgctgt tgttgttatg 780

tctgctgcta aagctaaaga actgggtctg accccgctgg ctaccatcaa atcttacgct 840

aacgctggtg ttgacccgaa agttatgggt atgggtccgg ttccggcttc taaacgtgct 900

ctgtctcgtg ctgaatggac cccgcaggac ctggacctga tggaaatcaa cgaagcgttc 960

gctgctcagg ctctggctgt tcaccagcag atgggttggg acacctctaa agttaacgtt 1020

aacggtggtg ctatcgctat cggtcacccg atcggtgctt ctggttgccg tatcctggtt 1080

accctgctgc acgaaatgaa acgtcgtgac gctaaaaaag gtctggcttc tctgtgcatc 1140

ggtggtggta tgggtgttgc tctggctgtt gaacgtaaat aa 1182

<210> 8

<211> 3663

<212> DNA

<213> Synthetic sequence

<400> 8

atgagcggca ccggccgcct ggcaggcaag attgcgctga ttaccggtgg cgccggcaac 60

atcggctctg aactgactcg tcgcttcctg gcagagggtg cgaccgttat tatttctggc 120

cgtaaccgtg cgaagctgac cgcactggcc gaacgtatgc aggcagaggc aggcgtgccg 180

gcaaagcgca tcgatctgga agttatggat ggctctgatc cggttgcggt gcgtgccggt 240

atcgaagcga ttgtggcccg tcacggccag atcgacattc tggttaacaa cgcaggctct 300

gccggtgccc agcgtcgtct ggccgagatt ccgctgactg aagctgaact gggcccgggc 360

gccgaagaga ccctgcatgc cagcatcgcc aacctgctgg gtatgggctg gcatctgatg 420

cgtattgcgg caccgcatat gccggtgggc tctgcggtta tcaacgtttc taccatcttt 480

agccgtgctg agtactacgg ccgtattccg tatgttaccc cgaaagctgc tctgaacgct 540

ctgtctcaac tggctgcgcg tgagctgggt gcacgtggca tccgcgttaa cactatcttc 600

ccgggcccga tcgaatctga tcgcatccgt accgtgttcc agcgtatgga tcagctgaag 660

ggccgtccgg aaggcgacac cgcgcaccat tttctgaaca ccatgcgcct gtgtcgtgcc 720

aacgaccagg gcgcgctgga gcgtcgcttc ccgtccgttg gcgatgtggc agacgcggcg 780

gtgttcctgg ccagcgcgga atccgccgct ctgtccggtg agaccattga ggttacccac 840

ggcatggagc tgccggcctg ctctgagacc agcctgctgg cccgtactga tctgcgcacc 900

attgatgcct ctggccgcac caccctgatc tgcgccggcg accagattga agaggtgatg 960

gcgctgaccg gtatgctgcg tacctgtggc tctgaagtga tcatcggctt ccgttctgct 1020

gcggcgctgg cccagttcga gcaggcagtt aacgagtctc gtcgtctggc gggcgcagac 1080

ttcaccccgc cgattgccct gccgctggac ccgcgcgatc cggcaaccat cgacgctgtg 1140

ttcgactggg gcgccggcga gaacaccggc ggcattcatg cagcggtgat tctgccggct 1200

acctctcacg aaccggcacc gtgcgtgatt gaggttgatg atgagcgtgt gctgaacttt 1260

ctggccgatg aaatcaccgg caccattgtg attgcctctc gcctggcccg ttactggcag 1320

tctcaacgtc tgaccccggg cgcacgcgcg cgtggcccgc gtgttatctt cctgtctaac 1380

ggtgcggatc aaaacggcaa cgtgtacggc cgcatccaat ctgccgctat cggtcagctg 1440

attcgtgtgt ggcgtcacga ggctgaactg gactatcagc gtgccagcgc cgccggtgat 1500

catgtgctgc cgccggtgtg ggccaaccag attgtgcgct tcgctaaccg cagcctcgaa 1560

ggcctggaat ttgcatgcgc ctggaccgct caactgctgc attctcaacg ccatatcaac 1620

gagattaccc tgaacatccc ggccaacatt agcgccacca ccggcgcacg ctctgcatct 1680

gttggctggg cggaaagcct gatcggcctg catctgggca aagttgcgct gattaccggt 1740

ggcagcgccg gtattggtgg ccagatcggc cgcctgctgg ctctgtctgg cgcgcgtgtg 1800

atgctggcag cccgtgatcg tcataagctg gaacagatgc aggcgatgat ccaatctgag 1860

ctggctgagg tgggctatac cgatgttgaa gatcgcgttc acattgcacc gggctgcgat 1920

gtgtctagcg aagcgcagct ggcggatctg gttgaacgta ccctgagcgc ttttggcacc 1980

gttgattatc tgatcaacaa cgccggcatc gccggtgttg aagagatggt tatcgatatg 2040

ccggttgagg gctggcgcca taccctgttc gccaacctga tcagcaacta ctctctgatg 2100

cgcaaactgg cgccgctgat gaaaaaacag ggtagcggtt acatcctgaa cgttagcagc 2160

tactttggcg gtgaaaaaga tgcggccatt ccgtacccga accgtgccga ttacgccgtt 2220

tctaaggctg gtcagcgtgc aatggccgaa gtttttgcgc gcttcctggg cccggagatc 2280

cagatcaacg ccattgcgcc gggtccggtt gaaggtgatc gcctgcgcgg taccggtgaa 2340

cgtccgggcc tgttcgcccg ccgtgcgcgt ctgatcctgg agaacaagcg tctgaacgag 2400

ctgcacgctg ctctgatcgc ggctgcgcgc accgatgagc gctctatgca cgaactggtt 2460

gaactgctgc tgccgaacga tgtggccgca ctggagcaga acccggcagc accgaccgcg 2520

ctgcgcgaac tggcgcgccg cttccgcagc gagggcgatc cggcggcaag cagcagctct 2580

gcgctgctga accgtagcat tgccgctaaa ctgctggctc gtctgcataa cggtggctat 2640

gtgctgccgg ccgacatctt tgcaaacctg ccgaacccgc cggacccgtt cttcacccgc 2700

gcccagattg atcgcgaggc tcgcaaggtt cgtgacggca tcatgggcat gctgtacctg 2760

caacgtatgc cgactgagtt tgatgttgct atggccaccg tgtactacct ggccgaccgc 2820

aacgtttctg gtgagacctt ccatccgagc ggcggtctgc gttacgaacg taccccgacc 2880

ggtggcgaac tgttcggcct gccgagcccg gaacgtctgg cggagctggt tggctctacc 2940

gtgtacctga tcggtgaaca tctgactgaa cacctgaacc tgctggcccg tgcgtacctg 3000

gaacgttacg gcgcacgtca ggtggtgatg attgttgaga ccgaaaccgg cgcagagacc 3060

atgcgtcgcc tgctgcacga tcacgttgag gctggtcgtc tgatgactat tgtggccggt 3120

gatcagatcg aagccgctat cgaccaggct atcactcgct acggtcgccc gggcccggtt 3180

gtgtgcaccc cgttccgtcc gctgccgacc gtgccgctgg ttggccgtaa agactctgac 3240

tggagcaccg tgctgtctga ggctgaattt gccgagctgt gcgaacacca gctgacccac 3300

catttccgtg tggcgcgcaa gattgccctg tctgatggtg cctctctggc gctggttact 3360

ccggaaacta ccgctaccag cactaccgag caatttgctc tggctaactt catcaaaacc 3420

accctgcacg cttttaccgc taccattggt gttgagagcg aacgcactgc tcagcgcatt 3480

ctgatcaacc aagttgatct gacccgtcgt gcgcgtgccg aagagccgcg tgatccgcac 3540

gagcgtcaac aagaactgga acgttttatc gaggcagttc tgctggttac tgcaccgctg 3600

ccgccggaag ccgatacccg ttacgccggc cgtattcatc gcggccgtgc gattaccgtg 3660

taa 3663

<210> 9

<211> 2526

<212> DNA

<213> Synthetic sequence

<400> 9

atgatcgaca ctgcgcccct ggcccccccc cgggcgcccc gctctaatcc gattcgggat 60

cgcgttgatt gggaagctca gcgcgctgct gcgctggcag atcccggcgc cttccacggc 120

gcgattgccc ggaccgttat ccactggtac gacccccaac accattgctg gattcgcttc 180

aacgagtcta gtcagcgttg ggaaggcctg gatgccgcta ccggtgcccc tgtgacggtg 240

gactatcccg ccgattatca gccctggcag caggcgttcg acgatagtga agcgcccttt 300

taccgctggt tcagcggtgg cttgaccaat gcctgcttta atgaagtgga ccggcatgtc 360

acgatgggct atggcgacga ggtggcctac tactttgaag gtgaccgctg ggataactcg 420

ctcaacaatg gtcgtggtgg tccggttgtc caggagacca tcacgcggcg gcgcctgttg 480

gtggaggtgg tgaaggctgc gcaggtgttg cgtgatctgg gcctgaagaa gggtgatcgg 540

attgctctga atatgccgaa tattatgccg cagatttatt atacggaagc ggcaaaacgc 600

ctgggtattc tgtacacgcc ggtcttcggt ggcttctcgg acaagactct gtccgaccgt 660

attcacaatg ccggtgcacg cgtggtgatt acctctgatg gtgcgtaccg caacgcgcag 720

gtggtgccct acaaagaagc gtataccgat caggcgctcg ataagtatat tccggttgag 780

acggcgcagg cgattgttgc gcagaccctg gccaccttgc ccctgactga gtcgcagcgc 840

cagacgatca tcaccgaagt ggaggccgca ctggccggtg agattacggt tgagcgctcg 900

gacgtgatgc gtggcgttgg ttctgccctc gcaaagctcc gcgatctgga tgcaagcgtg 960

caggcaaagg tgcgtaccgt gctggcgcag gcgctggtcg agtcgccgcc gcgggttgaa 1020

gctgtggtgg ttgtgcgtca taccggtcag gagattttgt ggaacgaggg ccgcgatcgc 1080

tggagtcacg acttgctgga tgctgcgctg gcgaagattc tggccaatgc gcgtgctgcc 1140

ggctttgatg tgcacagtga gaatgatctg ctcaatctcc ccgatgacca gctgatccgt 1200

gcgctctacg ccagtattcc ctgtgaaccg gttgatgctg aatatccgat gtttatcatt 1260

tacacctcgg gtagcaccgg taagcccaag ggtgtgatcc acgttcacgg cggttatgtc 1320

gccggtgtgg tgcacacctt gcgggtcagt tttgacgccg agccgggtga tacgatctat 1380

gtgatcgccg atccgggctg gatcaccggt cagagctata tgctcaccgc caccatggcc 1440

ggtcggctga ccggcgtgat tgccgagggc agcccgctct tccccagcgc cggccgttat 1500

gccagcatca tcgagcgcta tggcgtgcag atctttaagg cgggtgtgac cttcctcaag 1560

accgtgatgt ccaatccgca gaatgttgaa gatgtgcgcc tctatgatat gcactcgctg 1620

cgggttgcaa ccttctgcgc cgagccggtc agtccggcgg ttcagcagtt cggcatgcag 1680

atcatgaccc cgcagtatat caattcgtac tgggcgaccg agcacggtgg cattgtctgg 1740

acgcatttct acggtaatca ggacttcccg ctgcgtcccg atgcccatac ctatcccttg 1800

ccctgggtga tgggtgatgt ctgggtggcc gaaactgatg agagcggcac gacgcgctat 1860

cgcgttgctg acttcgatga gaagggcgag attgtgatta ccgccccgta tccctacctg 1920

acccgcaccc tctggggcga cgtgcccggc ttcgaggcgt acctccgcgg tgagattccg 1980

ctgcgggcct ggaagggtga tgccgagcgt ttcgtcaaga cctactggcg ccgtggcccc 2040

aacggtgaat ggggctatat ccagggtgat tttgccatca agtaccccga tggtagcttc 2100

acgctccacg gccgctctga cgatgtgatc aatgtgtcgg gccaccgtat gggcaccgag 2160

gagattgagg gtgccatttt gcgtgaccgc cagatcacgc ccgactcgcc cgtcggtaat 2220

tgtattgtgg tcggtgcgcc gcaccgtgag aagggtctga ccccggttgc cttcattcaa 2280

cctgcgcctg gccgtcatct gaccggcgcc gaccggcgcc gtctcgatga gctggtgcgt 2340

accgagaagg gcgcggtcag tgtccccgag gattacatcg aggttagtgc cttcccggaa 2400

acccgcagcg gcaagtatat gcgtcgcttc ctgcgcaata tgatgctcga tgaacccctg 2460

ggtgatacga cgacgttgcg caatcctgaa gtgctcgaag agattgcagc caagatcgct 2520

gagtaa 2526

Claims

1. A photosynthetic microorganism, wherein the photosynthetic microorganism comprises exogenous genes, and the exogenous genes comprise a gene encoding propionyl-coa transferase, a gene encoding polyhydroxyalkanoate synthase, and a gene encoding d-lactate dehydrogenase; the nucleotide sequence of the coding gene of the propionyl-coenzyme A transferase is shown as SEQ ID NO. 1, the nucleotide sequence of the coding gene of the polyhydroxyalkanoate synthase is shown as SEQ ID NO. 2, and the nucleotide sequence of the coding gene of the d-lactate dehydrogenase is shown as SEQ ID NO. 3; the photosynthetic microorganism is Synechococcus.

2. The photosynthetic microorganism of claim 1, wherein the exogenous genes further comprise a gene encoding pyruvate dehydrogenase and a gene encoding acetyl-coa synthase; the nucleotide sequence of the coding gene of the pyruvate dehydrogenase is shown as SEQ ID NO. 4; the nucleotide sequence of the coding gene of the acetyl-CoA synthase is shown as SEQ ID NO. 5.

3. The photosynthetic microorganism of claim 1, wherein the exogenous genes further comprise a gene encoding a β -ketothiolase and a gene encoding an acetoacetyl-coa reductase; the nucleotide sequence of the coding gene of the beta-ketothiolase is shown as SEQ ID NO. 6, and the nucleotide sequence of the coding gene of the acetoacetyl-CoA reductase is shown as SEQ ID NO. 7.

4. The photosynthetic microorganism of claim 3, wherein the exogenous genes further comprise a gene encoding pyruvate dehydrogenase and a gene encoding acetyl-coa synthase; the nucleotide sequence of the coding gene of the pyruvate dehydrogenase is shown as SEQ ID NO. 4, and the nucleotide sequence of the coding gene of the acetyl-CoA synthase is shown as SEQ ID NO. 5.

5. The photosynthetic microorganism of claim 1, wherein the exogenous genes further comprise a gene encoding malonyl-coa reductase and a gene encoding an ACS region of a propionyl-coa synthase gene; the nucleotide sequence of the coding gene of the malonyl-coenzyme A reductase is shown as SEQ ID NO. 8; the nucleotide sequence of the coding gene of the ACS region of the propionyl coenzyme A synthetase gene is shown as SEQ ID NO. 9.

6. The photosynthetic microorganism of claim 5, wherein said exogenous genes further comprise genes encoding pyruvate dehydrogenase and acetyl-coa synthase; the nucleotide sequence of the coding gene of the pyruvate dehydrogenase is shown as SEQ ID NO. 4, and the nucleotide sequence of the coding gene of the acetyl-CoA synthase is shown as SEQ ID NO. 5.

7. Use of a photosynthetic microorganism according to any one of claims 1-6 for the conversion of CO ₂ Is converted into PLA and lactic acid copolymer.