CN104560848B

CN104560848B - A kind of genetic engineering bacterium that realizing high density fermentation co-production 2,3- butanediols and its construction method and application

Info

Publication number: CN104560848B
Application number: CN201410559814.9A
Authority: CN
Inventors: 纪晓俊; 刘陆罡; 黄和; 童颖佳; 沈梦秋; 聂志奎
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2014-10-20
Filing date: 2014-10-20
Publication date: 2018-10-30
Anticipated expiration: 2034-10-20
Also published as: CN104560848A

Abstract

The invention discloses a kind of genetic engineering bacterium for realizing high density fermentation co-production 2,3-butanediol and its construction method and application, the genetic engineering bacterium is by three key genes in 2,3-butanediol route of synthesis：α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and 2,3- butanediol dehydrogenation enzyme coding genes are integrated into built-up on escherichia coli chromosome, the strain fermentation byproduct in process object acetic acid is reduced, so that it can realize high density fermentation, the 2,3-butanediol of co-production high added value；In addition, invention additionally discloses a kind of other compounds of realization high density fermentation co-production and 2,3- butanediols genetic engineering bacterium and application, in addition to energy high density fermentation production 2,3-butanediol, moreover it is possible to coproduction poly-hydroxy fatty acid or functional protein, to realize poly-hydroxy fatty acid or functional protein, with 2,3-butanediol low cost, efficient coproduction, there is important industrial application value.

Description

A kind of genetic engineering bacterium and its structure for realizing high density fermentation co-production 2,3- butanediols Construction method and application

Technical field

The invention belongs to technical field of biochemical industry, and in particular to a kind of realization Escherichia coli high density fermentation co-production 2, The genetic engineering bacterium and its construction method of 3- butanediols and application.

Background technology

Escherichia coli are used for industrial bacterial strain as first, and simple in structure by its, genetic background is clear, hold The features such as easily culture, the speed of growth is fast, and target gene expression is high, and cultivation cycle is short, and contamination resistance is strong, has become at present The most commonly used prokaryotic expression system.As the research of metabolic engineering and field of fermentation engineering deepens continuously, Escherichia coli are utilized The high molecular polymer of a variety of high added values of fermenting and producing, such as polyhydroxyalkanoates and various functions albumen, such as protease, pancreas islet Element, human-like collagen etc. are widely used.

Concentration cultivation technology (high cell density cultivation, HCDC), i.e. high density fermentation skill Art, in particular under certain condition and cultivating system improves the fermentation density of thalline using certain culture technique and device, So that cell density is significantly increased compared with Nostoc commune Vanch, to obtain most cell concentrations, thus more or more efficiently obtains Purpose product, the zymotechnique of the final specific production rate for improving product.Compared with traditional zymotic technique, high density fermentation not only may be used To reduce volume of culture, strengthen downstream separation extraction, the production cycle can also be shortened, reduce equipment investment, to reduce production Cost improves production efficiency, realizes large-scale industrial production.

With the development of technique for gene engineering and High Density Cultivation technology, high molecular polymer with high added value, again The yield and yield of histone increase substantially, and fermentation costs substantially reduce, this is produced for recombination bacillus coli large scale fermentation Provide more wide foreground.However in recombination engineering foreign gene high level expression, be directed not only to host, carrier Correlation between clone gene three, it is also closely bound up with the environmental condition residing for host strain, influence growth and outer There are many factor of source approach expression, including pass oxygen limited ability, and substrate inhibits, and metabolic by-product inhibits etc..Wherein Metabolic byproducts The inhibiting effect of object acetic acid is the most important problem that high-density cultivation of Escherichia coli is faced.The accumulation of acetic acid not only limits The growth of thalline can also inhibit the synthesis of product, and the formation of acetic acid can also cause the loss of carbon source and then reduce substrate turn Rate.Excessively high acetic acid concentration will destroy the stability of intracellular protein, make intracellular protein and DNA that irreversible degradation occur, from And cause cell cracking dead.

In using Escherichia coli fermentation production process, the generation of acetic acid is mainly due to the following aspects.First, big In enterobacteria, glycolytic pathway and TCA cycles can generate co-factor NADH, and under conditions of supplying oxygen sufficient, NADH can be complete Total oxygen turns to NAD⁺.However, when the synthesis speed of wear rate, that is, NADH of glucose has been more than that Escherichia coli take the photograph the oxygen upper limit, NADH will start largely to accumulate.NADH is the specificity allosteric inhibitor of citrate synthetase, can limit acetyl coenzyme A and Oxaloacetic acid generates citric acid；Meanwhile it can also inhibit the ArcA regulating systems of several genes in TCA cycles by intracellular redox The influence of state, so that acetic acid largely accumulates in fermentation process.Secondly, in recombination bacillus coli process of high-density fermentation In, it will produce acetic acid when for hypoxgia or too fast cell growth.In the case of oxygen supply abundance, the formation speed of acetic acid Rate is related with the specific growth rate of cell and cell oxygen uptake rate to the generation of acetic acid.In Bacillus coli cells growth course, with The raising of specific growth rate, oxygen uptake rate accordingly increases, and when specific growth rate reaches certain value, the oxygen uptake capacity of cell reaches To the upper limit, even if oxygen supply is abundant, the oxygen uptake rate of cell will not increase again, to as in growth course it is restricted because Element leads to the generation of acetic acid.In addition, in process of high-density fermentation, Escherichia coli quickly consume using grape it is glycogenetic compared with More intermediates cannot be used for cell growth and product expression in time, and excessive carbon source accumulation leads to the acetyl coenzyme A in TCA cycles It is converted into acetic acid.

Scholars have significantly pushed the development of zymotechnique for the research that acetic acid inhibits in recent decades.It is big in recombination In enterobacteria process of high-density fermentation, for will produce acetic acid when hypoxgia or too fast cell growth；Sufficient in oxygen supply In the case of, the synthesis speed of acetic acid is directly related with cell growth rate；Meanwhile the growth rate of culture is by restricted substrate Feed rate determine, so acetic acid synthesis speed is also directly related with feed rate.In early days, people are by changing culture medium group Point, reduce specific growth rate, Dialysis culture, the optimization fermentation process such as limiting glucose concentration to reduce the formation of acetic acid.So And the optimization of nutrient media components can only slow down the negative effect that acetic acid expresses purpose product, can not reduce the accumulation of acetic acid, and And the change of component often increases cost, and adverse effect is also will produce to downstream purification process；Although reducing specific growth rate Acetic acid can be made to reduce, but also can delay the growth of cell that fermentation period is caused to extend simultaneously；Dialysis culture method is palliative, Partial medium can be also lost during removing acetic acid in the formation that can not avoid acetic acid.

With the continuous maturation of technique for gene engineering and metabolic engineering technology, regulate and control work in gene level using Molecular tools The metabolism of journey bacterium is widely used to control yield of acetic acid.Control acetic acid, which generates the genetic manipulation strategy used, can usually divide It is three kinds：The first strategy is generated by controlling the consumption of glucose to control acetic acid, due to the size of glucose consumption rate It is directly related with acetic acid generation, glucose uptake rate can be controlled to directly control acetic acid life by knocking out related gene cluster At.Second of strategy flows to acetic acid generation or be catalyzed carbon source to generate for cut-out carbon source poisons smaller substance, and the strategy is main It to be generated by the knockout of the metabolic pathway key gene to leading to acetic acid generation in glycolysis and TCA cycles to reduce acetic acid. A kind of last strategy is to reduce the metabolic pathway for potentially resulting in acetic acid generation, such as by reducing the accumulation of intracellular NADH, is come Reduce the generation of acetic acid.

Invention content

The purpose of the present invention is to provide a kind of genetic engineering bacterium for realizing high density fermentation co-production 2,3-butanediol, When using it using glucose as fermenting substrate, the metabolic fluxes for flowing to acetate pathway originally can be consumed and to generate toxicity extremely low Neutral products 2,3-butanediol, thus the acetic acid generated greatly reduces, simultaneously as big in 2,3-butanediol building-up process The NADH of amount is consumed, and further reduces the generation of acetic acid, to dramatically alleviate influence of the acetic acid inhibition to fermentation, So as to realize the high density fermentation of more high-biomass, while also coproduction height adds 2,3-butanediol.

Another object of the present invention is to provide a kind of above-mentioned realization Escherichia coli high density fermentation co-production 2,3- of structure The method of the genetic engineering bacterium of butanediol.

In order to achieve the object of the present invention, a kind of realization high density fermentation co-production 2,3-butanediol genetic engineering Bacterium is by three in 2,3-butanediol route of synthesis crucial enzyme coding genes：α-acetolactate synthestase encoding gene, α-acetyl Lactic acid decarboxylase encoding gene and 2,3-butanediol dehydrogenase coding genes are integrated on escherichia coli chromosome, built-up Recombinant bacterium.

The 2,3- butanediol dehydrogenation enzyme coding genes are (R, R) -2,3- butanediol dehydrogenations enzyme coding gene or meso- 2,3- butanediol dehydrogenation enzyme coding genes.

The construction method of said gene engineering bacteria includes specific steps：

1) α-acetolactate synthestase encoding gene and alpha -acetolactate decarboxylase are expanded respectively from Friedlander's bacillus Encoding gene expands (R, R) -2,3-butanediol dehydrogenase coding genes from bacillus subtilis, recycles Overlap extension PCR skill Art by above three genetic fragment according to α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene, (R, R) sequential concatenation of -2,3- butanediol dehydrogenations enzyme coding gene assembles to obtain α-acetolactate synthestase encoding gene, α-acetyl Three Gene Fusion segments of lactic acid decarboxylase encoding gene and (R, R) -2,3- butanediol dehydrogenation enzyme coding genes or directly from Friedlander's bacillus expands α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2, The operon gene segment of 3- butanediol dehydrogenation enzyme coding genes.

2) by two step methods of homologous recombination that α in step 1)-acetolactate synthestase encoding gene, α-acetolactic acid is de- Carboxylic encodes enzyme gene and three Gene Fusion segment of (R, R) -2,3- butanediol dehydrogenations enzyme coding gene or α-acetolactate synthestase The operon gene of encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2,3- butanediol dehydrogenation enzyme coding genes Segment is integrated into escherichia coli chromosome group.

Wherein, α-acetolactate synthestase encoding gene amplification obtained, alpha -acetolactate decarboxylase encoding gene, and Before the splicing of 2,3-butanediol dehydrogenase coding genes, first in α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase Encoding gene, (R, R) -2,3-butanediol dehydrogenase coding genes upstream introduce ribosome bind site respectively；Or directly exist α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2,3- butanediol dehydrogenase coding The operon gene segment upstream of gene introduces ribosome bind site.Said gene upstream is introduced corresponding ribosomes to combine Site can improve corresponding gene protein translation rate, to improve the expression quantity of destination protein, so that 2,3-BD production Amount is increased.

The two step methods of homologous recombination the specific steps are：

1) first passing through the technology of Overlap extension PCR, that the escherichia coli chromosome of PCR amplification knocked in site upstream sequence is same Segment, resistance screening marker gene, sucrose levanase gene and Escherichia coli dye of one section of source containing 500-1000 base Colour solid is knocked in one section of homologous segment containing 500-1000 base of site downstream sequence and is merged, and recombinant fragment 1 is obtained, then Recombinant fragment 1 is integrated into the knocking on site of genome of E.coli using the method for λ-Red homologous recombinations.

2) escherichia coli chromosome of PCR amplification is knocked in site upstream sequence homology by the method for first passing through over-lap PCR One section of segment containing 500-1000 base, α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene Three Gene Fusion segment of (R, R) -2,3- butanediol dehydrogenations enzyme coding gene or α-acetolactate synthestase encoding gene, α-second Acyl lactic acid decarboxylase encoding gene and meso-2, the operon gene segment and large intestine bar of 3- butanediol dehydrogenation enzyme coding genes Bacterium chromosome is knocked in one section of homologous segment containing 500-1000 base of site downstream sequence and is merged, and recombinant fragment is obtained 2 or recombinant fragment 3, recombinant fragment 2 or recombinant fragment 3 are replaced above-mentioned steps 1 by the method for reusing λ-Red homologous recombinations) in Recombinant fragment 1.

The resistance screening marker gene is chloramphenicol resistance gene, kalamycin resistance gene, gentamicin resistance One kind in gene, tetracycline resistance gene.

The escherichia coli chromosome knock in site be lactic dehydrogenase enzyme coding gene site or 16SrDNA gene locis, During by the relevant gene integration of 2,3-butanediol route of synthesis to Escherichia coli, lactic dehydrogenase enzyme coding gene position is selected Point is that escherichia coli chromosome knocks in site, and the relevant gene of lactic acid route of synthesis is destroyed, therefore, the gene work built During the fermentation, while acetic acid inhibition is eased, by-product lactic acid is also reduced journey bacterium.

Another object of the present invention is to provide a kind of method for realizing high density fermentation coproduction 2,3- butanediols.For solution Certainly this technical problem, the present invention are high density fermentation culture said gene engineering bacteria production 2,3-butanediols.

Wherein, high density fermentation culture seed culture medium (g/L) group becomes：Peptone 10；Yeast extract 5；NaCl 10；Hair Ferment culture medium (g/L) group becomes glucose 60-100；Yeast extract 0-40；K₂HPO₄·3H₂O 10.0-15.0；KH₂PO₄ 2.0- 6.0；(NH₄)₂HPO₄2.0-6.0；(NH₄)₂SO₄2.0-8.0；MgSO₄·7H₂O 0.1-0.3；FeSO₄·7H₂O 0.01- 0.1；ZnSO₄·7H₂O 0.01-0.1；MnSO₄·H₂O 0.01-0.1；CaCl₂0.01-0.1；EDTA 0.01-0.1.

Without mending alkali regulation and control zymotic fluid pH value in this high density fermentation incubation, corresponding fed-batch fermentation plan is simplified Slightly.

Another object of the present invention is to provide a kind of realization high density fermentation co-production poly-hydroxy fatty acid and 2,3- fourths Glycol genetic engineering bacterium.To solve the problems, such as this, the present invention in above-mentioned realization high density fermentation co-production poly-hydroxy fatty acid and 2, Exogenous plasmid is introduced in 3- butanediol genetic engineering bacteriums, the exogenous plasmid carries the dependency basis of poly-hydroxy fatty acid route of synthesis Cause.

The poly-hydroxy fatty acid is poly butyric ester or polyhydroxybutyrate valerate.

Another object of the present invention is to provide a kind of realization high density fermentation co-production poly-hydroxy fatty acid and 2,3- fourths Glycol process.To solve the problems, such as this, high density fermentation of the present invention realizes high density fermentation co-production poly-hydroxy fatty acid and 2,3- Butanediol gene engineering bacteria produces poly-hydroxy fatty acid and 2,3- butanediols.

Another object of the present invention is to provide a kind of realization high density fermentation co-production functional protein and 2,3- butanediols Genetic engineering bacterium.To solve the problems, such as this, the present invention is in above-mentioned realization high density fermentation co-production poly-hydroxy fatty acid and 2,3- Exogenous plasmid is introduced in butanediol genetic engineering bacterium, the exogenous plasmid carries the related gene of functional protein route of synthesis.

The functional protein is protease, interferon, insulin or human-like collagen.

Another object of the present invention is to provide a kind of realization high density fermentation co-production functional protein and 2,3- butanediols Method.To solve the problems, such as this, high density fermentation of the present invention realizes high density fermentation co-production functional protein and 2,3-butanediol base Because genetic engineering bacterium produces functional protein and 2,3- butanediols.

Beneficial effects of the present invention：

1, genetic engineering bacterium provided by the invention, by the related gene of the external source 2,3-butanediol route of synthesis of man-made assembly It is integrated on escherichia coli chromosome, genetic engineering bacterium consumes during synthesizing 2,3-butanediol and flows to acetic acid way originally The metabolic fluxes of diameter generate the extremely low neutral products 2,3-butanediol of toxicity, greatly reduce acetic acid generation, simultaneously as 2, A large amount of NADH is consumed in 3- butanediol building-up processes, to which comprehensive alleviation acetic acid inhibits during the fermentation to large intestine bar High density fermentation, the compound 2,3-butanediol of co-production high added value are realized in the influence of bacterium.Additionally, due to the gene work Journey bacterium realizes high density fermentation, not only reduces volume of culture, strengthens downstream separation extraction, at the same also shorten the production cycle, It reduces equipment investment and further improves production efficiency to reduce production cost.

2, a kind of other compounds of realization high density fermentation co-production and 2,3- butanediol genetic engineerings that the present invention is built Bacterium, in addition to energy high density fermentation production 2,3-butanediol, moreover it is possible to coproduction poly-hydroxy fatty acid or functional protein, to realize poly- hydroxyl Base aliphatic acid or functional protein have important industrial application value with 2,3-butanediol low cost, efficient coproduction.

Specific embodiment

According to following embodiments, the present invention may be better understood.However, as it will be easily appreciated by one skilled in the art that real It applies content described in example to be only limitted to illustrate the present invention, without sheet described in detail in claims should will not be limited Invention.Biological material source in the present invention is as follows：

Friedlander's bacillus CICC10011 bacterial strains (are abbreviated as K.pneumoniae bacterial strains)：It is purchased from China Microbiological bacterium Kind collection；168 bacterial strain of bacillus subtilis (is abbreviated as B.subtilis bacterial strains)：It is purchased from Chinese industrial microorganism fungus kind guarantor Tibetan center；

Carrier pEASY-Blunt：Commercial vector is purchased from Beijing Quanshijin Biotechnology Co., Ltd；

Carrier pTrc99a：Commercial vector is purchased from the Shanghai bio tech ltd Bei Nuo；

Carrier pKD46：Commercial vector is purchased from the Shanghai bio tech ltd Bei Nuo；

pk18mobsacB：Commercial vector is purchased from the Shanghai bio tech ltd Bei Nuo；

Escherichia coli MG1655 bacterial strains (are abbreviated as E.coli bacterial strains)：It is purchased from the Shanghai bio tech ltd Bei Nuo；

Embodiment 1 realizes the structure of the genetic engineering bacterium of high density fermentation co-production (R, R) -2,3- butanediols

1, α-acetolactate synthestase encoding gene alsS, alpha -acetolactate decarboxylase gene code gene budA and (R, R) the clone of -2,3- butanediol dehydrogenations enzyme coding gene bdhA

(1) clone of α-acetolactate synthestase encoding gene alsS

AlsS gene orders design synthesis in the Friedlander's bacillus (K.pneumoniae) announced according to Genebank Primer：

P1：5'-GATATGGACAAACAGTATCCGGT-3'

P2：5'-GCGTTACAGAATCTGACTCAGAT-3'

Using the genomic DNA of K.pneumoniae CICC10011 as template, with primer P1 and P2, Takara high fidelity enzymesHS (Premix) PCR amplification alsS genes.

PCR reaction systems：25 μ L of HS (Premix), primer P10.3 μ L, primer P20.3 μ L, K.pneumoniae CICC10011 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 62 DEG C of 15s, 72 DEG C of 1min45s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section, then the segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1 μ L pEASY-Blunt carriers, 4 μ L purifying Segment afterwards, gently mixing；After 25 DEG C of reaction 20min, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C heat shock 30s, is immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.Take 200 μ L Bacterium solution applies the LB tablets containing ampicillin, and after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid containing ampicillin Medium culture, extraction positive colony plasmid send sequence verification, alsS sequencing results such as SEQ ID NO:Shown in 1, by what is obtained Recombinant plasmid is named as pEASY-Blunt-alsS.

Using recombinant plasmid pEASY-Blunt-alsS as template, with primer P3 and P4, Takara high fidelity enzymesThe splicing sequence 1 of HS (Premix) PCR amplifications genetic fragment containing alsS.

P3：5'-TAAGGAGGATATACATGATATGGACAAACAGTATCCGGT-3'

P4：5'-CATTCAGAGAGTGATTCATAGCGCGTTACAGAATCTGACTCAGAT-3'

PCR reaction systems：25 μ L of HS (Premix), primer P30.3 μ L, primer P40.3 μ L, pEASY- Blunt-alsS 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 61 DEG C of 15s, 72 DEG C of 1min45s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, after glue recovery purifying, 4 DEG C of storages are for use.It amplifies Sequence include the sites RBS, alsS gene orders and end and the homologous 23bp sequences in budA genes front end, alsS gene orders The sequence in the sites RBS of upstream such as SEQ ID NO:Shown in 2.

(2) clone of alpha -acetolactate decarboxylase gene code gene budA

BudA gene orders design synthesis in the Friedlander's bacillus (K.pneumoniae) announced according to Genebank Primer：

P5：5'-GCTATGAATCACTCTGCTGAATG-3'

P6：5'-GTCTTAACTTTCTACGGAACGGA-3'

Using the genomic DNA of K.pneumoniae CICC10011 as template, with primer P5 and P6, Takara high fidelity enzymesHS (Premix) PCR amplification budA genes.

PCR reaction systems：25 μ L of HS (Premix), primer P50.3 μ L, primer P60.3 μ L, K.pneumoniae CICC10011 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 57 DEG C of 15s, 72 DEG C of 50s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section, then the segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1 μ L pEASY-Blunt carriers, 4 μ L purifying Segment afterwards, gently mixing；After 25 DEG C of reaction 20min, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C heat shock 30s, is immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.Take 200 μ L Bacterium solution applies the LB tablets containing ampicillin, and after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid containing ampicillin Medium culture, extraction positive colony plasmid send sequence verification, budA sequencing results such as SEQ IDNO:Shown in 3, the weight that will obtain Group plasmid is named as pEASY-Blunt-budA

Using recombinant plasmid pEASY-Blunt-budA as template, with primer P7 and P8, Takara high fidelity enzymesHS (Premix) PCR amplifications genetic fragment containing bdhA splices sequence 2.

P7:5’-ATCTGAGTCAGATTCTGTAACGCTAAGGAGGATATACATGCTATGAATCACTCTGCTGAATG- 3’

P8：5'-TGCCATCTTGCTGCCTTCATGCGTCTTAACTTTCTACGGAACGGA-3

PCR reaction systems：25 μ L of HS (Premix), primer P70.3 μ L, primer P80.3 μ L, pEASY- Blunt-alsS 0.4 μ L, ddH₂O 24μL。

PCR product is detected with 0.8% agarose gel electrophoresis, after glue recovery purifying, 4 DEG C of storages are for use.It amplifies AlsS genetic fragments include front end with the homologous 23bp sequences of alsS gene ends, RBS binding sites, budA gene orders and End and the homologous 22bp sequences in bdhA genes front end.The sequence of the RBS binding sites of budA gene orders upstream such as SEQ ID NO:Shown in 4.

(3) clone of (R, R) -2,3- butanediol dehydrogenation enzyme coding genes bdhA

BdhA gene orders design synthetic primer in the bacillus subtilis (B.subtilis) announced according to Genebank：

P9：5'-GCATGAAGGCAGCAAGATGGCA-3'

P10：5'-CGTTAGTTAGGTCTAACAAGGAT-3'

Using the genomic DNA of B.subtilis 168 as template, with primer P9 and P10, Takara high fidelity enzymesHS (Premix) PCR amplification bdhA genes.

PCR reaction systems：25 μ L of HS (Premix), primer P90.3 μ L, primer P100.3 μ L, K.pneumoniae CICC10011 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 1min10s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section, then the segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1 μ L pEASY-Blunt carriers, 4 μ L purifying Segment afterwards, gently mixing；After 25 DEG C of reaction 20min, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C heat shock 30s, is immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.Take 200 μ L Bacterium solution applies the LB tablets containing ampicillin, and after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid containing ampicillin Medium culture, extraction positive colony plasmid send sequence verification, bdhA sequencing results such as SEQ ID NO:Shown in 5, by what is obtained Recombinant plasmid is named as pEASY-Blunt-bdhA.

Using recombinant plasmid pEASY-Blunt-bdhA as template, with primer P11 and P12, Takara high fidelity enzymesThe splicing sequence 3 of HS (Premix) PCR amplifications genetic fragment containing bdhA.

P11:5’-TCCGTTCCGTAGAAAGTTAAGACTAAGGAGGATATACATGCATGAAGGCAGCAAGATGGCA- 3’

P12：5'-CGTTAGTTAGGTCTAACAAGGAT-3'

PCR reaction systems：25 μ L of HS (Premix), primer P110.3 μ L, primer P120.3 μ L, pEASY- Blunt-bdhA 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 1min15s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, after glue recovery purifying, 4 DEG C of storages are for use.It amplifies Genetic fragment include front end and the homologous 23bp sequences of budA gene ends, the sites RBS and bdhA gene orders.BdhA genes The sites RBS of Sequences upstream such as SEQ ID NO:Shown in 6.

2, splice assembling tri- genetic fragment of alsS, budA and bdhA using over-lap PCR

To splice sequence 1, splicing sequence 2 with splicing 3 three gene of sequence as template, with primer P13 and P14, Takara high Fidelity enzymeHS (Premix) anastomosing and splicings sequence 1, splicing sequence 2 and splicing 3 three genetic fragment of sequence.

P13：5'-ACCTATTGACAATTAAAGGCTAAAATGCTATAATTCCACAAATCTAAGGAGGATATACATGA TATGG-3’

P14：5'-AAAAGGCCATCCGTCAGGATGGCCTTCTCGTTAGTTAGGTCTAACAAGGAT-3'

PCR reaction systems：25 μ L of HS (Premix), primer P130.3 μ L, primer P140.3 μ L, alsS 0.6 0.6 0.6 μ L of μ L, bdhA of μ L, bdhA, ddH₂O 22.6μL。

PCR conditions：98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 3min50s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.It amplifies AlsSbudAbdhA genetic fragments include：Promoter, alsSbudAbdhA, terminator.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section, then the segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1 μ L pEASY-Blunt carriers, 4 μ L purifying Segment afterwards, gently mixing；After 25 DEG C of reaction 20min, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C heat shock 30s, is immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.Take 200 μ L Bacterium solution applies the LB tablets containing ampicillin, and after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid containing ampicillin Medium culture, extraction positive colony plasmid send sequence verification, and sequencing result is correct, and obtained recombinant plasmid is named as pEASY-Blunt-alsSbudAbdhA。

3, alsSbudAbdhA is integrated into escherichia coli chromosome group by two step methods of homologous recombination.

(1) PCR amplification ldhA-1

Using Escherichia coli MG1655 genomes as template, with primer ldhA-1-S and ldhA-1-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site upstream sequence Segment and end and Cm-sacB front end homologous 22bp segment of homologous one section containing 996 bases are arranged, is named as ldhA-1。

ldhA-1-S：5'-AGTTCGCTGACTGTAAGTTGTTGCC-3'

ldhA-1-A：5'-TGCGAAGTGATCTTCCGTCACACCATACATAGTAAAGCCGGTCAGAC-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-1-S 0.3 μ L, primer ldhA-1-A 0.3 μ L, Escherichia coli MG1655 genome 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 62 DEG C of 15s, 72 DEG C of 1min are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, after Takara plastic recovery kit fragment purifications, in 4 DEG C storage is for use.

Segment ldhA-1 sequence verifications：The ldhA-1 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, one section of sequencing fragment result such as SEQ for containing 996 bases of lactic dehydrogenase enzyme coding gene site upstream sequence homology ID NO:Shown in 7.

Using Escherichia coli MG1655 genomes as template, with primer ldhA-2-S and ldhA-2-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site downstream sequence The 22bp segments for arranging segment and front end and Cm-sacB terminal homologous of homologous one section containing 975 bases, are named as ldhA-2。

ldhA-2-S：5'-GACAATTAACAGTTAACAAATAA TATCAGCGTACCCGTGATGCTAACT-3'

ldhA-2-A：5'-GTTCACCATTAGACAGTTTGCC-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-2-S 0.3 μ L, primer ldhA-2- A0.3 μ L, Escherichia coli MG1655 genome 0.4 μ L, ddH₂O 24μL。

Segment ldhA-2 sequence verifications：The ldhA-2 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, one section of homologous segment for containing 975 bases of lactic dehydrogenase enzyme coding gene site downstream sequence, sequencing result such as SEQ ID NO:Shown in 8.

(2) PCR amplification chloramphenicol riddled basins and sucrose levanase gene C m-sacB

Using plasmid pk18mobsacb as template, with primer Cm-sacB-S and Cm-sacB-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes：Front end and ldhA1 fragment ends are homologous 20bp sequences, Cm-sacB sequences, the sequence of end and the homologous 20bp in ldhA2 segments front end, are named as Cm-sacB.

Cm-sacB-S：5'-TTCAATAACGTCGACCTTGACGTGTGACGGAAGATCACTTCGCA-3'

Cm-sacB-A：5'-TTTCAGAATGCGCAGCATCGCTTATTTGTTAACTGTTAATTGTCCT-3'

Answer system：HS (Premix) 25 μ L, primer Cm-sacB-S 0.3 μ L, primer Cm-sacB-A0.3 μ L, Escherichia coli MG1655 genome 0.4 μ L, ddH₂O 24μL。

Answer condition：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 3min10s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.With 0.8% Agarose gel electrophoresis detect PCR product, it is for use in 4 DEG C of storages after Takara plastic recovery kit fragment purifications.

Segment Cm-sacB sequence verifications：The Cm-sacB segments purified are cloned on carrier pEASY-Blunt and are carried out Sequence verification.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；25 DEG C of reaction 20min Afterwards, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.Rapidly 250 μ L LB culture mediums are added, 200rpm, cultivates 1h by 37 DEG C.200 μ L bacterium solutions are taken to apply the LB tablets containing ampicillin, overnight After culture, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send survey Sequence is verified, Cm-sacB measurement results such as SEQ ID NO:Shown in 9.

(3) method for utilizing over-lap PCR builds recombinant fragment 1,

Using tri- gene of ldhA-1, Cm-sacB and ldhA-2 as template, with primer ldhA-1-S and ldhA-2-A, Takara High fidelity enzymeHS (Premix) merges tri- genetic fragment of ldhA-1, Cm-sacB and ldhA-2.

ldhA-1-S：5'-AAGGTCGACGTTATTGAAACC-3'

ldhA-2-A：5'-GTTCACCATTAGACAGTTTGCC-3'

Reaction system：HS (Premix) 25 μ L, primer ldhA-1-S 0.3 μ L, primer ldhA-2-A0.3 μ 0.6 μ L, ldhA-20.6 μ L of L, ldhA-10.6 μ L, Cm-sacB, ddH₂O 22.6μL。

PCR conditions：98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 4min30s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section is named as recombinant fragment 1, and in 4 DEG C of storages, is used for first time homologous recombination.

1 sequence verification of segment recombinant fragment：The segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, 50 μ L Trans1-T1 are added In competent cell, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.200 μ L bacterium solutions are taken to apply the LB tablets containing ampicillin, after being incubated overnight, 10 positives of picking Bacterium colony connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequence verification, sequencing result correct.

(4) plasmid pKD46 electrotransformations Escherichia coli MG1655.

1) Escherichia coli MG1655 Electroporation-competent cells make.The fresh Escherichia coli MG1655 single bacterium colonies of picking, It is inoculated in the 50mL LB culture medium 250mL shaking flasks containing ampicillin, 30 DEG C, 200rpm, shaken cultivation 14h.Take overnight training Foster object 1mL transfers in the 50mL LB culture mediums containing ampicillin, 30 DEG C, 200rpm, and culture to OD 600 is about 0.2 left The right side adds 1mL L-arabinoses to make its final concentration of 30mM.Continue 30 DEG C of 200rpm to cultivate to OD 600 to be about 0.5-0.6.It will It is thin that bacterial cultures as being quenched 15min in mixture of ice and water, with glycerine method prepares Escherichia coli MG1655 electrotransformation competence Born of the same parents.

2) plasmid pKD46 electrotransformations Escherichia coli MG1655.By 0.2cm Bio-Rad electric shock cups and Escherichia coli MG1655 Electroporation-competent cells are placed on ice.100 μ L competent cells are added 1.5 μ L plasmid pKD46, place 5min on ice.It will mix Close the electric shock cup that precooling is added in liquid, ice bath 10min.Using MicroPulser (Bio-Rad) electroporation apparatus, shock parameters are 2.5KV, 200 Ω, 25uF.It is rapidly added the LB culture mediums of 37 DEG C of heat preservations of 1mL after electric shock, mixed liquor is sucked out, is transferred to In the centrifuge tube of 1.5mL, 30 DEG C, 200rpm shaken cultivation 1h, the LB tablets containing ampicillin are applied.After being incubated overnight, choose 10 single bacterium colonies are taken, the 5mL LB liquid mediums containing ampicillin of transferring, the verification of upgrading grain is correctly.Picking one is correctly Bacterium colony is named as LG-01.

(5) 1 electrotransformation Escherichia coli LG-01 of recombinant fragment

1) Escherichia coli LG-01 Electroporation-competent cells make.The fresh Escherichia coli LG-01 single bacterium colonies of picking, connect Kind is in the 50mL LB culture medium 250mL shaking flasks containing ampicillin, 30 DEG C, 200rpm, shaken cultivation 14h.It takes and is incubated overnight Object 1mL transfers in the 50mL LB culture mediums containing ampicillin, 30 DEG C, 200rpm, and culture to OD 600 is about 0.2 or so, 1mL L-arabinoses are added to make its final concentration of 30mM.Continue 30 DEG C of 200rpm to cultivate to OD 600 to be about 0.5-0.6.By bacterium Culture prepares Escherichia coli LG-01 Electroporation-competent cells as 15min is quenched in mixture of ice and water, with glycerine method.

2) 1 electrotransformation Escherichia coli LG-01 of recombinant fragment.By 0.2cm Bio-Rad electric shock cups and Escherichia coli LG-01 electricity Transformed competence colibacillus cell is placed on ice.100 μ L competent cells are added 1.5 μ L recombinant fragments 1, place 5min on ice.It will mixing The electric shock cup of precooling, ice bath 10min is added in liquid.Using MicroPulser (Bio-Rad) electroporation apparatus, shock parameters are 2.5KV, 200 Ω, 25uF.It is rapidly added the LB culture mediums of 30 DEG C of heat preservations of 1mL after electric shock, mixed liquor is sucked out, is transferred to In the centrifuge tube of 1.5mL, 30 DEG C, 200rpm shaken cultivation 1h, the LB tablets containing ampicillin and chloramphenicol are applied.Training overnight After supporting, 10 single bacterium colonies of picking, the 5mL LB liquid mediums containing ampicillin and chloramphenicol of transferring carry Genomic PCR and test Card is correct (correct bacterium colony genomic amplified fragments size is in 3000bp or so).One correct bacterium colony of picking, is named For LG-02.

Verify primer：

Verification-S：5'-TGAATTTTTCAATATCGCCATAGCT-3'

Verification-A：5'-GGCTACTTTCTTCATTGTGGTTCTC-3'

PCR reaction systems：HS (Premix) 25 μ L, verification-S 0.3 μ L of 0.3 μ L, verification-A, large intestine bar Bacterium LG-02 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 3min are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.(6)PCR Expand homologous sequence ldhA-3, ldhA-4 and gene order alsSbudAbdhA

Using Escherichia coli MG1655 genomes as template, with primer ldhA-3-S and ldhA-3-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site upstream sequence Segment and end and alsSbdhAbdhA front end homologous 25bp segment of homologous one section containing 996 bases are arranged, is named For ldhA-3.

ldhA-3-S：5'-CGTCAAGGTCGACGTTATTGAAACC-3'

ldhA-3-A：5'-TTTTAGCCTTTAATTGTCAATAGGT CGTCAAGGTCGACGTTATTGAAACC-3'PCR Reaction system：HS (Premix) 25 μ L, primer ldhA-3-S 0.3 μ L, primer ldhA-3-A0.3 μ L, large intestine bar Bacterium MG1655 genomes 0.4 μ L, ddH₂O 24μL。

Segment ldhA-3 sequence verifications：The ldhA-3 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, sequencing result are correct.

Using Escherichia coli MG1655 genomes as template, with primer ldhA-4-S and ldhA-4-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site downstream sequence The 22bp segments for arranging segment and front end and alsSbdhAbdhA terminal homologous of homologous one section containing 975 bases, are named For ldhA-4.

ldhA-4-S：5'-CCATCCTGACGGATGGCCTTTTACCTATTGACAATTAAAGGCTAAAATGC-3'

ldhA-4-A：5'-AAAAGGCCATCCGTCAGGATGG-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-4-S 0.3 μ L, primer ldhA-4- A0.3 μ L, Escherichia coli MG1655 genome 0.4 μ L, ddH₂O 24μL。

Segment ldhA-4 sequence verifications：The ldhA-4 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, sequencing result are correct.

Using plasmid pEASY-Blunt-alsSbudAbdhA as template, with primer alsSbudAbdhA-S with AlsSbdhAbdhA-A, Takara high fidelity enzymeHS (Premix) carries out PCR amplification, the segment packet amplified It includes：Front end and the homologous 25bp sequences of ldhA1 fragment ends, alsSbudAbdhA sequences, end and ldhA2 segments front end are homologous 25bp sequence, and be named as alsSbudAbdhA.

alsSbudAbdhA-S:5’-GGTTTCAATAACGTCGACCTTGACGACCTATTGACAATTAAAGGCTAAAAT GC-3’

alsSbdhAbdhA-A:

5 '-AGTTAGCATCACGGGTACGCTGATAAAAAGGCCATCCGTCAGGATGG-3 ' PCR reaction systems：HS (Premix) 25 μ L, primer alsSbudAbdhA-S 0.3 μ L, primer alsSbdhAbdhA-A0.3 μ L, greatly Enterobacteria MG1655 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 3min45s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

Segment alsSbudAbdhA sequence verifications：The alsSbudAbdhA segments purified are cloned into carrier pEASY- Sequence verification is carried out on Blunt.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；25 DEG C reaction 20min after, be added 50 μ L Trans1-T1 competent cells in, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on ice Upper 2min.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.200 μ L bacterium solutions are taken to apply containing ampicillin LB tablets, after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, positive gram of extraction Grand plasmid send sequence verification, sequencing result correct.

(7) Overlap extension PCR is utilized to build recombinant fragment 2

Using tri- gene of ldhA-3, alsSbudAbdhA and ldhA-4 as template, with primer ldhA-3-S and ldhA-4-A, Takara high fidelity enzymesHS (Premix) merges tri- genetic fragment of ldhA-3, alsSbudAbdhA and ldhA-4.

ldhA-3-S：5'-AGTTCGCTGACTGTAAGTTGTTGCC-3'

ldhA-4-A：5'-TCAGTTCACCATTAGACAGTTTGCC-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-3-S 0.3 μ L, primer ldhA-4- A0.3 μ L, ldhA-30.6 μ L, alsSbudAbdhA 0.6 μ L, ldhA-40.6 μ L, ddH₂O 22.6μL。

PCR conditions：98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 5min30s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section is named as recombinant fragment 2, and in 4 DEG C of storages, is used for second of homologous recombination.

2 sequence verification of segment recombinant fragment：The segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, 50 μ L Trans1-T1 are added In competent cell, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.200 μ L bacterium solutions are taken to apply the LB tablets containing ampicillin, after being incubated overnight, 10 positives of picking Bacterium colony connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequence verification, sequencing result correct.

(8) 2 electrotransformation Escherichia coli LG-02 of recombinant fragment

1) Escherichia coli LG-02 Electroporation-competent cells make.The fresh Escherichia coli LG-02 single bacterium colonies of picking, connect Kind is in the 50mL LB culture medium 250mL shaking flasks containing ampicillin, 30 DEG C, 200rpm, shaken cultivation 14h.It takes and is incubated overnight Object 1mL transfers in the 50mL LB culture mediums containing ampicillin, 30 DEG C, 200rpm, and culture to OD 600 is about 0.2 or so, 1mL L-arabinoses are added to make its final concentration of 30mM.Continue 30 DEG C of 200rpm to cultivate to OD 600 to be about 0.5-0.6.By bacterium Culture prepares Escherichia coli LG-02 Electroporation-competent cells as 15min is quenched in mixture of ice and water, with glycerine method.

2) 2 electrotransformation Escherichia coli LG-02 of recombinant fragment.By 0.2cm Bio-Rad electric shock cups and Escherichia coli LG-02 electricity Transformed competence colibacillus cell is placed on ice.100 μ L competent cells are added 1.5 μ L recombinant fragments 2, place 5min on ice.It will mixing The electric shock cup of precooling, ice bath 10min is added in liquid.Using MicroPulser (Bio-Rad) electroporation apparatus, shock parameters are 2.5KV, 200 Ω, 25uF.It is rapidly added the LB culture mediums of 37 DEG C of heat preservations of 1mL after electric shock, mixed liquor is sucked out, is transferred to In the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 3h, removal plasmid pKD46.Bacterium solution is transferred to 50mL and contains 10% sugarcane The salt-free LB liquid medium of sugar, 37 DEG C, after 200rpm shaken cultivations 18h, 10% salt-free LB solid mediums of dilution spread, 37 ℃12h.Picking single bacterium colony, proposing Genomic PCR verification, correctly (correct bacterium colony genomic amplified fragments size is on the left sides 3700bp It is right).One correct bacterium colony of picking, is named as LG-R.

Verify primer：

Verification-S：5'-TGAATTTTTCAATATCGCCATAGCT-3'

Verification-A：5'-GGCTACTTTCTTCATTGTGGTTCTC-3'

PCR reaction systems：HS (Premix) 25 μ L, verification-S 0.3 μ L of 0.3 μ L, verification-A, large intestine bar Bacterium LG-R genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 4min are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

2 high density fermentation of embodiment implements the genetic engineering bacterium in profit 1-recombination bacillus coli LG-R and produces (R, R)-2,3- Butanediol bacterial strain：Escherichia coli MG1655, Escherichia coli LG-R；

Seed culture medium (g/L)：Peptone 10；Yeast extract 5；NaCl 10.

Fermentation medium (g/L)：Glucose 80；K₂HPO₄·3H₂O 13.7；KH₂PO₄2.0；(NH₄)₂HPO₄3.3； (NH₄)₂SO₄6.6；MgSO₄·7H₂O 0.25；FeSO₄·7H₂O 0.05；ZnSO₄·7H₂O 0.01；MnSO₄·H₂O 0.01； CaCl₂0.01；EDTA 0.05.

Fermentation condition：

The preparation of seed liquor：The fresh LB liquid medium of the strain transfer of glycerol tube preservation, 37 DEG C, 200rpm activation 16h；The strain for connecing the activation of 1 ring lines the LB solid mediums with corresponding antibiotic, 37 DEG C of culture 12h；From fresh plate Upper picking single bacterium drops down onto in the 250mL triangular flasks equipped with 50mL seed culture mediums, 37 DEG C, cultivate 12h under the conditions of 200rpm, as First order seed；Primary seed solution is connected to another 50mL/250mL seed culture mediums, 37 DEG C, 200rpm with 5% inoculum concentration again Under the conditions of cultivate 12h, as secondary seed.

Ferment tank culture：When carrying out Batch fermentation using 5L fermentation tanks, with the inoculum concentration of 10% (v/v) by two level kind In sub- liquid access fermentation tank culture medium.When culture, 5L fermentation tank liquid amounts are 3L, and initial pH is 7.0；Ventilatory capacity and speed of agitator Respectively 1.5vvm, 400rpm.Fermentation time according to depending on specific experiment, be depleted using glucose or concentration no longer reduce as Fermentation termination.

Testing conditions：

Metabolite in fermentation process is measured using high performance liquid chromatography (HPLC).Japanese Shimadzu high performance liquid chromatography Instrument LC-20A, RID-10A differential refraction detector, Aminex HPX-87H chromatographic columns, column temperature are 65 DEG C, mobile phase 0.005M H₂SO₄, flow velocity 0.6mL/min.

As a result：

Escherichia coli MG1655 and recombination bacillus coli LG-R is measured in fermentation tank rank using high-efficient liquid phase chromatogram technique analysis Each product of section.Yield of acetic acid is up to 23.45g/L in original bacteria Escherichia coli MG1655, and the second in recombination bacillus coli LG-R Acid content only has 0.21g/L, and (R, R) -2,3-butanediol content then has 33.7g/L.

Example 3 realizes the structure of the genetic engineering bacterium of high density fermentation co-production meso-2,3- butanediols

1, α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2,3- fourth are expanded The operon gene segment alsSbudAbudC of glycol dehydrogenase coding genes

Using the genomic DNA of K.pneumoniae CICC10011 as template, with primer P15 and P16, Takara high-fidelities EnzymeHS (Premix) carries out PCR amplification, and the segment amplified includes：Promoter, the sites RBS, alsS, budA, BudC and terminator.

P15：5'-ACCTATTGACAATTAAAGGCTAAAATGCTATAATTCCACAAATCGGAGGATATACATATGAA TCATTCTGCTGAATG-3’

P16：5'-AAAAGGCCATCCGTCAGGATGGCCTTCTTTAGTTAAATACCATCCCGC-3'

PCR reaction systems：25 μ L of HS (Premix), primer P150.3 μ L, primer P160.3 μ L, K.pneumoniae CICC10011 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 3min30s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section, then the segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1 μ L pEASY-Blunt carriers, 4 μ L purifying Segment afterwards, gently mixing；After 25 DEG C of reaction 20min, it is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C heat shock 30s, is immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.Take 200 μ L Bacterium solution applies the LB tablets containing ampicillin, and after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid containing ampicillin Medium culture, extraction positive colony plasmid send sequence verification, alsSbudAbudC sequencing results such as SEQ ID NO:10, The gene order in the sites RBS of the upstreams alsSbudAbudC such as SEQ ID NO:Shown in 11, obtained recombinant plasmid is named as pEASY-Blunt-alsSbudAbudC。

2, alsSbudAbdhA is integrated into escherichia coli chromosome group by two step methods of homologous recombination

(1) PCR amplification homologous sequence ldhA-5, ldhA-6

Using Escherichia coli MG1655 genomes as template, with primer ldhA-5-S and ldhA-5-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site upstream sequence Fragment ends of homologous one section containing 996 bases and the homologous 25bp segments in the front ends alsSbdhAbdhA are arranged, is named as ldhA-5。

ldhA-5-S：5'-AGTTCGCTGACTGTAAGTTGTTGCC-3'

ldhA-5-A：5'-AACCTTTCAGAATGCGCAGCATCGCCGTCAAGGTCGACGTTATTGAAACC-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-5-S 0.3 μ L, primer ldhA-5- A0.3 μ L, Escherichia coli MG1655 genome 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 62 DEG C of 15s, 72 DEG C of 30s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

Segment ldhA-5 sequence verifications：The ldhA-5 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, sequencing result are correct.

Using Escherichia coli MG1655 genomes as template, with primer ldhA-6-S and ldhA-6-A, Takara high fidelity enzymesHS (Premix) carries out PCR amplification, and the segment amplified includes lactic dehydrogenase enzyme coding gene site downstream sequence The 20bp segments for arranging segment and front end and Cm-sacB terminal homologous of homologous one section containing 975 bases, are named ldhA- 6.ldhA-6-S：5'-GCGGGATGGTATTTAACTAATATCAGCGTACCCGTGATGCTAACT-3'ldhA-6-A：5'- TCAGTTCACCATTAGACAGTTTGCC-3 ' PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-6-S 0.3 μ L of 0.3 μ L, primer ldhA-6-A, Escherichia coli MG1655 genomes 0.4 μ L, ddH₂O 24μL。

Segment ldhA-6 sequence verifications：The ldhA-6 segments purified are cloned on carrier pEASY-Blunt and are surveyed Sequence is verified.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, It is added in 50 μ L Trans1-T1 competent cells, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.It is rapid to add Enter 250 μ L LB culture mediums, 200rpm, cultivates 1h by 37 DEG C.It takes 200 μ L bacterium solutions to apply the LB tablets containing ampicillin, trains overnight After supporting, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequencing Verification, sequencing result are correct.

(2) amplification gene sequence alsSbudAbudC

Using plasmid pEASY-Blunt-alsSbudAbudC as template, with primer alsSbudAbudC-S with AlsSbudAbudC-A, Takara high fidelity enzymeHS (Premix) carries out PCR amplification, the segment packet amplified It includes：Front end and the homologous 25bp sequences of ldhA-5 fragment ends, alsSbudAbudC sequences, end and ldhA-6 segments front end are same The sequence of the 25bp in source, and it is named as alsSbudAbudC.

alsSbudAbudC-S：5'-GGTTTCAATAACGTCGACCTTGACG GGAGGATATACATATGAATCATTCT-3’

alsSbudAbudC-A：5'-AGTTAGCATCACGGGTACGCTGATATTAGTTAAATACCATCCCGC-3'

PCR reaction systems：HS (Premix) 0.3 μ L of 25 μ L, primer alsSbudAbudC-S, primer 0.3 μ L of alsSbudAbudC-A, Escherichia coli MG1655 genomes 0.4 μ L, ddH₂O 24μL。

PCR reaction conditions：98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 3min40s are recycled 30 times；72 DEG C of 7min, 4 DEG C of heat preservations.

Segment alsSbudAbudC sequence verifications：The alsSbudAbudC segments purified are cloned into carrier pEASY- Sequence verification is carried out on Blunt.Clone's system：1 μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；25 DEG C reaction 20min after, be added 50 μ L Trans1-T1 competent cells in, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on ice Upper 2min.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 37 DEG C.200 μ L bacterium solutions are taken to apply containing ampicillin LB tablets, after being incubated overnight, the positive bacterium colony of picking 10 connects the LB liquid medium culture containing ampicillin, positive gram of extraction Grand plasmid send sequence verification, sequencing result correct.

(3) overlap extension pcr is utilized to build recombinant fragment 3

Using tri- gene of ldhA-5, alsSbudAbudC and ldhA-6 as template, with primer ldhA-5-S and ldhA-6-A, Takara high fidelity enzymesHS (Premix) merges tri- genetic fragment of ldhA-5, alsSbudAbudC and ldhA-6, And it is named as recombinant fragment 3.

ldhA-5-S：5'-AGTTCGCTGACTGTAAGTTGTTGCC-3'

ldhA-6-A：5'-TCAGTTCACCATTAGACAGTTTGCC-3'

PCR reaction systems：HS (Premix) 25 μ L, primer ldhA-5-S 0.3 μ L, primer ldhA-6- 0.6 μ L, ldhA-60.6 μ L of A0.3 μ L, ldhA-50.6 μ L, alsSbudAbudC, ddH₂O 22.6μL。

PCR product is detected with 0.8% agarose gel electrophoresis, and purpose piece is purified using Takara plastic recovery kits Section is named as recombinant fragment 3, and in 4 DEG C of storages, is used for first time homologous recombination.

3 sequence verification of segment recombinant fragment：The segment of purifying is cloned on carrier pEASY-Blunt.Clone's system：1μ L pEASY-Blunt carriers, the segments of 4 μ L after purification, gently mixing；After 25 DEG C of reaction 20min, 50 μ LTrans1-T1 are added In competent cell, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice.250 μ L LB culture mediums are rapidly added, 200rpm, cultivates 1h by 30 DEG C.200 μ L bacterium solutions are taken to apply the LB tablets containing ampicillin, after being incubated overnight, 10 positives of picking Bacterium colony connects the LB liquid medium culture containing ampicillin, and extraction positive colony plasmid send sequence verification, sequencing result correct.

(4) 3 electrotransformation Escherichia coli LG-02 of recombinant fragment

2) 3 electrotransformation Escherichia coli LG-02 of recombinant fragment.By 0.2cm Bio-Rad electric shock cups and Escherichia coli LG-02 electricity Transformed competence colibacillus cell is placed on ice.100 μ L competent cells are added 1.5 μ L recombinant fragments 2, place 5min on ice.It will mixing The electric shock cup of precooling, ice bath 10min is added in liquid.Using MicroPulser (Bio-Rad) electroporation apparatus, shock parameters are 2.5KV, 200 Ω, 25uF.It is rapidly added the LB culture mediums of 37 DEG C of heat preservations of 1mL after electric shock, mixed liquor is sucked out, is transferred to In the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 3h, removal plasmid pKD46.Bacterium solution is transferred to 50mL and contains 10% sugarcane The salt-free LB liquid medium of sugar, 37 DEG C, after 200rpm shaken cultivations 18h, 10% salt-free LB solid mediums of dilution spread, 37 ℃12h.Picking single bacterium colony, proposing Genomic PCR verification, correctly (correct bacterium colony genomic amplified fragments size is on the left sides 3400bp It is right).One correct bacterium colony of picking, is named as LG-MS.

Verify primer：

Verification-S：5'-TGAATTTTTCAATATCGCCATAGCT-3'

Verification-A：5'-GGCTACTTTCTTCATTGTGGTTCTC-3'

PCR reaction systems：HS (Premix) 25 μ L, verification-S 0.3 μ L of 0.3 μ L, verification-A, large intestine bar Bacterium LG-MS genomes 0.4 μ L, ddH₂O 24μL。

4 high density fermentation of embodiment implements the genetic engineering bacterium in profit 3-recombination bacillus coli LG-MS and produces meso-2,3- Butanediol bacterial strain：Escherichia coli MG1655, Escherichia coli LG-MS；

Seed culture medium (g/L)：Peptone 10；Yeast extract 5；NaCl 10.

Fermentation medium (g/L)：Glucose 80, K₂HPO₄·3H₂O 13.7、KH₂PO₄ 2.0、(NH₄)₂HPO₄ 3.3、 (NH₄)₂SO₄6.6、MgSO₄·7H₂O 0.25、FeSO₄·7H₂O 0.05、ZnSO₄·7H₂O 0.01、MnSO₄·H₂O 0.01、 CaCl₂ 0.01、EDTA 0.05。

Fermentation condition：

Testing conditions：

As a result：

Escherichia coli MG1655 and recombination bacillus coli LG-R is measured in fermentation tank rank using high-efficient liquid phase chromatogram technique analysis Each product of section.Yield of acetic acid is up to 23.55g/L in original bacteria Escherichia coli MG1655, and the second in recombination bacillus coli LG-R Acid content only has 0.53g/L, and (meso) -2,3-butanediol content then reaches 26.5g/L.

Example 5：Realize the structure of the genetic engineering bacterium of high density fermentation coproduction PHB and (R, R) -2,3- butanediols

With plasmid pBHR68 (be recorded in document Spiekermann P, Rehm B H A, Kalscheuer R, Baumeister D,Steinbüchel A.A sensitive,viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds[J].Archives of microbiology,1999,171 (2):It is 73-80.) template, with 5 '-TACGAGCTC of primer (SacI) AAGGAGGATGGCGACCGGCAAACG-3 ' and primer 5'-CGCGGATCC (BamHI) CGGCAGGTCAGCCCATAT-3 ' amplifies PHB operon for synthesizing gene phbCAB, passes through After SacI and BamHI digestions processing, it is inserted into plasmid pTrcAlperO1 (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) and opens Between mover multicloning sites downstream, plasmid pTrcAlperO1-phbCAB is obtained.

Escherichia coli MG1655 and Escherichia coli LG-R Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-phbCAB distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-R.Electrotransformation method：By 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-phbCAB places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification, phbCAB gene orders such as SEQ ID NO:Shown in 12, it is big to obtain recombination engineering Enterobacteria MG1655/pTrcAlperO1-phbCAB and Escherichia coli LG-R/pTrcAlperO1-phbCAB.

Genetic engineering bacterium coproduction PHB in 6 high density fermentation embodiment 5 of embodiment and (R, R) -2,3- butanediols

Bacterial strain：Original bacteria Escherichia coli MG1655/pTrcAlperO1-phbCAB and recombination engineering Escherichia coli LG-R/ pTrcAlperO1-phbCAB：

Seed culture medium (g/L)：Peptone 10；Yeast extract 5；NaCl 10；Ampicillin 50mg/mL；

Fermentation medium (g/L)：Glucose 80；KH₂PO₄2.0；Na₂HPO₄1.0；(NH₄)₂HPO₄1.7；(NH₄)₂SO₄ 4；MgSO₄·7H₂O 0.25；FeSO₄·7H₂O 0.05；ZnSO₄·7H₂O 0.001；CoCl₂·6H₂O 0.2；H₃BO₃0.3； MnSO₄·H₂O 0.001；CaCl₂0.01；CuSO₄·5H₂O 0.01；NiCl·6H₂O 0.02；Ampicillin 50mg/mL. Fermentation condition：

Seed culture：The fresh LB liquid medium of the strain transfer of glycerol tube preservation, 37 DEG C, 200rpm activate 16h；It connects The strain of 1 ring activation lines the LB solid mediums with corresponding antibiotic, 37 DEG C of culture 12h；The picking from fresh plate Single bacterium drops down onto in the 250mL triangular flasks equipped with 50mL seed culture mediums, 37 DEG C, cultivate 12h under the conditions of 200rpm, as level-one kind Son；Primary seed solution is connected to another 50mL/250mL seed culture mediums with 5% inoculum concentration again, 37 DEG C, under the conditions of 200rpm 12h is cultivated, as secondary seed.

Fermented and cultured：

Original bacteria：By secondary seed solution with 5% inoculum concentration access 300mL/1000mL seed culture medium, 37 DEG C, 12h is cultivated under the conditions of 200rpm, is then transferred to equipped in 2.7L culture medium 5L automatic fermenters with 10% inoculum concentration.Training When supporting, the pH in thalli growth stage is maintained at 7.0, is adjusted with 20% ammonium hydroxide；PH is positively retained at when thalline accumulates PHB 6.8, it is adjusted with 10M KOH.Personal monitoring's glucose and sulphur ammonium concentration when thalli growth, make concentration of glucose>1%, ammonium Concentration>0.2%, and adjusted using 50% glucose solution and 25% ammonium sulfate solution in deficiency.Fermented and cultured 72h, at interval of 4h is sampled.

Recombination engineering：By secondary seed solution with 5% inoculum concentration access 300mL/1000mL seed culture medium, 37 DEG C, cultivate 12h under the conditions of 200rpm, be then transferred to equipped with 2.7L culture medium 5L automatic fermenters with 10% inoculum concentration In.When culture, the pH controls of thalline starting stage are 7.0, and pH is positively retained at 6.8 when thalline accumulates PHB.Personal monitoring's glucose With sulphur ammonium concentration, when thalli growth, make concentration of glucose>1%, ammonium concentration>0.2%, and 50% glucose is used in deficiency Solution and 25% ammonium sulfate solution are adjusted.Fermented and cultured 72h is sampled at interval of 4h.

1. detection method：

(1) acetic acid and (R, R) -2,3- butanediol detection methods：Japanese Shimadzu high performance liquid chromatograph LC-20A, RID- 10A differential refraction detectors, Aminex HPX-87H chromatographic columns.Column temperature is 65 DEG C, and mobile phase is 0.005M H₂SO₄, flow velocity is 0.6mL/min。

(2) PHB detection methods：It takes fermented sample 12000rpm to centrifuge 2min, collects sedimentation cell and be washed with distilled water 2 times Afterwards, 6000rpm centrifuges 10min and collects cell, and drying claims its dry weight.150 μ L, 98% sulfuric acid is added into the thalline of drying, boils After water-bath 60min, using 20% ammonium hydroxide tune pH to 2.5, then the membrane filtration through 0.22um utilizes HPLC (high-efficient liquid phase colors Spectrum) detection.This Shimadzu high performance liquid chromatograph LC-20A, detection column (C18, BioRadLabs)；1% formic acid makees mobile phase； UV detector (ultraviolet wavelength 210nm).

(3) cell concentration measures:Zymotic fluid is after the dilution of suitable multiple, with ultraviolet specrophotometer at λ=600nm Survey light absorption value, the cell concentration (OD600) with product, that is, zymotic fluid of extension rate.

(4) dry cell weight (DCW) measures:30mL zymotic fluids are taken, are collected by centrifugation, are discarded supernatant.Thalline is dried to perseverance in 105 DEG C Weight, it is dry cell weight to measure.

(5) glucose concentration determination：Take the zymotic fluid 1mL of moment in 1.5mL centrifuge tubes, at room temperature, 12000rpm centrifuges 2min, takes 100 μ L supernatants to 10mL volumetric flasks, 10mL is settled to Wahaha water, is then passed using biology Sensor measures the concentration of glucose in zymotic fluid, and the unit for measuring numerical value is g/L.

2. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 82.5g/L, recombination bacillus coli engineering bacteria reach 116.7g/L.Acetic acid is measured respectively with PHB original The accumulation of bacterium and recombination bacillus coli engineering bacteria intracellular.Yield of acetic acid is up to 20.95g/L in original bacteria, in recombinant bacterium Yield of acetic acid only has 0.54g/L；PHB reaches the 34.5% of dry cell weight in original bacteria, and it is dry to reach cell by PHB in recombinant bacterium 40.9%, the PHB yield of weight increases 18.5%.Also, (R, R) -2,3-butanediol yield of final coproduction reaches 27.5g/L.

Example 7 realizes the structure of the genetic engineering bacterium of high density fermentation coproduction human-like collagen and (R, R) -2,3- butanediols It builds

With plasmid pMDHLC (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) for template, with 5 '-TACGAGCTC of primer (SacI) 5 '-CGCGGATCC of ATGCTCCAGGGCACCTGCTCCGTGC-3 ' and primer (BamHI) TTAAGGGTCTTGCGAGGTCATTCTG-3 ' amplifies human-like collagen synthetic gene HLC, passes through SacI and BamHI enzymes After cutting processing, it is inserted into plasmid pTrcAlperO1 (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) more grams of promoter downstream Between grand site, plasmid pTrcAlperO1-HLC is obtained.

Escherichia coli MG1655 and Escherichia coli LG-R Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-HLC distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-R.Electrotransformation method：By 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-HLC places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification, HLC gene orders such as SEQ ID NO:Shown in 13, recombination engineering large intestine bar is obtained Bacterium MG1655/pTrcAlperO1-HLC and Escherichia coli LG-R/pTrcAlperO1-HLC.

Genetic engineering bacterium coproduction human-like collagen in 8 high density fermentation embodiment 7 of embodiment and (R, R) -2,3- fourths Glycol

Bacterial strain：Original bacteria Escherichia coli MG1655/pTrcAlperO1-HLC and recombination engineering Escherichia coli LG-R/ pTrcAlperO1-HLC。

Seed culture medium (g/L)：Peptone 10；Yeast extract 5；NaCl 10；Ampicillin 50mg/mL.

Fermentation medium (g/L)：Glucose 60；Yeast extract 60；K₂HPO₄·3H₂O 5.8；NaH₂PO₄3.6；(NH₄)₂HPO₄3.3；(NH₄)₂SO₄4.2；MgSO₄·7H₂O 2.0；FeSO₄·7H₂O 0.6；ZnSO₄·7H₂O 0.2；MnSO₄·H₂O 0.2；CaCl₂0.3；EDTA 0.8；Ampicillin 50mg/mL.

1. coproduction of fermenting

Fermentation condition：

Fermented and cultured：

Original bacteria：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L hairs Fermentation tank liquid amount is 3L, and cultivation temperature is 37 DEG C, and pH is automatically adjusted in 6.8 or so by 25% ammonium hydroxide.Wait for that glucose is i.e. in tank When will exhaust, start flow feeding culture medium, by changing speed of agitator, air mass flow and mending sugared rate, maintains than growth Rate (μ) is in 0.1~0.2h^-1Left and right, DO are 10%~40% saturation degree.After speed of agitator, air mass flow reach the upper limit, if Dissolved oxygen rapid increase then improves the sugared rate of benefit；The sugared rate of benefit is reduced if dissolved oxygen is less than setting value.Meanwhile being aided with pH feedbacks, i.e., When sugared concentration is too low, cell is using nitrogen source as carbon source, to release NH⁴⁺, so that zymotic fluid pH is increased, improve mend sugar speed at this time Rate maintains normal pH.

Recombination engineering：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L fermentation tank liquid amounts are 3L, and cultivation temperature is 37 DEG C, and initial pH controls are 6.8 or so.When glucose in tank will exhaust, Start flow feeding culture medium, by changing speed of agitator, air mass flow and mending sugared rate, specific growth rate (μ) is maintained to exist 0.1~0.2h^-1Left and right, DO are 10%~40% saturation degree.After speed of agitator, air mass flow reach the upper limit, if dissolved oxygen is quick Rising then improves the sugared rate of benefit；The sugared rate of benefit is reduced if dissolved oxygen is less than setting value.Meanwhile being aided with pH feedbacks, i.e., when sugared concentration When too low, cell is using nitrogen source as carbon source, to release NH⁴⁺, so that zymotic fluid pH is increased, improve mend sugared rate at this time, maintain Normal pH.

2. testing conditions

(2) human-like collagen detection method：10mL zymotic fluids are taken, is centrifuged, is discarded supernatant liquid, precipitation is washed with distilled water After washing 3 times, resuspension, ultrasonic disruption is measured with light proline determination method and is crushed human-like collagen content in supernatant.

3. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 60.8g/L, recombination bacillus coli engineering bacteria reach 91.5g/L.Acetic acid is measured respectively with collagen to exist Original bacteria and the intracellular accumulation of recombination bacillus coli engineering bacteria.Yield of acetic acid is up to 22.93g/L in original bacteria, in weight Yield of acetic acid only has 0.69g/L in group bacterium；Collagen production is 11.5g/L, the collagen in recombinant bacterium in original bacteria Yield reaches 16.9g/L, and collagen production increases 47.0%.Also, (R, R) -2,3-butanediol yield of final coproduction Up to 20.3g/L.

Example 9 realizes the structure of high density fermentation coproduction trehalose synthetase and (R, R) -2,3- butanediol genetic engineering bacteriums

With thermophilic sporangium T.fusca WSH03-11 (be recorded in document He G, Huo G, Liu L, Zhu Y, Du G, Chen J.Enhanced cutinase production of Thermobifida fusca by a two-stage batch and fed-batch cultivation strategy[J].Biotechnology and Bioprocess Engineering,2009,14(1):It is 46-51.) template, with 5 '-TACGAGCTC of primer (SacI) ACCACACAGCCGGCTCCT-3 ' and primer 5 '-CGCGGATCC (BamHI) CAGGACCGCTGGGTCGGGTCG-3 ' is amplified Trehalose synthetase gene TreS, after SacI and BamHI digestions processing, being inserted into plasmid pTrcAlperO1, (purchase is in river The triumphant Bioisystech Co., Ltd of Su Tian) between promoter multicloning sites downstream, obtain plasmid pTrcAlperO1-TreS.

Escherichia coli MG1655 and Escherichia coli LG-R Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-TreS distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-R.Electrotransformation method：By 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-TreS places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification, TreS gene orders such as SEQ ID NO:Shown in 14, recombination engineering large intestine is obtained Bacillus MG1655/pTrcAlperO1-TreS and Escherichia coli LG-R/pTrcAlperO1-TreS.

The genetic engineering bacterium coproduction trehalose synthetase and (R, R) -2,3- fourths two of 10 high density fermentation embodiment 9 of embodiment Alcohol

Bacterial strain：Original bacteria Escherichia coli MG1655/pTrcAlperO1-TreS and recombination engineering Escherichia coli LG-R/ pTrcAlperO1-TreS：

Seed culture medium (g/L)：Peptone 10；Yeast powder 5；NaCl 10；Ampicillin 50mg/mL；

Fermentation medium (g/L)：Glucose 70；KH₂PO₄1.0；Na₂HPO₄3.8；(NH₄)₂HPO₄2.2；(NH₄)₂SO₄ 3.6；MgSO₄·7H₂O 0.3；FeSO₄·7H₂O 0.1；ZnSO₄·7H₂O 0.001；CoCl₂·6H₂O 0.1；H₃BO₃0.1； MnSO₄·H₂O 0.01；CaCl₂0.01；CuSO₄·5H₂O 0.01；NiCl·6H₂O 0.01；Ampicillin 50mg/mL. Fermentation condition：

High density fermentation：

Original bacteria：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L hairs Fermentation tank liquid amount is 3L, and 37 DEG C of fermentation temperature makes the holding of dissolved oxygen percentage be not less than by adjusting speed of agitator and air velocity 20%.PH is controlled by Feeding ammonia water 7.0 or so.After batch culture 8h, fed-batch cultivation is carried out.With constant flow velocity, (stream adds Rate is 80mL/h), stream plus 80% glucose.

Recombination engineering：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L fermentation tank liquid amounts are 3L, and 37 DEG C of fermentation temperature, initial pH controls are 7.0 or so.By adjusting speed of agitator and air stream Speed makes dissolved oxygen percentage keep being not less than 20%.After batch culture 8h, fed-batch cultivation is carried out.With constant flow velocity (stream rate of acceleration For 80mL/h), stream plus 80% glucose.

1. testing conditions

(2) trehalose synthetase detection method：Japanese Shimadzu high performance liquid chromatograph LC-20A, RID-10A differential refraction Detector, mobile phase ratio：Acetonitrile：Water=65:35, column temperature：30 DEG C, flow velocity：1.0mL/min.Run time 15min.

Conversion ratio measures：Maltose reaction solution dilutes 25 times and crosses sample introduction after film.

Conversion ratio calculates：

Wherein：For the peak area of trehalose after reaction；

For the peak area of maltose before reaction.

2. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 52.3g/L, recombination bacillus coli engineering bacteria reach 71.6g/L.Acetic acid is measured respectively to synthesize with trehalose Enzyme is in original bacteria and the intracellular accumulation of recombination bacillus coli engineering bacteria.Yield of acetic acid is up to 22.11g/L in original bacteria, Yield of acetic acid only has 0.66g/L in recombinant bacterium；Trehalose synthetase enzyme activity is 2720nmol/min in original bacteria, is being recombinated Trehalose synthetase enzyme activity is 3680nmol/min in bacterium, and trehalose synthetase enzyme activity improves 35.3%.Also, final coproduction (R, R) -2,3- butanediol yield reach 22.5g/L.

Embodiment 11 realizes the structure of the genetic engineering bacterium of high density fermentation coproduction PHB and meso-2,3- butanediol

With plasmid pBHR68 (be recorded in document Spiekermann P, Rehm B H A, Kalscheuer R, Baumeister D,Steinbüchel A.A sensitive,viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds[J].Archives of microbiology,1999,171 (2):It is 73-80.) template, with 5 '-TACGAGCTC of primer (SacI) AAGGAGGATGGCGACCGGCAAACG-3 ' and primer 5 '-CGCGGATCC (BamHI) CGGCAGGTCAGCCCATAT-3 ' amplifies PHB operon for synthesizing gene phbCAB, passes through After SacI and BamHI digestions processing, it is inserted into plasmid pTrcAlperO1 (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) and opens Between mover multicloning sites downstream, plasmid pTrcAlperO1-phbCAB is obtained.

Escherichia coli MG1655 and Escherichia coli LG-MS Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-phbCAB distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-MS.Electrotransformation method：It will 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-phbCAB places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification.It is verified correct, obtain recombination engineering Escherichia coli MG1655/ PTrcAlperO1-phbCAB and Escherichia coli LG-MS/pTrcAlperO1-phbCAB.

12 high density fermentation embodiment of example, 11 genetic engineering bacterium coproduction PHB and meso-2,3- butanediol

Strain：Original bacteria Escherichia coli MG1655/pTrcAlperO1-phbCAB and recombination engineering Escherichia coli LG- MS/pTrcAlperO1-phbCAB：

Fermentation medium (g/L)：Glucose 80；KH₂PO₄2.0；Na₂HPO₄1.0；NH₄)₂HPO₄1.7；(NH₄)₂SO₄ 4；MgSO₄·7H₂O 0.25；FeSO₄·7H₂O 0.05；ZnSO₄·7H₂O 0.001；CoCl₂·6H₂O 0.2；H₃BO₃0.3； MnSO₄·H₂O 0.001；CaCl₂0.01；CuSO₄·5H₂O 0.01；NiCl·6H₂O 0.02；Ampicillin 50mg/mL.

1. coproduction of fermenting

Fermented and cultured：

Recombination engineering：By secondary seed solution with 5% inoculum concentration access 300mL/1000mL seed culture medium, 37 DEG C, cultivate 12h under the conditions of 200rpm, be then transferred to equipped with 2.7L culture medium 5L automatic fermenters with 10% inoculum concentration In.When culture, thalline starting stage pH control pH at 7.0, thalline accumulation PHB is positively retained at 6.8.Personal monitoring's glucose and Sulphur ammonium concentration when thalli growth, makes concentration of glucose>1%, ammonium concentration>0.2%, and be with 50% glucose solution in deficiency It adjusts with 25% ammonium sulfate solution, fermented and cultured 72h, is sampled at interval of 4h.

2. testing conditions

(1) acetic acid and meso-2,3- butanediol detection methods：Japanese Shimadzu high performance liquid chromatograph LC-20A, RID-10A Differential refraction detector, Aminex HPX-87H chromatographic columns.Column temperature is 65 DEG C, and mobile phase is 0.005M H₂SO₄, flow velocity is 0.6mL/min。

(2) PHA detection methods：It takes fermented sample 12000rpm to centrifuge 2min, collects sedimentation cell and be washed with distilled water 2 times Afterwards, 6000rpm centrifuges 10min and collects cell, and drying claims its dry weight.150 μ L, 98% sulfuric acid is added into the thalline of drying, boils After water-bath 60min, using 20% ammonium hydroxide tune pH to 2.5, then the membrane filtration through 0.22um utilizes HPLC (high-efficient liquid phase colors Spectrum) detection.This Shimadzu high performance liquid chromatograph LC-20A, detection column (C18, BioRadLabs)；1% formic acid makees mobile phase； UV detector (ultraviolet waves are 210nm)

3. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 81.4g/L, recombination bacillus coli engineering bacteria reach 114.9g/L.Acetic acid is measured respectively with PHB original The accumulation of bacterium and recombination bacillus coli engineering bacteria intracellular.Yield of acetic acid is up to 21.16g/L in original bacteria, in recombinant bacterium Yield of acetic acid only has 0.79g/L, yield of acetic acid extremely low；PHB reaches the 33.5% of dry cell weight in original bacteria, in recombinant bacterium 39.6%, the PHB yield that PHB reaches dry cell weight increases 18.2%.Also, the meso-2 of final coproduction, the production of 3- butanediols Amount reaches 24.1g/L.

Example 13 realizes the structure of the genetic engineering bacterium of high density fermentation coproduction human-like collagen and meso-2,3- butanediols It builds

With plasmid pMDHLC (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) for template, with 5 '-TACGAGCTC of primer (SacI) 5 '-CGCGGATCC of ATGCTCCAGGGCACCTGCTCCGTGC-3 ' and primer (BamHI) TTAAGGGTCTTGCGAGGTCATTCTG-3 ' amplifies human-like collagen synthetic gene HLC, by SacI and BamHI digestions After processing, it is polyclonal to be inserted into plasmid pTrcAlperO1 (purchase is in Jiangsu Tian Kai Bioisystech Co., Ltd) promoter downstream Between site, plasmid pTrcAlperO1-HLC is obtained.

Escherichia coli MG1655 and Escherichia coli LG-MS Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-HLC distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-MS.Electrotransformation method：By 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-HLC places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification.It is verified correct, obtain recombination engineering Escherichia coli MG1655/ PTrcAlperO1-HLC and Escherichia coli LG-MS/pTrcAlperO1-HLC.

14 high density fermentation embodiment of example, 13 engineering bacteria fermentation coproduction human-like collagen and meso-2,3- fourths two Alcohol

Bacterial strain：The original bacteria Escherichia coli MG1655/pTrcAlperO1-HLC and equal Escherichia coli LG-MS/ of recombination pTrcAlperO1-HLC：

1. coproduction of fermenting

Fermentation condition：

Fermented and cultured：

2. testing conditions

3. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 61.1g/L, recombination bacillus coli engineering bacteria reach 88.9g/L.Acetic acid is measured respectively with collagen to exist Original bacteria and the intracellular accumulation of recombination bacillus coli engineering bacteria.Yield of acetic acid is up to 23.36g/L in original bacteria, in weight Yield of acetic acid only has 0.96g/L in group bacterium；Collagen production is 11.1g/L, the collagen in recombinant bacterium in original bacteria Yield reaches 16.3g/L, and collagen production increases 46.9%.Also, (meso) -2,3-butanediol yield of final coproduction Up to 17.2g/L.

Example 15 realizes the structure of the genetic engineering bacterium of high density fermentation coproduction trehalose synthetase and meso-2,3- butanediols It builds

With thermophilic sporangium T.fusca WSH03-11 (be recorded in document He G, Huo G, Liu L, Zhu Y, Du G, Chen J.Enhanced cutinase production of Thermobifida fusca by a two-stage batch and fed-batch cultivation strategy[J].Biotechnology and Bioprocess Engineering,2009,14(1):It is 46-51.) template, with 5 '-TACGAGCTC of primer (SacI) ACCACACAGCCGGCTCCT-3 ' and primer 5 '-CGCGGATCC (BamHI) CAGGACCGCTGGGTCGGGTCG-3 ' is amplified Trehalose synthetase gene TreS is inserted into plasmid pTrcAlperO1 and (derives from river after SacI and BamHI digestions processing The triumphant Bioisystech Co., Ltd of Su Tian) between promoter multicloning sites downstream, obtain plasmid pTrcAlperO1-TreS.

Escherichia coli MG1655 and Escherichia coli LG-MS Electroporation-competent cells are prepared respectively, by plasmid PTrcAlperO1-TreS distinguishes electrotransformation to Escherichia coli MG1655 and Escherichia coli LG-MS.Electrotransformation method：By 0.2cm Bio-Rad electric shock cups are placed on ice with Electroporation-competent cells.1.5 μ L plasmids are added in 100 μ L competent cells PTrcAlperO1-TreS places 5min on ice.Mixed liquor is added to the electric shock cup of precooling, ice bath 10min.It uses MicroPulser (Bio-Rad) electroporation apparatus, shock parameters 2.5KV, 200 Ω, 25uF.1mL 37 is rapidly added after electric shock DEG C heat preservation LB culture mediums, mixed liquor is sucked out, is transferred in the centrifuge tube of 1.5mL, 37 DEG C, 200rpm shaken cultivation 1h, apply LB tablets containing ampicillin.After being incubated overnight, 10 single bacterium colonies of picking, the 5mL LB liquid containing ampicillin of transferring Culture medium, the screening of upgrading grain, sequence verification.It is verified correct, obtain recombination engineering Escherichia coli MG1655/ PTrcAlperO1-TreS and Escherichia coli LG-MS/pTrcAlperO1-TreS.

The genetic engineering bacterium coproduction trehalose synthetase and meso-2,3- butanediols of 16 high density fermentation embodiment 15 of example

Bacterial strain：Original bacteria Escherichia coli MG1655/pTrcAlperO1-TreS and recombination engineering Escherichia coli LG-MS/ pTrcAlperO1-TreS：

Seed culture medium (g/L)：Peptone 10；Yeast powder 5；NaCl 10；Ampicillin 50mg/mL.

Fermentation medium (g/L)：Glucose 70；KH₂PO₄2.0；Na₂HPO₄3.8；(NH₄)₂HPO₄1.7；(NH₄)₂SO₄ 4；MgSO₄·7H₂O 0.25；FeSO₄·7H₂O 0.05；ZnSO₄·7H₂O 0.001；CoCl₂·6H₂O 0.2；H₃BO₃0.3； MnSO₄·H₂O 0.001；CaCl₂0.01；CuSO₄·5H₂O 0.01；NiCl·6H₂O 0.02；Ampicillin 50mg/L.

1. coproduction of fermenting

High density fermentation：

Original bacteria：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L hairs Fermentation tank liquid amount is 3L, and 37 DEG C of fermentation temperature makes the holding of dissolved oxygen percentage be not less than by adjusting speed of agitator and air velocity 20%.PH is controlled by Feeding ammonia water 7.0 or so.After batch culture 8h, fed-batch cultivation is carried out.With constant flow velocity, (stream adds Rate is 80mL/h) stream plus 80% glucose.

Recombination engineering：Secondary seed solution is accessed in fermentation tank culture medium with the inoculum concentration of 10% (v/v).When culture, 5L fermentation tank liquid amounts are 3L, and 37 DEG C of fermentation temperature, initial pH controls are 7.0 or so.By adjusting speed of agitator and air stream Speed makes dissolved oxygen percentage keep being not less than 20%.After batch culture 8h, fed-batch cultivation is carried out.With constant flow velocity (stream rate of acceleration For 80mL/h) stream plus 80% glucose.

2. testing conditions

Conversion ratio calculates：

Wherein：For the peak area of trehalose after reaction；

For the peak area of maltose before reaction.

3. result

The cell density of original bacteria and recombination bacillus coli engineering bacteria is measured respectively, and the highest cell density of original bacteria is The highest cell density of 51.4g/L, recombination bacillus coli engineering bacteria reach 70.9g/L.Acetic acid is measured respectively to synthesize with trehalose Enzyme is in original bacteria and the intracellular accumulation of recombination bacillus coli engineering bacteria.Yield of acetic acid is up to 22.38g/L in original bacteria, Yield of acetic acid only has 0.82g/L in recombinant bacterium, hardly produces acetic acid；Trehalose synthetase enzyme activity is in original bacteria 2680nmol/min, trehalose synthetase enzyme activity is 3650nmol/min in recombinant bacterium, and trehalose synthetase enzyme activity improves 36.1%.Also, the meso-2 of final coproduction, 3- butanediol yield reach 20.9g/L.

Claims

1. a kind of construction method of genetic engineering bacterium that realizing high density fermentation co-production 2,3-butanediol, it is characterised in that：It is real The genetic engineering bacterium of existing high density fermentation co-production 2,3- butanediols is to compile three key enzymes in 2,3- butanediol route of synthesis Code gene：α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and 2,3-butanediol dehydrogenase are compiled On code gene integration to escherichia coli chromosome, built-up recombinant bacterium；

The construction method for realizing the genetic engineering bacterium of high density fermentation co-production 2,3-butanediol, includes the following steps：

1) α-acetolactate synthestase encoding gene and alpha -acetolactate decarboxylase coding are expanded respectively from Friedlander's bacillus Gene expands (R, R) -2,3-butanediol dehydrogenase coding genes from bacillus subtilis, recycles overlap extension pcr will Above three genetic fragment is according to α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene, (R, R)- The sequential concatenation of 2,3- butanediol dehydrogenation enzyme coding genes assembles to obtain α-acetolactate synthestase encoding gene, α-acetolactic acid Decarboxylase encoding gene is with three Gene Fusion segments of (R, R) -2,3- butanediol dehydrogenation enzyme coding genes or directly from pneumonia Klebsiella expands α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2,3- fourths The operon gene segment of glycol dehydrogenase coding genes；

2) α in step 1)-acetolactate synthestase encoding gene, α-acetolactic acid decarboxylation are compiled by two step methods of homologous recombination Code enzyme gene and three Gene Fusion segment of (R, R) -2,3- butanediol dehydrogenations enzyme coding gene or α-acetolactate synthestase coding The operon gene segment of gene, alpha -acetolactate decarboxylase encoding gene and meso-2,3- butanediol dehydrogenation enzyme coding genes It is integrated into escherichia coli chromosome group；

Two step methods of homologous recombination the specific steps are：

1) escherichia coli chromosome of PCR amplification is knocked in site upstream sequence homology by the technology for first passing through Overlap extension PCR One section of segment, resistance screening marker gene, sucrose levanase gene and escherichia coli chromosome containing 500-1000 base It knocks in one section of homologous segment containing 500-1000 base of site downstream sequence to be merged, obtains recombinant fragment 1, reuse Recombinant fragment 1 is integrated into escherichia coli chromosome and knocked on site by the method for λ-Red homologous recombinations；

2) escherichia coli chromosome of PCR amplification is knocked in one section of site upstream sequence homology by the method for first passing through over-lap PCR Segment containing 500-1000 base, α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and (R, R) three Gene Fusion segment of -2,3- butanediol dehydrogenations enzyme coding gene or α-acetolactate synthestase encoding gene, α-acetyl breast Acid decarboxylase encoding gene and meso-2, the operon gene segment of 3- butanediol dehydrogenation enzyme coding genes and Escherichia coli dye Colour solid is knocked in one section of homologous segment containing 500-1000 base of site downstream sequence and is merged, obtain recombinant fragment 2 or Recombinant fragment 3 reuses the methods of λ-Red homologous recombinations and recombinant fragment 2 or recombinant fragment 3 is replaced above-mentioned steps 1) in recombination Segment 1；

It is lactic dehydrogenase enzyme coding gene site or 16S rDNA gene locis that the escherichia coli chromosome, which knocks in site,.

2. according to the method described in claim 1, it is characterized in that, the 2,3-butanediol dehydrogenase coding genes be (R, R) -2,3- butanediol dehydrogenations enzyme coding gene or meso-2,3- butanediol dehydrogenation enzyme coding genes.

3. according to the method described in claim 1, it is characterized in that, encoding base to α-acetolactate synthestase that amplification obtains Before cause, alpha -acetolactate decarboxylase encoding gene, and (R, R) -2,3-butanediol dehydrogenase coding genes splice, first in α-acetyl Lactic acid synthetase-coding gene, alpha -acetolactate decarboxylase encoding gene, on (R, R) -2,3-butanediol dehydrogenase coding genes Trip introduces ribosome bind site respectively.

4. according to the method described in claim 1, it is characterized in that, by α-acetolactate synthestase encoding gene, α-acetyl breast The operon gene segment of acid decarboxylase encoding gene and meso-2,3- butanediol dehydrogenation enzyme coding genes is integrated into Escherichia coli Before in genome, first in α-acetolactate synthestase encoding gene, alpha -acetolactate decarboxylase encoding gene and meso-2, The operon gene segment upstream of 3- butanediol dehydrogenation enzyme coding genes introduces ribosome bind site.

5. according to the method described in claim 1, it is characterized in that, the resistance screening marker gene is chlorampenicol resistant base One kind in cause, kalamycin resistance gene, gentamicin resistance gene, tetracycline resistance gene.