CN104046586A - Genetically engineered bacteria and application of genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol - Google Patents
Genetically engineered bacteria and application of genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol Download PDFInfo
- Publication number
- CN104046586A CN104046586A CN201410314730.9A CN201410314730A CN104046586A CN 104046586 A CN104046586 A CN 104046586A CN 201410314730 A CN201410314730 A CN 201410314730A CN 104046586 A CN104046586 A CN 104046586A
- Authority
- CN
- China
- Prior art keywords
- butanediol
- enterobacter cloacae
- cloacae
- genetically engineered
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses genetically engineered bacteria which are named as enterobacter cloacae SDM09, are collected in 'China Center For Type Culture Collection (CCTCC)' on May 7th, 2014 and have a collection number of CCTCC NO:M2014186. The invention further discloses application of the genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol by virtue of lignocelluloses hydrolysate. An experiment proves that the genetically engineered bacteria have remarkable capability of efficiently producing (2R, 3R)-2,3-butanediol by virtue of straw hydrolysate and provide a foundation for producing (2R, 3R)-2,3-butanediol by large-scale industrial development and utilization of the lignocelluloses hydrolysate.
Description
Technical field
The present invention relates to a strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof, relate in particular to a strain gene engineering enterobacter cloacae and utilizing ligno-cellulose hydrolysate to produce the application in (2R, 3R)-2,3-butanediol.
Background technology
2,3-butanediol be widely used in a plurality of fields such as chemical industry, food, fuel and space flight and aviation (Syu M J., Appl.Microbiol.Biotechnol., 2001,55,10-18).2,3-butanediol is a kind of liquid of colorless and odorless at normal temperatures, has three kinds of isomers: meso-2,3-butyleneglycol, (2R, 3R)-2,3-butanediol and (2S, 3S)-2,3-butanediol; (2R, the 3R) of opticity-2,3-butanediol important role in the asymmetric synthesis of chipal compounds wherein, and can use as frostproofer (Celinska and Grajek, Biotechnol.Adv.2009,27,715 – 725).
Lignocellulose, due to its substitutability and recyclability, is considered to utilize the desirable feedstock (Ji et al., Biotechnol.Adv.2011,29,351 – 364) of microorganisms producing chemical.Therefore, in recent years about utilizing the biotechnology of the carbohydrate production 2,3-butanediol that is derived from lignocellulose to obtain extensive concern (Wang et al., Appl.Microbiol.Biotechnol.2010,87,965 – 970).In ligno-cellulose hydrolysate, mainly contain glucose and xylose, because the existence of glucose can suppress 2,3-butanediol, produce the utilization of microorganism to wood sugar, tend to reduce the utilising efficiency of ligno-cellulose hydrolysate raw material, thereby cause the raising of 2,3-butanediol production cost.Have been reported by expressing when cAMRP (CRP) mutain is realized xylose and glucose and be used to produce 2,3-butyleneglycol (Ji et al., Appl.Microbiol.Biotechnol.2011,89,1119 – 1125), but due to output and production intensity lower, cannot meet industrial production demand.
In the wild strain of numerous production 2,3-butanediols of report, only Paenibacillus polymyxa produces optically pure (2R at present, 3R)-2,3-butanediol, this bacterial strain be take glucose as carbon source, fed-batch fermentation can produce (the 2R of 111.0 grams per liters, 3R)-2,3-butanediol, purity reaches 98%, for reporting at present (2R, the production peak of 3R)-2,3-butanediol, but its need high density organic nitrogen source (
et al., Bioresour.Technol.2012,124,237 – 244), increased production cost.Producing (2R, 3R)-2,3-butyleneglycol genetic engineering bacterium aspect, colibacillus engineering can utilize glucose to produce (2R, the 3R)-2,3-butanediol of 9.5 grams per liters, lower (the shen et al. of output, J.Ind.Microbiol.Biotechnol.2012,39,1725 – 1729); And yeast saccharomyces cerevisiae can utilize glucose and semi-lactosi to produce (2R, the 3R)-2,3-butanediol of 100.0 grams per liters by fed-batch fermentation, purity reaches 98%, and its production intensity is only 0.33g/[L h] (Lian et al., Metab.Eng.2014,23,92 – 99).And above-mentioned bacterial strains due to xylose utilization ability a little less than, can not effectively utilize ligno-cellulose hydrolysate to produce (2R, 3R)-2,3-butanediol.
Based on this, in the urgent need to finding better method, to realize, utilize ligno-cellulose hydrolysate to carry out the High-efficient Production of (2R, 3R)-2,3-butanediol.
Summary of the invention
In above-mentioned prior art, bacterial strain utilizes ligno-cellulose hydrolysate difficulty, yielding poorly of (2R, 3R)-2,3-butanediol, the deficiency that is difficult to scale operation, the problem to be solved in the present invention is to provide a strain and can utilizes the genetic engineering bacterium of ligno-cellulose hydrolysate production (2R, 3R)-2,3-butanediol and produce (2R, application in 3R)-2,3-butanediol.
Genetic engineering bacterium of the present invention is genetically engineered enterobacter cloacae, this bacterium called after enterobacter cloacae (Enterobacter cloacae) SDM09, its on May 7th, 2014 be preserved in " Chinese Typical Representative culture collection " center " (and China. Wuhan. Wuhan University), preserving number is: CCTCC NO:M2014186.
Said gene engineering bacteria enterobacter cloacae (Enterobacter cloacae) SDM09 is Gram-negative bacteria, aerobic or amphimicrobian is grown, the better culture temperature of this bacterium is 30 ± 1 ℃, can on the LB substratum that contains 50 mg/litre sulphuric acid kanamycins, grow.
Said gene engineering bacteria enterobacter cloacae (Enterobacter cloacae) SDM09 is by building with following method.
In enterobacter cloacae (Enterobacter cloacae) SDM CGMCC No.4230, the pK-bdh plasmid of utilization based on homologous recombination, knock out the bdh gene in E.cloacae SDM CGMCC No.4230, the recombinant bacterium called after bacterial strain enterobacter cloacae SDM01 obtaining; Utilize pcr amplification to obtain the (2R of bacillus pumilus, 3R)-2, Pb promotor in 3-butanediol dehydrogenation enzyme gene bpbdh and E.cloacae SDM CGMCC No.4230, and pass through recombinant PCR, enzyme is cut and is connected, build pET-Pb-bpbdh, wherein the nucleotide sequence of Pb-bpbdh is as shown in SEQ ID NO.1; In order to eliminate carbon metabolism, check, utilize pK-ptsG plasmid, knock out the ptsG gene in enterobacter cloacae SDM01, the recombinant bacterium called after enterobacter cloacae SDM03 obtaining; Utilize pcr amplification to obtain galactose permease gene galP and the Pb promotor in E.cloacae SDM CGMCC No.4230, and pass through recombinant PCR, enzyme is cut and is connected, build pET-Pb-galP, wherein the nucleotide sequence of Pb-galP is as shown in SEQ ID NO.2, further by restructuring pCR and enzyme, cut connection, obtain expressing the pETPb-bpbdh-PbgalP plasmid of bpbdh gene and galP gene simultaneously, wherein the nucleotide sequence of Pb-bpbdh-PbgalP is as shown in SEQ ID NO.3; Utilize pK-frdA and pK-ldhA to knock out frdA and the ldhA gene in enterobacter cloacae SDM03, the recombinant bacterium called after enterobacter cloacae SDM06 obtaining; PETPb-bpbdh-PbgalP plasmid electricity is transformed in enterobacter cloacae SDM06 to recombinant bacterium called after enterobacter cloacae (Enterobacter cloacae) SDM09 obtaining.
Genetic engineering bacterium of the present invention is utilizing ligno-cellulose hydrolysate to produce the application in (2R, 3R)-2,3-butanediol.
Select enterobacter cloacae (Enterobacter cloacae) SDM09CCTCC NO:M2014186, it is activated.
Under aseptic condition, get enterobacter cloacae (Enterobacter cloacae) the SDM09CCTCC NO:M2014186 bacterium liquid having activated, the inoculum size that the volume ratio of take is 5～10% is inoculated in fermention medium, 30 ± 1 ℃ of temperature, pH6.0～8.0, mixing speed 100～500rpm, under air flow 0.5～2.5vvm condition, cultivate 36～72 hours, therebetween, in substratum to be detected, the concentration of glucose is down to 20 grams per liters when following, adding ligno-cellulose hydrolysate to the concentration of glucose in substratum is 20～50 grams per liters, (2R in detecting fermented liquid, 3R)-2, when the concentration of 3-butyleneglycol no longer increases, fermentation ends, isolate nutrient solution, extract in the usual way (2R, 3R)-2, 3-butyleneglycol,
Wherein, above-mentioned fermentative medium formula is: in 1 liter of distilled water, contain: 8 grams of Dried Corn Steep Liquor Powder, 5 grams of anhydrous sodium acetates, 6 grams of potassium primary phosphates, 2.4 grams of citric acids, 1 gram, Repone K, 0.5 gram of magnesium sulfate heptahydrate, 10 milliliters of metal ion mother liquor solutions, 0.9%CaCl
210 milliliters of solution.The formula of metal ion mother liquor is: in 1 liter of distilled water, contain: 2.25 grams of iron vitriols, 0.75 gram of Zinc Sulphate Heptahydrate, 0.38 gram of manganese sulfate monohydrate.
In above-mentioned application: described pH scope preferably 6.0～7.0.
In above-mentioned application: described mixing speed is 300～450rpm preferably.
In above-mentioned application: described air flow is 1.0～2.0vvm preferably.
In above-mentioned application: the activation method of described enterobacter cloacae (Enterobacter cloacae) SDM09CCTCC NO:M2014186 bacterium liquid is:
(1) dull and stereotyped cultivation: by genetic engineering bacterium enterobacter cloacae (Enterobacter cloacae) SDM09CCTCC NO:M2014186 bacterial strain be scoring to contain mass volume ratio be 1.5～1.8% agar and contain 50 mg/litre sulfuric acid cards and receive on the LB culture medium flat plate of mycin, cultivate 12 ± 2 hours for 30 ± 1 ℃;
(2) seed culture: under aseptic condition, with a single bacterium colony on aseptic toothpick picking step (1) flat board, then be inoculated in the fermention medium that contains 60 grams per liter glucose and 50 mg/litre sulphuric acid kanamycins, 30 ± 1 ℃ of shaking table concussions are cultivated 12 ± 2 hours, obtain the activation bacterium liquid of enterobacter cloacae (Enterobacter cloacae) SDM09CCTCC NO:M2014186;
Wherein, the LB culture medium prescription described in above-mentioned steps (1) is: in 1 liter of distilled water, contain: 5 grams of yeast powders, 10 grams of peptones, 10 grams, sodium-chlor, 121 ℃ of sterilizings 15 minutes.
In above-mentioned application, the detection method of substrate glucose is: after the dilution that sample is set, adopt bio-sensing analyser SBA-40C (Shandong Province academy sciences Biology Research Institute) to measure.Measuring principle is for utilizing immobilized glucose oxidase film specificity to measure glucose content.
In above-mentioned application, the detection method of tunning (2R, 3R)-2,3-butanediol is:
In every 500 milliliters of ethyl acetate, add 0.7 milliliter of primary isoamyl alcohol, as extraction agent; Utilize this extraction agent, tunning sample in fermented liquid is carried out to equal-volume extraction, utilize the sample of vortex a pair of oscillators extraction to shake for 30 seconds, then standing, get upper strata sample and carry out vapor detection.Concrete vapor detection condition is as follows:
The model of gas chromatograph used is Agilent6820, and nitrogen is as carrier gas, and the temperature of sampler and detector is all made as 280 ℃, and the column temperature of testing process is set as: 40 ℃ keep 3 minutes; Then the speed with 1.5 ℃ of per minutes is warmed up to 80 ℃; Speed with 0.5 ℃ of per minute is warmed up to 86 ℃; Speed with 30 ℃ of per minutes is warmed up to 200 ℃.Sample size 1.5 microlitres, carry out vapor detection.
The present invention produces 2 to a plant height; the enterobacter cloacae of 3-mixture of butanediols carries out engineered; successfully realized and there is the ability of utilizing ligno-cellulose hydrolysate high yield (2R, 3R)-2,3-butanediol; and be that enterobacter cloacae SDM09 fermented stalk hydrolyzed solution obtains high yield (2R with this recombinant bacterial strain; 3R)-2,3-butanediol, produces (2R for industrial mass-producing develops ligno-cellulose hydrolysate; 3R)-2,3-butanediol provides basis.
The outstanding feature that the present invention has is:
(1) this project bacterial strain enterobacter cloacae SDM09 can utilize the xylose and glucose in lignocellulose simultaneously, and the utilization ratio of raw material improves greatly.
(2) engineering strain that the inventive method builds is produced (2R, 3R)-2,3-butanediol, and the trophic component of substratum is simple, production cost is low.
(3) engineering bacteria energy fermented stalk hydrolyzed solution of the present invention is produced (2R, 3R)-2,3-butanediol, and more than production peak can reach 152 grams per liters, purity is greater than 97%.
Accompanying drawing explanation
Fig. 1 carrier pETPb-bpbdh-PbgalP building process.
Fig. 2 enterobacter cloacae SDM09 fermented stalk hydrolyzed solution is produced (2R, 3R)-2,3-butanediol conditional curve.●, glucose; ■, biomass; ▲, wood sugar; ◆, (2R, 3R)-2,3-butanediol; ▼, acetoin.
The gas chromatogram of Fig. 3 enterobacter cloacae SDM09 tunning.
Wherein: A: standard substance gas chromatogram, B: the gas chromatogram of enterobacter cloacae SDM09 tunning.
Embodiment
Below by embodiment, further illustrate the present invention, but be not limited only to this.
Embodiment 1: the structure of producing (2R, 3R)-2,3-butanediol enterobacter cloacae engineering bacteria
1. knock out 2,3-butanediol dehydrogenase gene bdh (GenBank:13167657)
Adopt conventional method to prepare the genomic dna of enterobacter cloacae (Enterobacter cloacae) SDM CGMCC No.4230, the method that in the < < fine works molecular biology guide > > that this process can be published with reference to Science Press prepared by a small amount of of bacterial genomes; Use synthetic primer Kbdh1-f and Kbdh1-r pcr amplification from said gene group DNA to obtain the leading portion of 2,3-butanediol synthetic gene; Use synthetic primer Kbdh2-f and Kbdh2-r pcr amplification from said gene group to obtain the back segment of 2,3-butanediol synthetic gene; Utilize enzyme to cut and be connected recombinant conversion to intestinal bacteria S17-1 with the pKR6K plasmid that BamHI carries out double digestion, the bacterial strain called after intestinal bacteria pK-bdh obtaining through EcoRI.
Amplification restructuring design of primers is as follows:
Kbdh1-f:5 '-AAA
gAATTCcCAGGTGATGATCTCCAAC carries an EcoRI site
Kbdh1-r:5 '-TAT
aAGCTTcAAAACCATCTTTCACCAGG carries a HindIII site
Kbdh2-f:5 '-TTA
aAGCTTgGAGATTGACCGTCAGGTGT carries a HindIII site
Kbdh2-r:5 '-ATTT
gGATCCaTAGAGGTGTTTACTTTCCG carries a BamHI site.
1) cultivate the object bacterium enterobacter cloacae SDM CGMCC No.4230 that need to knock out and carry the intestinal bacteria pK-bdh that knocks out plasmid, growing into OD simultaneously
620nm0.5.1 milliliter of object bacterium culture is centrifugal, and physiological saline is washed twice; 5 milliliters of culture of Escherichia coli are centrifugal, and physiological saline is washed twice.
2) thalline of above-mentioned purpose bacterium and intestinal bacteria pK-bdh one is shared to 100 microlitre physiological saline resuspended, resuspended liquid is all dropped in to LB flat board (without any resistance) middle, dull and stereotyped positive placement, incubated overnight.
3) bacterium colony in above-mentioned flat board is scraped with physiological saline and scraper, physiological saline washes twice, and suitably diluting (is generally 10
-2or 10
-3), coating M9+ Citrate trianion+Kana is dull and stereotyped, and (enterobacter cloacae SDM GMCC No.4230 can utilize Citrate trianion for sole carbon source, and plasmid and genome have carried out the object bacterium that single cross is changed, can be in the dull and stereotyped growth of M9+ Citrate trianion+Kana; There is not the object bacterium that single cross is changed, cannot be in the dull and stereotyped growth of Kana; With the intestinal bacteria of plasmid, cannot grow at citrate flat plate), incubated overnight.
4) single bacterium colony of picking growth, utilizes upstream and downstream primer to carry out PCR checking, the object bacterium that single cross is changed, and PCR goes out long segment (original gene) and short-movie section (the upstream and downstream homology arm of structure) simultaneously.
5), by correct single switching purpose bacterium, be seeded to LB and shake pipe (without any resistance), incubated overnight.
6) above-mentioned nutrient solution is forwarded to LB containing 10% sucrose and shakes in pipe and cultivated for two generations, suitably dilution (is generally 10
-6or 10
-7), coating LB+12% sucrose is dull and stereotyped, incubated overnight.
7) single bacterium of picking growth, utilize upstream and downstream primer to carry out PCR checking, the object bacterium of double exchange, can go out short-movie section (the upstream and downstream homology arm of structure) by PCR, select correct double exchange bacterium, carry out phenotype checking, obtain correct bacterium E.cloacae SDM Δ bdh, the called after enterobacter cloacae SDM01 of knocking out.
M9 culture medium prescription is: in 1 liter of distilled water, contain: 0.5 gram, sodium-chlor, 1 gram of ammonium chloride, 3 grams of dipotassium hydrogen phosphates, 3 grams of Sodium phosphate dibasics, 0.246 gram of magnesium sulfate heptahydrate, 10 grams of trisodium citrates.
2. cross expression (2R, 3R)-2,3-butanediol dehydrogenase gene bpbdh
1) adopt conventional method to prepare the genomic dna of bacterial strain B.pumilus LN146, the method that in the < < fine works molecular biology guide > > that this process can be published with reference to Science Press prepared by a small amount of of bacterial genomes, the genomic dna of extraction B.pumilus LN146; Use synthetic primer Bp-f and Bp-r pcr amplification from B.pumilus LN146 genomic dna to obtain (2R, 3R)-2,3-butanediol dehydrogenase gene bpbdh.Use synthetic primer Pb-f and Pb-r from embodiment 1 in E.cloacae SDM CGMCC No.4230 genome pcr amplification obtain Pb promotor, utilize recombinant PCR to recombinate and obtain Pb-bpbdh fragment.
Amplification restructuring design of primers is as follows:
Pb-f:5 '-AAA
gGATCCaTCTAAAACGTCTCAAACCA carries a BamHI site
Pb-r:5’-TGCCAGCGTAGTGCTTTCATGCTCGTCCTCTTCAACTTTA
Bp-f:5’-TAAAGTTGAAGAGGACGAGCATGAAAGCACTACGCTGGCA
Bp-r:5 '-AAA
cTCGAGtTATTCAGCACTAACTAAAA carries an XhoI site.
The DNA sequence dna length of above-mentioned Pb-bpbdh fragment is 1143 bases, and its nucleotide sequence is as shown in SEQ ID NO.1.
2) double digestion that Pb-bpbdh fragment and pET28a after restructuring is carried out to BamHI and XhoI be connected, obtain pETPb-bpbdh plasmid.
3) the LB culture medium culturing enterobacter cloacae SDM01 that utilization contains every liter of EDTA of 0.7 mmole is to OD
620nm0.5.30 milliliters of object bacterium cultures are centrifugal, and ultrapure washing twice, and resuspended with the ultrapure water of 300 microlitres, obtains the competent cell of enterobacter cloacae SDM01.And then 2000 volts, 200 ohm, under 20 micro farad conditions, plasmid pETPb-bpbdh electricity is converted into enterobacter cloacae SDM01, be coated with Kana resistance LB dull and stereotyped, the transformant of picking, then proposes plasmid enzyme restriction checking, obtain correct transformant E.cloacae SDM Δ bdh/pETPb-bpbdh, called after enterobacter cloacae SDM02
Embodiment 2: the structure of removing glucose effect E.cloacae engineering bacteria
According to the gene knockout method in embodiment 1, on the basis of enterobacter cloacae SDM01, carry out knocking out of ptsG gene, obtain E.cloacae SDM Δ bdh Δ ptsG.
1. knock out glucose phosphotransferase gene ptsG (GenBank:13169500)
The genomic dna of enterobacter cloacae (Enterobacter cloacae) the SDM CGMCC No.4230 that extracts in embodiment 1 of take is template; Use synthetic primer KptsG1-f and KptsG1-r pcr amplification from E.cloacae SDM genomic dna to obtain the leading portion of ptsG.Use synthetic primer KptsG2-f and KptsG2-r pcr amplification from E.cloacae SDM genome to obtain the back segment of ptsG synthetic gene, utilize recombinant PCR to recombinate, make the genetically deficient middle portion after restructuring.Obtain recombinant fragment enzyme and cut and be connected recombinant conversion intestinal bacteria S17-1 through EcoRI with the pKR6K plasmid that BamHI carries out double digestion, obtain intestinal bacteria S17-1pK-ptsG.This bacterial strain is for the ptsG gene knockout of enterobacter cloacae SDM01, and concrete operations condition is with embodiment 1, and wherein amplification restructuring design of primers is as follows:
KptsG1-f:5 '-AAAGGATCCATGTTTAAGAATGCATTTGCT carries a BamHI site
KptsG1-r:5’-CAGAATCGCGTGGATAACGTATCACACCCGTGAAAATCGC
KptsG2-f:5’-GCGATTTTCACGGGTGTGAT?ACGTTATCCACGCGATTCTG
KptsG2-r:5 '-GTTGAATTCTTAGCTGTTGCGGATGTATTCATCCAT carries an EcoRI site.
The enterobacter cloacae E.cloacae SDM Δ bdh Δ ptsG called after enterobacter cloacae SDM03 obtaining.
2. recombinant expressed galactose permease gene galP
1) take the genomic dna of enterobacter cloacae (Enterobacter cloacae) the SDM CGMCC No.4230 that extracts in embodiment 1 is template, uses synthetic primer pcr amplification from E.cloacae SDM genomic dna to obtain galP synthetic gene.Recombinating obtains Pb-galP fragment with Pb (2,3-butanediol synthetic promoter derives from E.cloacae SDM), and utilizes BamHI and HindIII enzyme to cut to be connected to pET28a, to obtain pETPb-galP.
Amplification restructuring design of primers is as follows:
Pb-f:5 '-AAA
gGATCCaTCTAAAACGTCTCAAACCA, carries a BamHI site
Pg-r:5’-TGTTTATTATTGTCAGGCATGCTCGTCCTCTTCAACTTTA
G-f:5’-TAAAGTTGAAGAGGACGAGCATGCCTGACAATAATAAACA
G-r:5 '-TTT
aAGCTTtTAGTCGTGTGCGCCGATTT carries a HindIII site
The DNA sequence dna length of above-mentioned Pb-galP fragment is 1500 bases, and its nucleotide sequence is as shown in SEQ ID NO.2.
2) utilize primer G-B-f and G-B-r, take pETPb-galP as template pcr amplification obtains the DNA fragmentation of Pb-galP, utilize primer B-G-f and Bp-r, the pETPb-bpbdh of take obtains Pb-bpbdh as template pcr amplification.Use recombinant PCR that Pb-galP and Pb-bpbdh are heavily grouped together, NcoI/XhoI double digestion then, pET28a is connected with expression vector, obtains recombinant plasmid pETPb-bpbdh-PbgalP.
G-B-f:5 '-TAAGAAGGAGATATACCATGGATCTAAA carries a NcoI site
G-B-r:5’-TGAGACGTTTTAGATTTAGTCGTGTGCGCC
B-G-f:5’-GGCGCACACGACTAAATCTAAAACGTCTCA
Bp-r:5 '-AAACTCGAGTTATTCAGCACTAACTAAAA carries an XhoI site.
The DNA sequence dna length of above-mentioned Pb-bpbdh-PbgalP fragment is 2643 bases, and its nucleotide sequence is as shown in SEQ ID NO.3.
The recombinant plasmid pETPb-bpbdh-PbgalP electricity of gained is turned and entered in enterobacter cloacae enterobacter cloacae SDM03, obtain E.cloacae SDM Δ bdh Δ ptsG/pETPb-bpbdh-PbgalP, by its called after enterobacter cloacae SDM04.
Embodiment 3: the structure that knocks out by product pathways metabolism E.cloacae engineering bacteria
1. knock out lactate dehydrogenase gene ldhA (GenBank:13166930)
The genomic dna of enterobacter cloacae (Enterobacter cloacae) the SDM CGMCC No.4230 that extracts in embodiment 1 of take is template, uses synthetic primer KldhA1-f and KldhA1-r pcr amplification from E.cloacae SDM genomic dna to obtain the leading portion of ldhA gene.Use synthetic primer KldhA2-f and KldhA2-r pcr amplification from E.cloacae SDM genome to obtain the back segment of ldhA gene, utilize recombinant PCR to recombinate, make the genetically deficient middle portion after restructuring.Obtaining recombinant fragment enzyme cuts and is connected recombinant conversion through EcoRI with the pKR6K plasmid that SmaI carries out double digestion.
Amplification restructuring design of primers is as follows:
KldhA1-f:5 '-GCT
gAATTCaTCGATGAGCCCCGCGTTAA carries an EcoRI site
KldhA1-r:5’-GCTGAAGGTGGTTGGGGGTTGATTGACTCTCAG
KldhA2-f:5’-AGAGTCAATCAACCCCGAACCACCTTCAGCCCCA
KldhA2-r:5 '-GCTA
cCCGGGtATCCTGATTTAGCGAGAGA carries a SmaI site.
According to the biparent cross method in embodiment 1, on the basis of enterobacter cloacae E.cloacae SDM03, carry out biparent cross double exchange and obtain E.cloacae SDM Δ bdh Δ ptsG Δ ldhA, by its called after enterobacter cloacae SDM05.
2. knock out succinodehydrogenase gene frdA (GenBank:13168818)
The genomic dna of enterobacter cloacae (Enterobacter cloacae) the SDM CGMCC No.4230 that extracts in embodiment 1 of take is template, uses synthetic primer KfrdA1-f and KfrdA1-r pcr amplification from enterobacter cloacae E.cloacae SDM genomic dna to obtain the leading portion of frdA gene.Use synthetic primer KfrdA2-f and KfrdA2-r pcr amplification from enterobacter cloacae E.cloacae SDM genome to obtain the back segment of frdA gene, utilize recombinant PCR to recombinate, make the genetically deficient middle portion after restructuring.Obtaining recombinant fragment enzyme cuts and is connected recombinant conversion through EcoRI with the pKR6K plasmid that SmaI carries out double digestion.
Amplification restructuring design of primers is as follows:
KfrdA1-f:5 '-CC
gAATTCgTGCAAACTTTTCAAGCCGA carries an EcoRI site
KfrdA1-r:5’-GACGTCAGTGACCGTCATCGACCAGAAT
KfrdA2-f:5’-CGGTCACTGACGTCGAGAAACGACTGAA
KfrdA2-r:5 '-TTT
cCCGGGtCAGCCATTCGCCTTCTCCT carries a SmaI site.
According to the biparent cross method in embodiment 1, on the basis of enterobacter cloacae E.cloacae SDM05, carry out biparent cross double exchange and obtain enterobacter cloacae E.cloacae SDM Δ bdh Δ ptsG Δ ldhA Δ frdA, by its called after enterobacter cloacae SDM06.
The plasmid pETPb-bpbdh-PbgalP electricity that embodiment 2 is built forwards in E.cloacae SDM06, obtain final purpose engineering strain E.cloacae SDM Δ bdh Δ ptsG Δ ldhA Δ frdA/pETPb-bpbdh-PbgalP, called after enterobacter cloacae (Enterobacter cloacae) SDM09.
Engineering bacteria enterobacter cloacae obtained above (E.cloacae) SDM09 is preserved in Chinese Typical Representative culture collection center (Wuhan University, Wuhan, China) on May 7th, 2014, and preservation center is numbered: CCTCC NO:M2014186.
Above-mentioned restructuring enterobacter cloacae (E.cloacae) SDM09CCTCC NO:M2014186 is Gram-negative bacteria, and aerobic or amphimicrobian growth, can be for fermentative production (2R, 3R)-2,3-butanediol.
The better culture temperature of above-mentioned restructuring enterobacter cloacae (E.cloacae) SDM09CCTCC NO:M2014186 is 30 ± 1 ℃, can receive on the LB substratum of mycin and grow containing 50 mg/litre sulfuric acid cards.
Embodiment 4: the cell liquid culture of preparation enterobacter cloacae (Enterobacter cloacae) SDM09 bacterial strain
1, dull and stereotyped cultivation: gained enterobacter cloacae in embodiment 3 (Enterobacter cloacae) SDM09 is scoring to to contain mass volume ratio be on LB flat board 1.5% agar and that contain 50 mg/litre sulphuric acid kanamycins, cultivates 12 hours for 30 ℃;
2, seed: under aseptic condition, with a single bacterium colony on aseptic toothpick picking step (1) flat board, be then inoculated in the LB substratum that contains 50 mg/litre sulphuric acid kanamycins of 5 milliliters, 30 ℃ of shaking tables concussions are cultivated 12 hours;
3, shaking flask: under aseptic condition, get bacterium liquid that step (2) cultivates with the inoculum size of volume ratio 1～3%, be inoculated in 30～150 milliliters of fermention mediums that contain 60 grams per liter glucose and 50 mg/litre sulphuric acid kanamycins, 30 ± 1 ℃ of shaking table concussions are cultivated 12 ± 1 hours, obtain the cell liquid culture of enterobacter cloacae (Enterobacter cloacae) SDM09 bacterial strain;
Wherein, the LB culture medium prescription described in above-mentioned steps 1 is: in 1 liter of distilled water, contain: 10 grams of peptones, 5 grams of yeast powders, 10 grams, sodium-chlor, 121 ℃ of sterilizings 15 minutes.
Embodiment 5: enterobacter cloacae (Enterobacter cloacae) SDM09 engineering bacteria be take glucose and xylose as carbon source through fermentation production (2R, 3R)-2,3-butanediol
The cell liquid culture of enterobacter cloacae (Enterobacter cloacae) the SDM09 bacterial strain that the method by embodiment 4 is obtained, the inoculum size that the volume ratio of take is 5% is inoculated in the fermention medium that contains 60 grams per liter glucose, 20 grams per liter wood sugars and 50 mg/litre sulphuric acid kanamycins, at 30 ℃, pH6.5,300rpm, 1.5vvm air flow condition bottom fermentation.In fermentation, every 3 hours, sample sample centrifugal 10 minutes with 8,000 * g, the concentration of (2R, 3R)-2,3-butanediol and glucose in detection supernatant, according to glucose concn, add the glucose and xylose powder mixture that ratio is 3:1, make glucose concn maintain 20～50 grams per liters; Supernatant is carried out to the concentration that (2R, 3R)-2,3-butanediol in fermented liquid is measured in gas chromatographic analysis, when the concentration of (2R, 3R)-2,3-butanediol no longer increases, stop fermentation.
Wherein, 1 formula of the fermention medium described in above-mentioned steps is: in 1 liter of distilled water, contain: 8 grams of Dried Corn Steep Liquor Powder, 5 grams of sodium acetates, 6 grams of potassium primary phosphates, 2.4 grams of citric acids, 1 gram, Repone K, 0.5 gram, magnesium sulfate, 10 milliliters of metal ion mother liquor solutions, 0.9%CaCl
210 milliliters of solution.The formula of metal ion mother liquor is: in 1 liter of distilled water, contain: 2.25 grams of iron vitriols, 0.75 gram of Zinc Sulphate Heptahydrate, 0.38 gram of manganese sulfate monohydrate.
After 44 hours, detected result shows: the concentration of (2R, 3R)-2,3-butanediol is 152 grams per liters.
Embodiment 6: enterobacter cloacae (Enterobacter cloacae) SDM09 engineering bacteria be take stalk hydrolyzed solution as carbon source through fermentation production (2R, 3R)-2,3-butanediol
The cell liquid culture of enterobacter cloacae (Enterobacter cloacae) the SDM09 bacterial strain that the method by embodiment 4 is obtained, the inoculum size that the volume ratio of take is 5% is inoculated in the fermention medium of the stalk hydrolyzed solution that contains 550 grams per liter total reducing sugars (glucose and xylose ratio is 3:1) and 50 mg/litre sulphuric acid kanamycins, at 30 ℃, pH7.0,450rpm, 2.0vvm air flow condition bottom fermentation.In fermentation, every sampling in 3 hours, sample centrifugal 10 minutes with 8,000 * g, detected (2R, 3R)-2,3-butanediol and glucose concn in supernatant, according to glucose concn, adds concentrated stalk hydrolyzed solution, makes glucose concn maintain 20～50 grams per liters; Supernatant is carried out to the concentration that (2R, 3R)-2,3-butanediol in fermented liquid is measured in gas chromatographic analysis, when the concentration of (2R, 3R)-2,3-butanediol no longer increases, stop fermentation.
After 51 hours, detected result shows: the concentration of (2R, 3R)-2,3-butanediol is 119.4 grams per liters.
Embodiment 7: enterobacter cloacae (Enterobacter cloacae) SDM09 engineering bacteria be take glucose as carbon source through fermentation production (2R, 3R)-2,3-butanediol
The cell liquid culture of enterobacter cloacae (Enterobacter cloacae) the SDM09 bacterial strain that the method by embodiment 4 is obtained, the inoculum size that the volume ratio of take is 5% is inoculated in the fermention medium that contains 80 grams per liter glucose and 50 mg/litre sulphuric acid kanamycins, at 30 ℃, pH6.0,400rpm, 1.0vvm air flow condition bottom fermentation.In fermentation, every 3 hours, sample, sample centrifugal 10 minutes with 8,000 * g, in detection supernatant, the concentration of (2R, 3R)-2,3-butanediol and glucose, adds glucose dry powder according to glucose concn, makes glucose concn maintain 20～50 grams per liters; Supernatant is carried out to the concentration that (2R, 3R)-2,3-butanediol in fermented liquid is measured in gas chromatographic analysis, when the concentration of (2R, 3R)-2,3-butanediol no longer increases, stop fermentation.
After 52 hours, detected result shows: the concentration of (2R, 3R)-2,3-butanediol reaches 155.0 grams per liters.
Claims (2)
1. a strain gene engineering bacterium, it is characterized in that: described genetic engineering bacterium is genetically engineered enterobacter cloacae, this bacterium called after enterobacter cloacae (Enterobacter cloacae) SDM09, it has been preserved on May 7th, 2014, and " Chinese Typical Representative culture collection " center ", preserving number is: CCTCC NO:M2014186.
2. described in claim 1, genetic engineering bacterium is utilizing ligno-cellulose hydrolysate to produce the application in (2R, 3R)-2,3-butanediol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314730.9A CN104046586B (en) | 2014-07-02 | 2014-07-02 | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314730.9A CN104046586B (en) | 2014-07-02 | 2014-07-02 | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104046586A true CN104046586A (en) | 2014-09-17 |
| CN104046586B CN104046586B (en) | 2016-08-17 |
Family
ID=51499986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314730.9A Active CN104046586B (en) | 2014-07-02 | 2014-07-02 | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104046586B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560848A (en) * | 2014-10-20 | 2015-04-29 | 南京工业大学 | Genetically engineered bacteria realizing high-density fermentation co-production of 2,3-butanediol as well as construction method and application thereof |
| CN104593310A (en) * | 2015-01-07 | 2015-05-06 | 山东大学 | Special bacillus licheniformis engineering bacteria for producing meso-2,3-butanediol and application thereof |
| CN108570440A (en) * | 2018-03-23 | 2018-09-25 | 山东大学深圳研究院 | One plant of recombination bacillus coli and its application in producing optical voidness meso-2,3- butanediols |
| CN109554386A (en) * | 2018-12-17 | 2019-04-02 | 山东大学 | A kind of utilizing works Escherichia coli are using Corncob hydrolysate as the method for substrate high yield D- xylonic |
| CN111511919A (en) * | 2017-12-01 | 2020-08-07 | Gs 加德士 | Recombinant microorganism having ability to synchronously ferment mixed sugars and method for producing diol using same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011130725A2 (en) * | 2010-04-16 | 2011-10-20 | Myriant Technologies Inc | Production of organic acids from xylose rich hydrolysate by bacterial fermentation |
| CN102226159A (en) * | 2010-11-29 | 2011-10-26 | 山东大学 | Strain of Enterobacter cloacae and its application in the preparation of 2,3-butylene glycol |
| CN102666838A (en) * | 2009-11-18 | 2012-09-12 | 麦兰特公司 | Engineering microbes for efficient production of chemicals |
-
2014
- 2014-07-02 CN CN201410314730.9A patent/CN104046586B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102666838A (en) * | 2009-11-18 | 2012-09-12 | 麦兰特公司 | Engineering microbes for efficient production of chemicals |
| WO2011130725A2 (en) * | 2010-04-16 | 2011-10-20 | Myriant Technologies Inc | Production of organic acids from xylose rich hydrolysate by bacterial fermentation |
| CN102226159A (en) * | 2010-11-29 | 2011-10-26 | 山东大学 | Strain of Enterobacter cloacae and its application in the preparation of 2,3-butylene glycol |
Non-Patent Citations (6)
| Title |
|---|
| JINLEI TANG ET AL.: "Recruiting alternative glucose utilization pathways for improving succinate production", 《APPL MICROBIOL BIOTECHNOL》 * |
| QINGZHAO WANG ET AL.: "Expression of galactose permease and pyruvate carboxylase in Escherichia coli ptsG mutant increases the growth rate and succinate yield under anaerobic conditions", 《BIOTECHNOLOGY LETTERS》 * |
| YOUQIANGXU ET AL.: "Systematic metabolic engineering of Escherichia coli for high-yield production of fuel bio-chemical 2,3-butanediol", 《METABOLIC ENGINEERING》 * |
| 康振等: "好氧发酵生产琥珀酸工程菌株的构建", 《生物工程学报》 * |
| 张帜等: "芽胞杆菌发酵产2，3-丁二醇的研究进展及展望", 《生物加工过程》 * |
| 李全林: "《现代生物工程》", 31 December 2008, 南京：东南大学出版社 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560848A (en) * | 2014-10-20 | 2015-04-29 | 南京工业大学 | Genetically engineered bacteria realizing high-density fermentation co-production of 2,3-butanediol as well as construction method and application thereof |
| CN104560848B (en) * | 2014-10-20 | 2018-10-30 | 南京工业大学 | A kind of genetic engineering bacterium that realizing high density fermentation co-production 2,3- butanediols and its construction method and application |
| CN104593310A (en) * | 2015-01-07 | 2015-05-06 | 山东大学 | Special bacillus licheniformis engineering bacteria for producing meso-2,3-butanediol and application thereof |
| CN111511919A (en) * | 2017-12-01 | 2020-08-07 | Gs 加德士 | Recombinant microorganism having ability to synchronously ferment mixed sugars and method for producing diol using same |
| CN111511919B (en) * | 2017-12-01 | 2024-01-12 | Gs 加德士 | Recombinant microorganism having mixed sugar synchronous fermentation ability and method for producing diol using the same |
| CN108570440A (en) * | 2018-03-23 | 2018-09-25 | 山东大学深圳研究院 | One plant of recombination bacillus coli and its application in producing optical voidness meso-2,3- butanediols |
| CN109554386A (en) * | 2018-12-17 | 2019-04-02 | 山东大学 | A kind of utilizing works Escherichia coli are using Corncob hydrolysate as the method for substrate high yield D- xylonic |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104046586B (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Hydrogen production from cellulose by co-culture of Clostridium thermocellum JN4 and Thermoanaerobacterium thermosaccharolyticum GD17 | |
| Dhaliwal et al. | Enhanced ethanol production from sugarcane juice by galactose adaptation of a newly isolated thermotolerant strain of Pichia kudriavzevii | |
| Sheng et al. | Direct hydrogen production from lignocellulose by the newly isolated Thermoanaerobacterium thermosaccharolyticum strain DD32 | |
| Wang et al. | Efficient L-lactic acid production from sweet sorghum bagasse by open simultaneous saccharification and fermentation | |
| CN104046586A (en) | Genetically engineered bacteria and application of genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol | |
| CN102226159B (en) | Strain of Enterobacter cloacae and its application in the preparation of 2,3-butylene glycol | |
| CN102373230A (en) | Nucleotide sequence of Clostridium D-tagatose 3-epimerase and application thereof | |
| CN102174433A (en) | Clostridium beijerinckii with high stress resistance and application thereof | |
| CN101475914B (en) | Method for producing oligo-galactose by cyclic utilization of recombinant Saccharomyces cerevisiae | |
| CN103952326B (en) | The recombinant pichia yeast strain of a kind of coexpression alantin excision enzyme and restriction endonuclease and construction method and application | |
| CN109554386A (en) | A kind of utilizing works Escherichia coli are using Corncob hydrolysate as the method for substrate high yield D- xylonic | |
| CN100558884C (en) | A kind of acid-producing Klebsiella bacterium and application thereof | |
| CN105062938A (en) | Engineering bacterium capable of producing D-lactate by aid of pentose and hexose synchronously by means of fermentation, and fabrication and application of engineering bacterium | |
| CN111088177B (en) | Construction and application of heat-resistant yeast engineering bacteria for producing glycerol under high-temperature aerobic condition | |
| CN101597627B (en) | Production method of high molecular poly (gamma-glutamic acid) | |
| CN105274041B (en) | One plant of recombination bacillus coli and its application in production 2- butanol | |
| Dai et al. | Bioconversion of inulin to 2, 3-butanediol by a newly isolated Klebsiella pneumoniae producing inulinase | |
| CN104789586A (en) | Escherichia coli genome integration vector, genetically engineered bacterium and application of genetically engineered bacterium to xylitol production | |
| CN103805551A (en) | Genetically engineered bacterium for producing meso-2, 3-butanediol and application of genetically engineered bacterium | |
| CN105062907A (en) | Building and application of engineered strains capable of producing xylitol and ethanol at high temperature simultaneously with high yield | |
| CN102936576B (en) | A kind of Xylitol genetic engineering bacterium and mixing thereof transform the method for producing Xylitol | |
| CN106929425B (en) | High-temperature-resistant acidic thermoascus thermophilus cellulase, and preparation method and application thereof | |
| US20230053729A1 (en) | A recombinant filamentous fungus for producing ethanol and its construction and application | |
| CN103421698B (en) | Construction and application of high-temperature high-yield xylitol engineering strains | |
| CN105177034A (en) | Gene engineering bacterium and application using same to prepare 2,3-butylene glycol from glycerin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |