CN114686412A - Bacillus subtilis mutant strain and application thereof in production of alginate lyase - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a bacillus subtilis mutant strain and application thereof in production of alginate lyase. The bacillus subtilis mutant strain is obtained by screening through an ultraviolet mutagenesis method, is preserved in China center for type culture collection of Wuhan university in China in 11.11.6.2020, has a preservation number of CCTCC NO: M2020698, can be widely applied to fermentation production of alginate lyase, is beneficial to reducing the production cost of the alginate lyase and has wide application prospect.

Description

Bacillus subtilis mutant strain and application thereof in production of alginate lyase

Technical Field

The invention relates to the technical field of genetic engineering and microbial modification, and particularly relates to a bacillus subtilis mutant strain and application thereof in production of alginate lyase.

Background

The biological energy is used as a new energy which can possibly replace petroleum in the future, has the characteristics of being renewable, low in pollution and the like, and has a wide research prospect. The first type of bioenergy, which is referred to as the first generation bioenergy, is based on the use of raw materials, including grain crops and sugar-producing crops. Although the production technology is quite mature, the development of the method is limited because the problems of expensive raw materials and land competition with grains are contradicted with the survival and development of human beings. The second type is the second generation biofuel technology, which takes lignocellulose as raw material to produce ethanol and other energy sources through fermentation. However, the biological energy source using lignocellulose as raw material has a bottleneck in the aspects of pretreatment, enzyme hydrolysis, conversion rate and other technologies, and the large-scale commercial production cannot be realized until now. Seaweed biomasses such as alginic acid and the like are used as raw materials of the third generation biological energy and are regarded as potential approaches for solving the energy crisis. The U.S. department of energy has been studied for many years and has made great progress, and has also been developed in japan, germany, india and other countries. Relevant researchers believe that the production of biofuels from algae and extracts thereof such as alginic acid has a broad prospect of development. Algal biofuels are likely to become one of the most important renewable energy sources in the future.

At present, methods for degradation of alginic acid can be divided into three major categories: one is a chemical degradation method, and the acid hydrolysis method is widely adopted in the past, so that the method has complicated operation steps and severe reaction conditions. In addition, there is a hydrogen peroxide oxidation degradation method; the second is physical degradation, such as sonication of alginic acid; the third type is an alginate lyase enzymolysis method, the conditions for degrading alginic acid by an enzyme method are mild, the process is controllable, the yield is high, the method is green and safe, the environment is friendly, the action mechanism is clear, the product is determined, and enzyme preparations with different substrate specificities can be singly or combined according to the specific target product requirements. The reaction process of degrading alginic acid by enzyme can also provide information on sequence, configuration and the like, so the method is more suitable for degrading alginic acid and preparing alginate oligosaccharide, and therefore, biodegradation represented by an enzymatic hydrolysis method can gradually replace traditional chemical degradation and is dominant in future commercial production.

The alginate lyase has wide sources and mainly comprises three main types, wherein the first type is microorganisms such as marine bacteria, soil bacteria, fungi and the like, the second type is marine mollusks and echinoderms such as conch, sea cucumber, abalone and the like, and the third type is plants such as kelp, Ascophyllum nodosum and kelp and the like. At present, most of alginate lyase is produced by means of alginate decomposing bacteria. For example, Shenhong et al found a Microbulbifer sp.SH-1 strain of Microbulbifer with high yield of alginate lyase, which can be used for fermentation production of alginate lyase and direct degradation of brown algae. Zhang Wu et al isolated Sphingomonas Sphingomonas sp. ZHO from self-made seaweed compost and cloned 4 alginate lyase genes from the bacterium for complete degradation of alginic acid. The alginate lyase Aly-SJ02 of Pseudomonas aeruginosa, SM0524 is purified and researched by Li and the like, and the enzyme activity is as high as 65.4U/mg. The Vibrio alginolyticus BH17 is separated from rotten kelp by Gaojie and the like, and the enzyme activity reaches 83U/mL, which is superior to that of most of the currently reported strains.

The role of the alginic acid decomposer as an alginate lyase producer is researched and applied, and the alginic acid decomposer plays an important role in producing biological energy by utilizing seaweed biomasses such as alginic acid and the like with the increasing energy crisis in recent years. Further mining the production strains of the high-yield alginate lyase has important significance for sustainable development of ecological environment and economy and effective utilization of marine resources.

Disclosure of Invention

The invention provides a bacillus subtilis (Bacillus subtilis) for solving the problems of the prior artBacillus subtilis) Mutant strain and application thereof in production of alginate lyase. The mutant strain obtained by screening by the applicant through an ultraviolet mutagenesis method can greatly improve the expression quantity of alginate lyase and reduce the production cost of the alginate lyase, thereby being beneficial to promoting the wide application of the alginate lyase.

The invention provides a bacillus subtilis engineering bacterium which carries a recombinant plasmid for expressing alginate lyase.

The amino acid sequence of the alginate lyase is SEQ ID NO. 1, and the coding nucleotide sequence is SEQ ID NO. 2.

The invention provides a bacillus subtilis mutant which is obtained by taking the bacillus subtilis engineering bacteria as a starting bacteria through an ultraviolet mutagenesis method.

The bacillus subtilis mutant is named as bacillus subtilis AH-29 (Bacillus subtilisAH-29) which has been preserved in China center for type culture Collection of Wuhan university in Wuhan, China at 11/6/2020 with the preservation number of CCTCC NO: M2020698.

The invention also provides a method for producing alginate lyase, which takes the bacillus subtilis mutant bacteria as a fermentation strain.

The invention firstly constructs and obtains the bacillus subtilis BS ALH308 of the alginate lyase by high-efficiency recombinant expression, and then obtains the mutant strain bacillus subtilis AH-29 by screening the strain serving as an original strain through an ultraviolet mutagenesis method. The shake flask fermentation enzyme activity of the mutant strain is as high as 350U/ml, the 20L tank fermentation enzyme activity is as high as 3888U/ml, the enzyme activity is respectively improved by 52.3% and 42.6% compared with that of the original strain, and unexpected technical effects are achieved. The optimum action temperature of the alginate lyase produced by the mutant strain is 50 ℃, the optimum action pH is 8.5, and the optimum action temperature is consistent with that of the original strain. The mutant strain Bacillus subtilis AH-29 provided by the invention can be widely applied to fermentation production of alginate lyase, is favorable for reducing the production cost of the alginate lyase and promotes the popularization and application of the alginate lyase.

Drawings

FIG. 1 is a graph showing pH-relative enzyme activity of alginate lyase produced by Bacillus subtilis AH-29;

FIG. 2 is the temperature-relative activity curve of alginate lyase produced by Bacillus subtilis AH-29.

Detailed Description

The process of the present invention is further illustrated by the following examples, in which experimental procedures not specifically indicated for the conditions may be carried out under conventional conditions, such as those described in molecular cloning, a laboratory Manual written by J. Sambrook et al, or as recommended by the manufacturer. The present invention may be better understood and appreciated by those skilled in the art with reference to the following examples. However, the method of carrying out the present invention should not be limited to the specific method steps described in the examples of the present invention.

In the embodiment of the invention, the culture medium comprises the following components in percentage by weight:

LB plate: tryptone 1%, yeast powder 0.5%, NaCl 1%, agar 1.5%;

LB liquid medium: tryptone 1%, yeast powder 0.5%, NaCl 1%;

1 minimum salt solution: k₂HPO₄ 14 g/L，KH₂PO₄ 6 g/L，（NH₄）₂SO₄2 g/L, trisodium citrate 1 g/L, MgSO₄•7H₂O 0.2 g/L；

GMI solution: 95.6 ml of minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein and 1 ml of 10% yeast powder juice;

GMII solution: 96.98 ml of minimum salt solution 1, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast powder juice and 1M MgCl₂ 0.25 ml，1 M CaCl₂ 0.05 ml；

Beef extract peptone medium: beef extract 0.5%, peptone 1%, NaCl 0.5%, agar 1.5%, pH 7.2.

The present invention will be described in detail with reference to specific embodiments.

Example 1 construction of Bacillus subtilis expression vector

1.1 cloning of the Gene

According to the published report of NCBI, the alginate lyase gene was artificially synthesized, and according to Bacillus subtilis (B.) (Bacillus subtilis) Is optimized for codon preference. The synthesized gene was used as a template, and PCR amplification was performed using the following primers:

primer szx 303-F: GGCGTTCAGCAACATGAGCGCGCAGGCTGCATCACTGACAAATCCTGGCT, respectively;

primer szx 303-R: GTCCTCTGTTAACCTCGAGTTATTATTAATCATGTGTATGTTCCAGGCTA is added.

The PCR amplification conditions were: 94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, and 72 ℃ for 1 min; 5min at 72 ℃. And recovering the PCR amplification product by using a gel recovery kit.

1.2 sequencing analysis

The amplification product recovered in 1.1 was ligated to the pSZX303 plasmid to obtain a recombinant plasmid, which was sent to the Beijing Huada Gene research center for sequencing analysis. The sequencing result shows that the alginate lyase gene obtained by amplification has the sequence SEQ ID NO. 1, and the coding amino acid sequence is SEQ ID NO. 2. The applicants named this gene ALH and named the recombinant plasmid obtained by the construction ALY-pSZX 308. The results of multiple clones demonstrated that no amplification errors occurred.

Example 2 transformation and screening

Freshly activated Bacillus subtilis 1A751 (apr-, his-, npr-, eglS. DELTA.102, bglT/bglS. DELTA.EV)) (Wolf M, et al. microbiology 1995141: 281-90) hosts were inoculated from LB plates into 5ml of GM I solution and cultured overnight at 30 ℃ with shaking at 125rpm to give a culture broth A; transferring 2ml of the culture solution A into 18ml of GM I solution, and culturing at 37 ℃ and 250rpm for 3.5h to obtain a culture solution B; transferring 10ml of the culture solution B into 90ml of GM II solution, culturing at 37 ℃ and 125rpm for 90min to obtain a culture solution C; and (3) centrifugally collecting the thalli in the culture solution C at 5000g for 10min, and lightly suspending the thalli by using 10ml of GM II solution, wherein the suspended thalli are competent cells. Then, an appropriate amount of the recombinant plasmid of example 1 was added to 0.5mL of the competent cells, cultured with shaking at 37 ℃ and 200rpm for 30min, then plated on an LB plate (containing 5. mu.g/mL of chloramphenicol), cultured overnight at 37 ℃, and the transformants were checked and verified the next day.

The positive transformants were inoculated into a liquid fermentation medium (yeast extract 0.5%, tryptone 0.5%, glucose 1%, K)₂HPO₄1.8 percent), shaking the flask at 37 ℃ for 48 hours, centrifuging at 5000g for 10min, collecting supernatant, and respectively measuring the enzyme activity of alginic acid lyase in the supernatant.

The applicant named the positive transformant with the highest fermentation enzyme activity as Bacillus subtilis BS ALH308 (Bacillus subtilis BS ALH 308), the alginic acid lyase enzyme activity in the supernatant reaches 230U/mL.

The method for measuring the enzyme activity of the alginate lyase comprises the following steps:

1. definition of enzyme activity unit:

at the temperature of 40 ℃ and the pH value of 7.5, degrading the substrate sodium alginate per minute to generate unsaturated bonds, wherein 1 enzyme activity unit is obtained when the absorbance is increased by 0.1 at 235nm, and the enzyme activity unit is expressed by U/g (U/mL).

2. The principle is as follows:

the alginate lyase can cut off glycosidic bonds in alginate molecules through beta-elimination reaction to generate unsaturated double bonds at non-reducing ends, the double bonds are positioned between non-reducing ends C4 and C5 of products, and maximum ultraviolet absorption is generated at 235 nm.

3. Measurement method

(1) Liquid sample: diluted to an appropriate amount with buffer, and the absorbance OD235 was controlled to be between 0.22 and 0.35, and the enzyme activity was about 0.5U/mL.

(2) Measurement procedure

Enzyme reaction: taking three 15mm by 150mm test tubes, adding 1.8mL of substrate, preheating in a 40 ℃ water bath for 5min, adding 0.2mL of diluted enzyme solution, accurately timing, carrying out vortex oscillation, keeping the temperature at 40 ℃ for 10min, taking the test tubes out of the water bath, immediately adding 2mL of phosphate stop solution, carrying out vortex oscillation, and placing the test tubes on a test tube rack outside a water bath kettle.

Blank: taking a 15mm by 150mm test tube, adding 1.8mL of substrate, preheating in a 40 ℃ water bath for 5min, adding 0.2mL of buffer solution, carrying out vortex oscillation, preserving the temperature at 40 ℃ for 10min, taking the test tube out of the water bath, immediately adding 2mL of phosphate stop solution, carrying out vortex oscillation, and placing the test tube on a test tube rack outside a water bath kettle.

Color comparison: immediately after the blank and enzyme reactions for each sample were terminated, the color was compared at 235nm and the absorbance values A0 and A-samples were recorded.

Remarking:

calculating X ═ (A0-A samples). times.2 XN/(t X0.1)

In the formula:

x-enzyme activity, U/mL or U/g

2-volume factor of 2mL of phosphoric acid stop solution

t (min) -enzymatic reaction time (in the linear range of the enzymatic reaction)

0.1-system coefficient, i.e. conversion of the absorbance increase unit to 0.1

N-dilution factor

Through simplification: the enzyme activity (U/mL) was (A0-A-like). times.2 XN.

Example 3 UV mutagenesis screening

The mutation caused by ultraviolet mutagenesis has strong randomness, and the effect generated by mutation is random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, the screening workload is large, and the possibility that effective positive mutations cannot be obtained exists. However, ultraviolet mutagenesis requires simple equipment and low cost, and can obtain a large number of mutants in a short time, so that it is still a common mutagenesis breeding method.

The applicant constructed a recombinant strain of Bacillus subtilis BS ALH308 (in example 2: (I))Bacillus subtilis BS ALH 308) is taken as an original strain, and is genetically modified by an ultraviolet mutagenesis method, so that the yield of alginate lyase is further improved.

3.1 ultraviolet mutagenesis

Streaking and inoculating a starting strain Bacillus subtilis BS ALH308 on a beef extract peptone slant culture medium containing 50 mu g/mL chloramphenicol, and culturing at 37 ℃ for 48 h; washing off all bacteria on the inclined plane by using 5mL of 0.85% physiological saline, and transferring the bacteria into a sterile test tube containing glass beads; vortex and oscillate for 10min, and fully beat into unicellular thallus; transferring all the bacterial suspension into a 15mL centrifuge tube, and centrifuging at 6000rpm for 3min to collect bacteriaA body; removing supernatant, and suspending the thallus with 10mL of 0.85% physiological saline; the cells were washed twice and finally the cell concentration was adjusted to 10⁸/mL。

And opening a 9W ultraviolet lamp switch, and preheating for about 30 min. Taking a sterile plate with the diameter of 9cm, adding the above cell concentration of 10⁸10mL of bacterial suspension per mL is put into a sterile magnetic stirrer; and (3) opening the magnetic stirrer, then opening the dish cover, stirring and irradiating for 1min at a vertical distance of 15cm, covering the dish cover, closing the ultraviolet lamp, and incubating for 30min in the dark.

Diluting the irradiated bacterial suspension to 10 times by 10-fold dilution method with 0.85% physiological saline^-1～10^-6(ii) a Get 10^-4、 10^-5、10^-6Each 100. mu.L of each of the three dilutions was coated with beef extract peptone plates, three plates were coated at each dilution, and the entire plate surface was spread evenly with a sterile glass rod. The plates were wrapped with black cloth or newspaper and incubated overnight at 37 ℃.

Picking single colony growing on the plate, and streaking and purifying on beef extract peptone plate containing 50 mug/mL chloramphenicol; picking single colony, streaking and inoculating to beef extract peptone inclined plane containing 50 mug/mL chloramphenicol for seed preservation; 99 mutant strains are selected by co-enrichment.

3.2 Shake flask screening

Simultaneously adding the enriched 99 mutant strains and the original strain Bacillus subtilis BS ALH308 in a fermentation medium (yeast extract powder 0.5%, tryptone 0.5%, glucose 1%, K)₂HPO₄1.8%) of the alginic acid, performing shake flask fermentation, centrifuging for 5000g and 10min after 48h, collecting supernate, and respectively measuring the enzyme activity of alginic acid lyase in the supernate.

The results show that the enzyme activities of the two mutant strains with the highest enzyme activity of kainic acid lyase in the fermentation supernatant are 253U/ml and 237U/ml respectively, the enzyme activities are only 10.1 percent and 6.6 percent respectively higher than that of the original strain bacillus subtilis BS ALH308, and the effect is not obvious.

The applicant continues to carry out 6 rounds of ultraviolet mutagenesis screening according to the method, and finally obtains a mutant strain with the alginate lyase yield remarkably higher than that of the original strain, namely a mutant strain named as SuzuoBacillus subtilis AH-29 (Bacillus subtilisAH-29). After the mutant strain is subjected to shake flask fermentation for 48 hours, the enzyme activity of alginic acid lyase in a fermentation supernatant is 350U/mL, and is increased by 52.3% compared with that of the original strain.

3.320L tank fermentation

Respectively selecting mutant strain AH-29 and starting strain single colony, inoculating in 0.6L seed culture medium (tryptone 1%, yeast powder 0.5%, NaCl 1%), and shake culturing at 34 deg.C and 210rpm for 8 hr; 0.6L of the seed culture was inoculated completely into a 12L fermentation medium (yeast extract 0.5%, tryptone 0.5%, glucose 1%, K)₂HPO₄1.8%) in a 20L fermenter, fermenting and culturing at 34 deg.C for 36h, and then detecting the enzyme activity of alginate lyase in the fermentation supernatant respectively.

The result shows that the enzyme activity of alginic acid lyase in the mutant strain AH-29 fermentation supernatant is improved by 42.6 percent compared with that of the original strain, and reaches 3888U/ml, and unexpected technical effects are achieved. Multiple fermentation tests also prove that the level of alginate lyase produced by mutant strain AH-29 is kept stable.

Example 4 enzymatic analysis of alginate lyase produced by Bacillus subtilis AH-29

4.1 optimum pH analysis

Respectively diluting the fermentation supernatant of the bacillus subtilis AH-29 by using buffer solutions with pH values of 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5 and 9.0, measuring the enzyme activity of alginate lyase in the fermentation supernatant at 40 ℃, calculating the relative enzyme activity by taking the highest enzyme activity as 100 percent, and making a pH-relative enzyme activity curve. As shown in FIG. 1, the optimum action pH value of the alginate lyase produced by the mutant strain Bacillus subtilis AH-29 obtained by the invention is 8.5, which is consistent with the optimum action pH value of the alginate lyase produced by the original strain.

4.2 optimum temperature analysis

The enzyme activity of the alginate lyase in the supernatant of the fermentation of the bacillus subtilis AH-29 is measured under the conditions of 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃, 90 ℃ and 95 ℃ and the pH value is 6.5, the highest enzyme activity is taken as 100 percent, the relative enzyme activity is calculated, and a temperature-relative enzyme activity curve group is made. As shown in FIG. 2, the optimum action temperature of the mutant strain AH-29 obtained by the invention for producing the alginate lyase is 50 ℃, which is consistent with the optimum action temperature of the emergent strain for producing the alginate lyase.

In conclusion, the mutant strain Bacillus subtilis AH-29 obtained by screening through an ultraviolet mutagenesis method can obviously improve the yield of the alginate lyase, the fermentation enzyme activity of a 20L tank is up to 2888U/ml, the yield is improved by 42.6% compared with that of the original strain, and the enzymological property of the alginate lyase produced by the mutant strain is not changed compared with that of the original strain.

The applicant has already obtained the above mutant Bacillus subtilis AH-29 (6.11.2020%Bacillus subtilisAH-29) is preserved in China center for type culture Collection, with the preservation number of CCTCC NO: M2020698.

Sequence listing

<110> Weifang kang Den Biotech Co., Ltd

Qingdao blue biological group Co Ltd

<120> bacillus subtilis mutant strain and application thereof in production of alginate lyase

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1728

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaaatca acaggttact tcctttcagc atttcccttc tgttcagcgc ctcggcactg 60

gcaagcttga ccaacccggg ctttgaaaac cagttcagcg gctggagcga tacggaccca 120

tccgccatct caggcgatgc cgccagtggc agttactcgg ccaaaattac cggttcttca 180

ggacgagtgg atcaacaggt cgctttggac actaacaccc aataccggct gaccgccgag 240

gtactgggta gtggcgtgat tggcatcaac attggcggca ccgtgcacga cgaacgggta 300

aacacctcca gctggacaac ggtgaccgtg gagtttgact ccggctccgc gagcagcggc 360

gaggtgttcg caaagtacaa cgacggtacc ggccggttcg acgacttcac tctctcggtg 420

atcggctctt ctggaggctc cggagaatgt gtaaacggag aagccatcga tatcgtttcg 480

gccagcgatg acggaaccaa tgacggccac acgcccgatc ttgccataga cggcaatctg 540

gccgactcct cccggtggtc ctccttgggc gacggaaagg ctatcactct ggacctaggc 600

tctgtctcca ccatcgacac catccgaacc gcctggtaca aagccgatga acgcaccgcc 660

tatttcgacg ttgaagtatc ggaagatggc agcaactggt cttcggtcct aacgaatacc 720

caatcccagg gaaccgaagg gttcgcctca aattcattca acgaggctga tgctcgctat 780

gtccgtatcg tcggccatgg aaattcgagc aatgaatgga acagtctgat cgaagtgcag 840

gtgggttgcg gcgattttgc cgatgacacg agcacccctc ccccggcctc tggaagtctt 900

gaccccaacc ttgccccctc gggaaacttt gacttgagtc gatggtacct gagtgtgccc 960

actgacactg acaatagtgg tacggcggac agcatcaaag aaaacgagct aaactccggt 1020

tatgaggaca gtgagtactt ctatacgggc tctgatggag gcatggtatt caagtgtcct 1080

atcgatggtt ttaaaacctc taccaacacc agctatactc gcaccgaact gcgggagatg 1140

ttgcgcgccg gcgacaccag tatcgcgact cagggggtaa ataaaaataa ctgggtattt 1200

gggagtgcac cgtcctccga tcggaatgat gcgggtggcg tagacggcaa tatgacagcg 1260

actctcgcag tgaatcacgt cactacgacg ggaagcaata gccaggtggg acgcgtcatc 1320

atcggtcaaa ttcacgccaa cgatgatgaa ccactgcgcc tgtactatcg aaagcttccc 1380

gggaatagta aaggctcaat ctactttgct catgaaccca acggcggtag cgactcctgg 1440

tacgagctga tcggcagccg gtcgagcagc gcctcagacc ctagtgacgg gattgcactt 1500

gatgaagttt tcagctacga aatcgacgtt acttatgaca ctctgacggt cactatttac 1560

cgcgacggca aaaaccctgt ctcagagtcg gtgaatatga gcagcagcgg ctatagtagc 1620

ggtggccagt atatgtactt taaagcgggc gtatataacc agaacaactc tggtaacagc 1680

gacgactacg tccaagccac attctactcc cttgagcaca cccacgat 1728

<210> 2

<211> 576

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Ile Asn Arg Leu Leu Pro Phe Ser Ile Ser Leu Leu Phe Ser

1 5 10 15

Ala Ser Ala Leu Ala Ser Leu Thr Asn Pro Gly Phe Glu Asn Gln Phe

20 25 30

Ser Gly Trp Ser Asp Thr Asp Pro Ser Ala Ile Ser Gly Asp Ala Ala

35 40 45

Ser Gly Ser Tyr Ser Ala Lys Ile Thr Gly Ser Ser Gly Arg Val Asp

50 55 60

Gln Gln Val Ala Leu Asp Thr Asn Thr Gln Tyr Arg Leu Thr Ala Glu

65 70 75 80

Val Leu Gly Ser Gly Val Ile Gly Ile Asn Ile Gly Gly Thr Val His

85 90 95

Asp Glu Arg Val Asn Thr Ser Ser Trp Thr Thr Val Thr Val Glu Phe

100 105 110

Asp Ser Gly Ser Ala Ser Ser Gly Glu Val Phe Ala Lys Tyr Asn Asp

115 120 125

Gly Thr Gly Arg Phe Asp Asp Phe Thr Leu Ser Val Ile Gly Ser Ser

130 135 140

Gly Gly Ser Gly Glu Cys Val Asn Gly Glu Ala Ile Asp Ile Val Ser

145 150 155 160

Ala Ser Asp Asp Gly Thr Asn Asp Gly His Thr Pro Asp Leu Ala Ile

165 170 175

Asp Gly Asn Leu Ala Asp Ser Ser Arg Trp Ser Ser Leu Gly Asp Gly

180 185 190

Lys Ala Ile Thr Leu Asp Leu Gly Ser Val Ser Thr Ile Asp Thr Ile

195 200 205

Arg Thr Ala Trp Tyr Lys Ala Asp Glu Arg Thr Ala Tyr Phe Asp Val

210 215 220

Glu Val Ser Glu Asp Gly Ser Asn Trp Ser Ser Val Leu Thr Asn Thr

225 230 235 240

Gln Ser Gln Gly Thr Glu Gly Phe Ala Ser Asn Ser Phe Asn Glu Ala

245 250 255

Asp Ala Arg Tyr Val Arg Ile Val Gly His Gly Asn Ser Ser Asn Glu

260 265 270

Trp Asn Ser Leu Ile Glu Val Gln Val Gly Cys Gly Asp Phe Ala Asp

275 280 285

Asp Thr Ser Thr Pro Pro Pro Ala Ser Gly Ser Leu Asp Pro Asn Leu

290 295 300

Ala Pro Ser Gly Asn Phe Asp Leu Ser Arg Trp Tyr Leu Ser Val Pro

305 310 315 320

Thr Asp Thr Asp Asn Ser Gly Thr Ala Asp Ser Ile Lys Glu Asn Glu

325 330 335

Leu Asn Ser Gly Tyr Glu Asp Ser Glu Tyr Phe Tyr Thr Gly Ser Asp

340 345 350

Gly Gly Met Val Phe Lys Cys Pro Ile Asp Gly Phe Lys Thr Ser Thr

355 360 365

Asn Thr Ser Tyr Thr Arg Thr Glu Leu Arg Glu Met Leu Arg Ala Gly

370 375 380

Asp Thr Ser Ile Ala Thr Gln Gly Val Asn Lys Asn Asn Trp Val Phe

385 390 395 400

Gly Ser Ala Pro Ser Ser Asp Arg Asn Asp Ala Gly Gly Val Asp Gly

405 410 415

Asn Met Thr Ala Thr Leu Ala Val Asn His Val Thr Thr Thr Gly Ser

420 425 430

Asn Ser Gln Val Gly Arg Val Ile Ile Gly Gln Ile His Ala Asn Asp

435 440 445

Asp Glu Pro Leu Arg Leu Tyr Tyr Arg Lys Leu Pro Gly Asn Ser Lys

450 455 460

Gly Ser Ile Tyr Phe Ala His Glu Pro Asn Gly Gly Ser Asp Ser Trp

465 470 475 480

Tyr Glu Leu Ile Gly Ser Arg Ser Ser Ser Ala Ser Asp Pro Ser Asp

485 490 495

Gly Ile Ala Leu Asp Glu Val Phe Ser Tyr Glu Ile Asp Val Thr Tyr

500 505 510

Asp Thr Leu Thr Val Thr Ile Tyr Arg Asp Gly Lys Asn Pro Val Ser

515 520 525

Glu Ser Val Asn Met Ser Ser Ser Gly Tyr Ser Ser Gly Gly Gln Tyr

530 535 540

Met Tyr Phe Lys Ala Gly Val Tyr Asn Gln Asn Asn Ser Gly Asn Ser

545 550 555 560

Asp Asp Tyr Val Gln Ala Thr Phe Tyr Ser Leu Glu His Thr His Asp

565 570 575

Claims (7)

1. A bacillus subtilis engineering strain is characterized in that the bacillus subtilis engineering strain carries a recombinant plasmid for expressing alginate lyase.

2. The engineered bacillus subtilis strain of claim 1, wherein the alginate lyase gene sequence is SEQ ID NO. 1, and the encoded amino acid sequence is SEQ ID NO. 2.

3. A Bacillus subtilis mutant strain, which is characterized in that the mutant strain is obtained by taking the engineering strain of claim 2 as a starting strain and adopting an ultraviolet mutagenesis method.

4. The mutant strain of claim 3, which has a accession number of CCTCC NO: M2020698.

5. Use of the engineered strain of bacillus subtilis of claim 1 or 2 for the production of alginate lyase.

6. Use of the mutant strain of Bacillus subtilis of claim 3 or 4 for the production of alginate lyase.

7. A method for producing alginate lyase, which uses the bacillus subtilis mutant strain of claim 3 or 4 as a fermentation strain.

Images