CN101633690B - Hydrogen production associated protein, coding genes thereof and application thereof - Google Patents

Abstract

The invention discloses a hydrogen production associated protein, coding genes thereof and application thereof. The hydrogen production associated protein is a protein (a) or protein (b), wherein the protein (a) has an amino acid sequence represented by the No.1 sequence 1 in a sequence table; or (b) the protein has an amino acid sequence that has substituents of one or more amino acid residues, lacks one or more amino acid residues or has one or more additional amino acid residues and is associated with the hydrogen production and derived from the sequence 1. The invention also obtains a strain of engineering bacteria by inactivating the coding genes of the protein in the enterobacter aerogenes, and the engineering bacteria have the advantages of high growing speed and strong environmental adaptability, greatly improve the glucose utilizing ability and the hydrogen producing ability, can be applied to biological hydrogen production, and have great instruction significance.

Description

A kind of hydrogen production associated protein and encoding sox thereof and application

Technical field

The present invention relates to a kind of hydrogen production associated protein and encoding sox thereof and application.

Background technology

Nowadays the fossil energy system of having set up since the world industry revolution of 18th century is being faced with two challenges greatly: 1) the fossil energy reserves reduce day by day, are faced with exhausted danger; 2) burning of fossil oil has produced a large amount of pollution substances, particularly CO ₂The Greenhouse effect that the isothermal chamber gas purging causes, the environment of depending on for existence to the mankind brings huge threat.Therefore, the renewable and clean energy resource of Sustainable Development, progressively substituting fossil energy is the grand strategy problem that concerns national energy security, environmental safety and social stability peaceful development.

Hydrogen Energy is as substituting one of clean energy the future that has potentiality, is energy carrier efficiently, has energy density height, cleaning, renewable, products of combustion and be water and characteristics such as pollution-free, is very good renewable energy source.At present, hydrogen mainly transforms (account for hydrogen source 96%) and water electrolysis hydrogen production (accounting for 4%) from the reformation of fossil oil, fails to break away from the dependence to original fossil energy.Therefore, how to utilize renewable resources to obtain the concern widely that hydrogen receives people constantly.Biological hydrogen production is one of important channel that addresses this problem.It is advantages such as substrate that biological hydrogen production has normal temperature and pressure reaction, mild condition, environmentally friendly, capable of using discarded biological substance, can be with environmental pollution improvement, reduce disposal of pollutants and interrelate, and be very good hydrogen production process.

The research of modern biological hydrogen production starts from the energy dilemma of the seventies in 20th century, and since the nineties, Along with people's is to the further understanding of Greenhouse effect, and biological hydrogen production has caused people's extensive attention more as the hydrogen production process of Sustainable development.Bio-hydrogen production technology comprises optical drive process and two kinds of routes of anaerobically fermenting.The former utilizes photosynthetic bacterium or algae directly conversion of solar energy to be hydrogen, is a very ideal process, but because the light utilising efficiency is very low, factors such as photoreactor difficult design are difficult to push to use at no distant date.What the latter adopted is the hydrogenogens anaerobically fermenting, and its advantage is that product hydrogen speed is fast, reactor design simple and can combines with discarded biological utilization, realizes industrial application more easily in the near future with respect to the former.

Fermentation method hydrogen manufacturing starts from middle nineteen sixties, and the nineties comes into one's own, but progress and little.Late nineteen nineties is to the beginning of this century, and people recognize that ferment for hydrogen production realizes industrialization more easily in the near future, have increased the scientific research input of dark ferment for hydrogen production aspect greatly, have produced the basic research result of a collection of relevant culture process.The research of the hydrogen production process that combines with the abandoned biomass processing in recent years greatly increases; Some of them have reached the pilot scale level; But mainly concentrate on reactor type design, the technical study; And the mixed culture hydrogen generation efficiency is lower than pure culture, and total transformation efficiency is not high, and this is the bottleneck of ferment for hydrogen production place just also.Solving the key of ferment for hydrogen production bottleneck, is to realize technological breakthrough, improves the hydrogen yield.Research shows, only from the angle of technology, can't fundamentally break through the low problem of hydrogen generation efficiency, must pay attention to the research and development of highly effective hydrogen yield bacterial classification.

For many years; The hydrogenogens kind of using in the dark ferment for hydrogen production mainly comprises enterobacter (Enterobacter), fusobacterium (Clostridium), Escherichia (Escherichia) and bacillus (Bacillus), and is wherein maximum with the correlative study of enterobacter and fusobacterium especially.Fusobacterium produces the hydrogen rate and can reach 2.36mol/mol glucose, and enteroaerogen belongs to product hydrogen rate and reaches as high as 3mol/mol glucose (being 6mol/mol sucrose) [Kumar, N.and Das; D.Bioprocess Engineering 23; 205-208 (2000)], [Kumar, N.and Das; D.ProcessBiochemistry 35,589-593 (2000)].With clostridium (Clostridium sp) is that the mechanism of the obligatory anaerobic bacteria fermentation and hydrogen production of representative is: generate pyruvic acid after the glucose glycolysis, in forming the acetic acid process, a part of electronics forms hydrogen through ferredoxin under the effect of hydrogen enzyme.1 mole glucose can form 4 mol of hydrogen and 2 molecule acetic acid.Therefore, in the time of the obligatory anaerobic bacteria fermentation and hydrogen production, must follow organic acid formation such as acetic acid.Amphimicrobian hydrogenogens E.aerogenes separates approach through sugar and tricarboxylic acid cycle (TCA) approach produces NADH and ATP; The hydrogen enzyme converts proton into hydrogen through NADH; Producing hydrogen theoretical transformation rate is that 1 mole of glucose forms 12mol hydrogen, is far longer than the hydrogen yield of obligatory anaerobic bacteria.Therefore, E.aerogenes is the important bacterial classification of the efficient ferment for hydrogen production technology of exploitation.

Along with the develop rapidly of biotechnology, the simple bacterial screening and the optimization of culture process can not have been satisfied the demand that improves hydrogen generation efficiency.The research of ferment for hydrogen production need get into cell interior, through the transformation of hydrogen enzyme and metabolism network thereof being strengthened the hydrogen process of producing.100 kinds hydrogenase gene sequence [PauletteM.Vignais, Bernard Billoud, Jacques Meyer.FEMS Microbiology Reviews 25 on gene pool, can have been obtained at present to surpass; 455-501 (2001)], but still have the hydrogenase gene of a large amount of known hydrogenogens strains not cloned as yet, seeking more hydrogenase gene is the important directions [Kalia of biological hydrogen production research; V.C., Lal, S.; Ghai, R., Mandal; M.andChauhan, A.Trends in Biotechnology 21,152-156 (2003)].Different hydrogen enzymes have different functions, compare with other enzyme system, and people are also very limited to the understanding of hydrogen enzyme.

At present, the more clearly of research is the gene of colibacillary hydrogen enzyme I, II, III and IV, and they all belong to Ni-Fe hydrogen enzyme, wherein hydrogen enzyme III and IV and produce hydrogen relevant [Andrews, S.C.; Berks, B.C., Mcclay, J., Ambler; A., Quail, M.A., Golby; P.and Guest, J.R.Microbiology 143,3633-3647 (1997)], and I, II are relevant with suction hydrogen process.The hydrogen enzyme of fusobacterium all belongs to iron hydrogen enzyme, and three clostridial iron hydrogen enzymes have sequencing result, but not clear about its subsidiary gene, regulatory mechanism.Be cloned into clostridial iron hydrogenase gene, and in photosynthetic bacterium, obtained heterogenous expression, strengthened the product hydrogen process of photosynthetic bacteria.The expression of clostridial iron hydrogenase gene in intestinal bacteria be not success but; Possibly be since clostridium and intestinal bacteria for [Yasuo Asada, Yoji Koike, the Jorg Schnackenberg that causes inequality of the subsidiary gene system of iron hydrogen expression of enzymes; MasatoMiyake; Ieaki Uemura, Jun Miyake.Biochimica et Biophysica Acta 1490,269-278 (2000)].Recently, Mishra J. etc. clone the iron hydrogen enzyme about 450bp through the method for iron hydrogen enzyme conserved sequence design from E.cloacae IIT-BT08, and in the intestinal bacteria that do not produce hydrogen heterogenous expression, verified its function, the result shows that this hydrogen enzyme is positioned at tenuigenin [Mishra; J., Kumar, N., Ghosh, A.K.and Das; D.International Journal of Hydrogen Energy 27,1475-1479 (2002)], [Mishra, J.; Khurana, S., Kumar, N.; Ghosh, A.K.and Das, D.Biochemical and BiophysicalResearch Communications 324,679-685 (2004)].The early-stage Study of enteroaerogen E.aerogenes shows that on its cytolemma, the NADH effect that produces in hydrogen enzyme and the cell generates hydrogen [Nakashimada; Y., Rachman, M.A.; Kakizono; T.and Nishio, N.International Journal of HydrogenEnergy 27,1399-1405 (2002)].Therefore study hydrogen enzyme characteristic, gene and the biological function explore thereof of this Pseudomonas, significant for the technological breakthrough that realizes raising enteroaerogen product hydrogen yield.

Nadh dehydrogenase is claimed NADH-ubiquinone oxide-reductase enzyme again, is an important protein mixture in the cellular respiration electron transport chain, and two transfer transports of catalyzing N ADH are given ubiquinone (ubiquinone).Evolutionary analysis shows that its hydrogen enzyme relevant with DNAH (nicotinamide adenine dinucleotide) is that same origin is evolved, and therefore, studies its function to understanding the product hydrogen process of enteroaerogen, and is significant.

Nadh dehydrogenase is divided into three kinds: participate in the I type nadh dehydrogenase (NDH-1) of proton transhipment, the II type nadh dehydrogenase (NDH-2) and the sodium ion transhipment type NADH-ubiquinone oxide-reductase enzyme [NantapongN in noenergy coupling site; Otofuji A; Migita CT; Et al.Electron transfer ability from NADH tomenaquinone and from NADPH to oxygen of type IINADH dehydrogenase ofCorynebacterium glutamicum [J] .Bioscience Biotechnology and Biochemistry; 2005,69 (1): 149-159.].Composite I homology in NDH-1 of bacterium and the eukaryote plastosome is made up of 13-14 different subunits, contains FMN and some iron-sulphur bunch as prothetic group.This endonuclease capable proton from the tenuigenin pump to periplasmic space.And NDH-2 is the enzyme of a single subunit; But it contains vitamin G iron content-sulphur bunch [Yagi T not; Seo B.B, Di Bernardo S, et al.NADH dehydrogenases:from basic science tobiomedicine [J] .J.Bioenerg.Biomembr.; 2005,33:233-242.].Contain NDH-1 and/or NDH-2 in the respiratory chain of bacterium.E.coli contains NDH-1 and NDH-2 [Matsushita, K, Ohnishi; T, andKaback, R.NADH-ubiquinone oxidoreductase of the Escherichia coli aerobicrespiratory chain [J] .Biochemistry; 1987,26:7732-7737.], respectively by nuo and ndh genes encoding; But Paracoccus denitrificans has only NDH-1, and Bacillus subtilis has only NDH-2 [Bergsma J, Strijker R; Alkema J Y; Et al.NADH dehydrogenase and NADHoxidation in membrane vesicle from Bacillus subtilis [J] .Eur.J.Biochem., 1981,120:599-606.].

In E.coli, NDH-1 is made up of 13 subunits, is called NuoA to NuoN respectively, contains a FMN and 9 iron-sulphur (Fe/S) in addition bunch as prothetic group.People such as Flemming conclude bacterium NDH-1 model; Disclosed the NDH-1 model from 3 main models development that are used for electron transport and prototropy from the angle of phylogenetics; They have constituted nadh dehydrogenase module, hydrogen enzyme module and transporter module [the Flemming D of NDH-1 model respectively; Stolpe S; Schneider D, Hellwig P, Friedrich T; Et al.A possiblerole for iron-sulfur cluster N2 in proton translocation by the NADH:ubiquinoneoxidoreductase (complex I) [J] .J Mol Microbiol Biotechnol.2005,10:208-222.].The nadh dehydrogenase module has characterized the inlet of electronics, and it is made up of subunit NuoE, NuoF and NuoG, and comprises NADH binding site, FMN, double-core Fe/S bunch N1a and N1b and four nuclears Fe/S bunch of N3, N4, N5 and N7.Because the free energy that reduction reaction provides is not enough to drive prototropy, the nadh dehydrogenase module comprises transfer transport and the proton transport process that is not coupled probably.Amphiphilic hydrogen enzyme module has comprised wetting ability subunit NuoB, NuoC, NuoD and NuoI and hydrophobicity subunit NuoH and NuoL, and contains Fe/S bunch of N2, N6a and N6b.This module has comprised an energy coupling site, and wherein subunit NuoB, NuoD, NuoH and NuoL are considered to participate in the cohesive process of ubiquinone.Remaining hydrophobicity subunit NuoA, NuoJ, NuoK, NuoM and NuoN are called as so-called transporter module, and it comprises the homologue of hydrogen ion and other cationic antiporter subunit, and this module is not found prothetic group at present.Substrate is striden film through the antiporter conformational change and is carried, so the transporter module becomes another energy coupling site of NDH-1 probably with the proton pump form of conformational change driving.

Enteroaerogen is a facultative anaerobe, and fast growth under anaerobic can produce hydrogen, and advantage such as it is wide to have the substrate of utilization scope, and growth adaptability is strong, is the bacterial strain with good industrial proterties.Existing many reports about enteroaerogen product hydrogen, but be mostly aspect technology and cultivation [E.Palazzi, B.Fabiano, P.Perego.Bioprocess Eng.22:205-213 (2000) .], the relevant relevant gene of hydrogen that produces also has no report.Research shows that enteroaerogen has the utilize formic acid similar with intestinal bacteria and produces ability [Tatsuo, the K. of hydrogen; Shigeharu, T.Mar Biotechnol.7:112-118 (2005) .], and it has the hydrogen of suction process; [the Y.L Ren. that exists that inhales the hydrogen enzyme is promptly arranged; X.H.Xing., C.Zhang., and Z.X.Gou.Biotechnol Lett.27 (14): 1029-1033 (2005) .].

Summary of the invention

The purpose of this invention is to provide a kind of hydrogen production associated protein and encoding sox thereof and application.

Hydrogen production associated protein provided by the invention, name is called NuoB, derives from enteroaerogen E.aerogenesIAM1183, is (a) or protein (b) as follows:

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and with produce hydrogen relevant by sequence 1 deutero-protein.

In order to make the albumen in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned (b) but in the albumen synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.Proteic encoding sox in above-mentioned (b) can be through the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2; And/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The encoding sox (nuob) of said hydrogen production associated protein (NuoB) also belongs to protection scope of the present invention.

Said proteic encoding sox specifically can be following 1) or 2) or 3) dna molecular:

1) its encoding sequence is the dna molecular shown in the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

3) with 1) or 2) dna sequence dna that limits has 90% above homology, and the identical function protein DNA molecule of encoding.

Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

The expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain said gene all belong to protection scope of the present invention.

The present invention also protects a hydrogen-producing engineering bacteria, is that gene (nuob) obtains described in the deactivation E.aerogenes IAM1183.

Said deactivation realizes through homologous recombination.

Said homologous recombination specifically can import said E.aerogenes IAM1183 with dna fragmentation P and realize;

Said dna fragmentation P is followed successively by homology arm T to downstream from the upper reaches ₁, dna fragmentation M, homology arm T ₂Said homology arm T ₁With homology arm T ₂Can with said gene generation homologous recombination, the said gene of deactivation; Said dna fragmentation M is the antibiotics resistance fragment.

The dna fragmentation that said gene is made up of the nucleotide sequence shown in the sequence in the sequence table 2; Said homology arm T ₁The dna fragmentation of forming by the nucleotide sequence shown in the sequence in the sequence table 4; Said homology arm T ₂The dna fragmentation of forming by the nucleotide sequence shown in the sequence in the sequence table 5; Said dna fragmentation M is the tetracyclin resistance fragment; Sequence 3 in the nucleotide sequence preferred sequence table of said dna fragmentation P.

The present invention also protects dna fragmentation P, is followed successively by homology arm T to downstream from the upper reaches ₁, dna fragmentation M, homology arm T ₂Said homology arm T ₁With homology arm T ₂Can with the said gene generation homologous recombination of E.aerogenes IAM1183, the said gene of deactivation; Sequence 3 in the nucleotide sequence preferred sequence table of said dna fragmentation P.

The expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain said dna fragmentation P all belong to protection scope of the present invention.

When using dna fragmentation P to make up recombinant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or constitutive promoter, they can use separately or be used in combination with other promotor; In addition; When using dna fragmentation P construction of expression vector of the present invention; Also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of the transgenic bacterial strain being identified and being screened; Can process used expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in bacterial strain, to express, have antibiotic marker thing (qingfengmeisu qiong affinity tag, kantlex affinity tag etc.) or the anti-chemical reagent marker gene of resistance etc.

Said engineering bacteria can be applicable in the biological hydrogen production.

The present invention has obtained new hydrogen production associated protein and encoding sox thereof through molecular biology method from enteroaerogen, and has obtained a strain engineering bacteria through the deactivation gene.The glucose utilization ability of the engineering bacteria that the present invention obtains significantly improves, and hydrogen production potential is strengthened greatly, can be applicable to biological hydrogen production, has huge directive significance.

The engineering bacteria that the present invention obtains has the following advantages:

1) starting strain E.aerogenes IAM1183 is a facultative anaerobe, under aerobic, anaerobic condition, all can grow fast, and is strong to environmental compatibility; Utilize its carry out biological hydrogen production have the substrate of utilization scope wide, utilize the substrate ability strong and produce the hydrogen advantage of higher, be to have the potential strain excellent that is applied to industrial biological hydrogen preparing.

2) engineering bacteria that obtains of the present invention is except having original bacterium 1) advantage, it is stronger also to have the substrate utilization ability, the characteristics that hydrogen production potential further improves.

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.

Description of drawings

Fig. 1 is the resistance screening figure of E.aerogenes IAM1183-B

Fig. 2 is that the PCR of E.aerogenes IAM1183-B identifies

Fig. 3 is the growth curve OD of E.aerogenes IAM1183-B ₆₀₀

Fig. 4 is the product hydrogen (H of fermentor cultivation E.aerogenes IAM1183-B ₂) situation

Embodiment

Experimental technique among the following embodiment like no specified otherwise, is ordinary method.

Used primer is following in following examples:

nuoB-fw：ATGGATTATACGCTCACCCGCATAG；

nuoB-rv：TTAAATCTCGTCCGGTGTCCGCA。

nuoB-tet-fw：

ATGGATTATACGCTCACCCGCATAGATCCTAACGGTGAGATTTGGTGACTGCGCTCCTC；

nuoB-tet-rv：

TTAAATCTCGTCCGGTGTCCGCAGATTGGTCACTGCAATGTGTTGTTGCTCAGGTCGCA；

Culture medium prescription and purposes related in following examples are following:

(1) LB substratum (L ^-1): peptone 10g, yeast soak powder 5g, NaCl 10g, agar powder 15g (adding during solid medium); Be used for bacterial classification short term storage and activation culture.

(2) dextrose culture-medium (L ^-1): glucose 15g, peptone 5g, K ₂HPO ₄3H ₂O 14g, KH ₂PO ₄6g, (NH ₄) ₂SO ₄2g, MgSO ₄7H ₂O 0.2g; Be used for ferment for hydrogen production.

The clone of embodiment 1, nuob gene

Enterobacteria nadh dehydrogenase gene order among the NCBI is carried out sequential analysis; Designing a pair of primer nuoB-fw and nuoB-rv, is that template is carried out PCR with the DNA of enteroaerogen (E.aerogenes IAM1183) (available from using microbe institute of Tokyo Univ Japan (IAM) strain library).

The result shows that having obtained molecular weight is the band of 675bp.With 4 ℃ of preservations of this PCR product, serve extra large Invitrogen Corporation order-checking, sequencing result shows that the nucleotide sequence that increases is seen the sequence 2 of sequence table, encoding amino acid sequence is the protein of the sequence 1 of sequence table.With the NuoB of albumen called after shown in the sequence 1, with the nuob of Nucleotide called after shown in the sequence 2.

Through online compare of analysis, the NADH dehydrogenasesubunit B of nuob and Klebsiella pneumoniae subsp has highest homology property, and homology reaches 89%, therefore determines that it is the subunit B of nadh dehydrogenase.

The acquisition of embodiment 2, enteroaerogen E.aerogenes IAM1183-B two mutants

Through sequential analysis, design a pair of primer nuoB-tet-fw and nuoB-tet-rv, the sequence of the band line in the primer is the homology arm of enteroaerogen (E.aerogenes IAM1183) Δ nuoB.

The mode that transforms through electricity with the pYM-red plasmid (in plum, Zhou Jianguang, Chen Wei; Li Shanhu, Huang Cuifen, the foundation of a kind of transferable recombined engineering pYM-Red of system. biological chemistry and biophysics progress .2005; 32 (4) .) in the enteroaerogen of shocking by electricity (E.aerogenes IAM1183); Carry out paraxin (24mg/mL) resistance screening, from positive strain, extract the pYM-red plasmid and identify, obtained to contain the enteroaerogen (E.aerogenes IAM1183) of pYM-red recombinant plasmid.

(the Nanjing sage is than Australia bio tech ltd with the pACYC184 plasmid; 70905-3) (Chang; A.C.; AndS.N.Cohen.1978.Construction and characterization of amplifiable multicopyDNA cloning vehicles derived from the P15A cryptic miniplasmid.J.Bacteriol.134:1141-1156.) DNA is a template; Carry out pcr amplification with primer nuoB-tet-fw, nuoB-tet-rv, obtained to contain the linear DNA (sequence 3 of sequence table) of tetracycline marker, with this linear DNA as targeting vector.Mode through electricity transforms imports targeting vector the enteroaerogen (E.aerogenes IAM1183) that contains the pYM-red recombinant plasmid.Bacterium after transforming is coated on the monoclonal antibody LB flat board that contains tsiklomitsin (4ug/ml), cultivated 1 day for 30 ℃; Then the bacterium that grows is transferred and contain on the two anti-LB flat board of tsiklomitsin (4ug/ml) and paraxin (24ug/ml), cultivated 1 day for 30 ℃.Monoclonal antibody is seen Fig. 1 with two anti-results of screening, and left side figure is the figure of monoclonal antibody screening among Fig. 1, and right figure is the figure of two anti-screenings.

Several clones that on two anti-substratum, grow of picking at random extract genomic dna, through the method for PCR identify targeting vector whether with karyomit(e) on target site homologous recombination has taken place, the used a pair of primer of PCR reaction is nuoB-fw, nuoB-rv.

The result sees Fig. 2.Among Fig. 2, the amplified production of 1:E.aerogenes IAM1183; 2:DNA 2000bp Marker; 3: the amplified production of positive colony.Visible by figure, the amplified production of E.aerogenes IAM1183 is 675bp: the amplified production of positive colony is 1913bp, and is consistent with expected result.The result shows that in the positive colony of acquisition, homologous recombination has taken place the target site on targeting vector and the karyomit(e), has obtained to have taken place the saltant of homologous recombination, with its called after E.aerogenes IAM1183-B.

Embodiment 3, the growth of E.aerogenes IAM1183-B engineering bacteria and product hydrogen situation

In the 70mL serum bottle, add the 20mL dextrose culture-medium, the engineering bacteria E.aerogenesIAM1183-nuoB after the activation is carried out shake-flask culture; Simultaneously the wild bacterium E.aerogenes IAM1183 after the activation is carried out the shake-flask culture of similarity condition, as contrast.The concrete operations step is following:

(1) seed culture: adopt the 15ml centrifuge tube, add 5ml LB substratum, from solid plate inoculation, 37 ℃ of culture temperature, airbath shaking speed 170rpm, incubated overnight.

(2) anaerobism shake-flask culture: adopt 70ml serum bottle anaerobism culturing bottle, dextrose culture-medium liquid amount 20ml (using the air in nitrogen replacement culturing bottle top and the substratum in advance); Plant the inoculum size 2.5% (v/v) of daughter bacteria, 37 ℃ of culture temperature, airbath shaking speed 170rpm.Cultivated 24 hours.

Three repetitions are established in test, and all results are multiple MV three times, represent with mean+SD.

Utilize spectrophotometer (UV-1206, SHIMADZU company (Japan)) to measure the growing state of thalline.The OD of engineering bacteria E.aerogenes IAM1183-Δ nuoB and wild bacterium ₆₀₀Variation see Fig. 3.

Enteroaerogen has two and produces the hydrogen approach; Formate transporters and NADH approach (Tanisho; S.; N.Kamiya, and N.Wakao.1989.Hydrogen evolution of Enterobacter aerogenes depending onculture pH:mechanism of hydrogen evolution from NADH by means ofmembrane-bound hydrogenase.Biochim Biophys Acta 9731:1-6.; Tatsuo, K., andT.Shigeharu.2005.Effects of Formate on Fermentative Hydrogen Production byEnterobacter aerogenes.Mar Biotechnol.7:112-118.).To the hydrogen source analysis, which the bar approach that can measure mutant strain is strengthened.Engineering bacteria E.aerogenes IAM1183-Δ nuoB and wild bacterium shake the product hydrogen yield of bottle batch formula cultivation and relatively see table 2.Through known two hydrogen yield of producing the hydrogen approach certain variation has taken place, the hydrogen yield of engineering bacteria formate transporters is higher than wild bacterium, and the hydrogen that produces through the NADH approach equates with wild bacterium.Explain that the formate transporters of engineering bacteria is effectively strengthened, reference is provided the design that fermentation substrate is provided.

Table 2 shakes the product hydrogen yield that bottle batch formula is cultivated

The metabolic flux analysis of embodiment 4, E.aerogenes IAM1183-Δ nuoB engineering bacteria

Be the variation of confirming that the nuob inactivation of gene brings bacterial strain, detect the distribution of each metabolic flux in wild bacterium and the engineering bacteria cell respectively, concrete steps are following:

(1) seed culture: adopt 15ml centrifuge tube (5ml LB substratum is housed), from solid plate inoculation bacterium, 37 ℃ of temperature, airbath shaking speed 170rpm, incubated overnight.

(2) anaerobism shake-flask culture: adopt 70ml serum bottle anaerobism culturing bottle (the 20ml dextrose culture-medium is housed), use the air in nitrogen replacement culturing bottle top and the substratum in advance; Plant the inoculum size 2.5% (v/v) of daughter bacteria, 37 ℃ of temperature, airbath shaking speed 170rpm cultivated 16 hours.

(3) behind the 16h meta-bolites is detected.Behind fermented product centrifuging and taking supernatant, filter.Utilize the output and the composition of high-pressure liquid chromatography metabolite.High-pressure liquid phase gas spectrum is (HPLC-10A, SHIMADZU company (Japan).Three repetitions are established in test, and all results are multiple MV three times, represent with mean+SD.The result is as shown in table 3.

The metabolism stream comparative analysis (n=3) of table 3 engineering bacteria and original bacterium

Significant variation has taken place in the metabolism of engineering bacteria, and the concentration of product except lactic acid all is higher than wild bacterium.The result shows that the nuob inactivation of gene is bigger to metabolic influence, has significantly improved the utilization ratio and the hydrogen output of the substrate of bacterium.

Embodiment 5, fermentor cultivation E.aerogenes IAM1183-B engineering bacteria

When using serum bottle to ferment, the application proterties of engineering bacteria is superior to original bacterium, is the using value of further testing engineering bacterium, adopts the fermentor cultivation engineering bacteria.Simultaneously wild bacterium is carried out the fermentation culture of similarity condition, as contrast.

1) preparation seed liquor

The E.aerogenes IAM1183-Δ nuoB bacterial classification that activation is good is inoculated in the 50mL triangular flask (filling the LB substratum of 30mL), and incubated overnight is as seed liquor.

2) fermentation

With gas 30min in the nitrogen replacement fermentor tank to guarantee initial anaerobic condition.Adopt 5L fermentor tank (the 3L dextrose culture-medium is housed), the seed liquor of inoculation 60mL step 1) preparation.Airtight cultivation, culture temperature are 37 ℃, and stir speed (S.S.) is 200rpm.(be used to absorb CO with being inverted in 10mM NaOH solution ₂) the gas that collect to produce of graduated cylinder, the volume of measurement gas.In the fermenting process, detect the growing state of thalline.

The result is as shown in Figure 4, cultivates similar with serum bottle.The wild bacterium of the growth fraction of engineering bacteria lags behind, but bacteria concentration is higher than wild bacterium.And total growing amount of hydrogen is 2 times of original bacterium.

So no matter metabolic analysis is all similar with the serum bottle experiment with growth characteristics.Above bottle fermentation and ferment tank data analysis can be found out, the good wild bacterium of biological character of hydrogen is produced in the fermentation of engineering strain E.aerogenes IAM1183-B far away, is to have potentiality hydrogen manufacturing bacterial classification.

Sequence table

< 110>Tsing-Hua University

< 120>a kind of hydrogen production associated protein and encoding sox thereof and application

<130>CGGNARY81497

<160>5

<210>1

<211>224

<212>PRT

< 213>enteroaerogen (E.aerogenes)

<400>1

Met Asp Tyr Thr Leu Thr Arg Ile Asp Pro Asn Gly Glu Asn Asp Arg

1 5 10 15

His Pro Leu Gln Lys Gln Glu Ile Val Thr Asp Pro Leu Glu Gln Glu

20 25 30

Val Asn Lys Ser Val Tyr Met Gly Lys Leu Glu His Ala Leu His Asp

35 40 45

Met Val Asn Trp Gly Arg Lys Asn Ser Ile Trp Pro Cys Asn Phe Gly

50 55 60

Leu Ser Cys Cys Tyr Ala Glu Met Val Thr Ser Phe Thr Ala Val His

65 70 75 80

Asp Val Ala Arg Phe Gly Ala Glu Val Leu Arg Ala Ser Pro Arg Gln

85 90 95

Ala Asp Leu Met Val Val Ala Gly Thr Cys Phe Thr Lys Met Ala Pro

100 105 110

Val Ile Gln Arg Leu Tyr Asp Gln Met Leu Glu Pro Lys Trp Val Ile

115 120 125

Ser Met Gly Ala Cys Ala Asn Ser Gly Gly Met Tyr Asp Ile Tyr Ser

130 135 140

Val Val Gln Gly Val Asp Lys Phe Ile Pro Val Asp Val Tyr Ile Pro

145 150 155 160

Gly Cys Pro Pro Arg Pro Glu Ala Tyr Met Gln Ala Leu Met Leu Leu

165 170 175

Gln Glu Ser Ile Gly Lys Glu Arg Arg Pro Leu Ser Trp Val Val Gly

180 185 190

Asp Gln Gly Val Tyr Arg Ala Asn Met Gln Ser Glu Arg Glu Arg Lys

195 200 205

Arg Gly Glu Arg Ile Ala Val Thr Asn Leu Arg Thr Pro Asp Glu Ile

210 215 220

<210>2

<211>675

<212>DNA

< 213>enteroaerogen (E.aerogenes)

<400>2

atggattata cgctcacccg catagatcct aacggtgaga acgaccgtca ccccctgcag 60

aaacaggaga tcgtaaccga ccccctggag caagaagtca ataaaagcgt gtatatgggg 120

aaactcgaac atgcgctgca tgacatggtg aactggggcc gcaagaactc aatctggccc 180

tgcaacttcg gcctgtcatg ctgctacgct gaaatggtga cgtcattcac tgcggtgcat 240

gacgttgcgc gttttggcgc cgaggtactg cgtgcttctc ctcgtcaggc ggacctgatg 300

gtggtcgccg gcacctgctt caccaaaatg gcgccggtca ttcagcgtct gtatgaccag 360

atgctggagc ctaagtgggt tatctccatg ggcgcctgcg ccaactccgg cgggatgtac 420

gatatttatt ctgtcgtcca gggcgtggac aagtttattc cggttgatgt ttacatcccg 480

ggctgtccgc cgcgtccgga agcttatatg caggcgctga tgctgctgca ggagtccatt 540

ggtaaagaac gtcgcccgct ctcatgggtg gttggcgatc agggcgtgta ccgcgccaac 600

atgcagtcgg aacgcgagcg taaacgtggt gaacgcattg cagtgaccaa tctgcggaca 660

ccggacgaga tttaa 675

<210>3

<211>1913

<212>DNA

< 213>artificial sequence

<400>3

atggattata cgctcacccg catagatcct aacggtgaga tttggtgact gcgctcctcc 60

aagccagtta cctcggttca aagagttggt agctcagaga accttcgaaa aaccgccctg 120

caaggcggtt ttttcgtttt cagagcaaga gattacgcgc agaccaaaac gatctcaaga 180

agatcatctt attaatcaga taaaatattt ctagatttca gtgcaattta tctcttcaaa 240

tgtagcacct gaagtcagcc ccatacgata taagttgtaa ttctcatgtt tgacagctta 300

tcatcgataa gctttaatgc ggtagtttat cacagttaaa ttgctaacgc agtcaggcac 360

cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg caccgtcacc ctggatgctg 420

taggcatagg cttggttatg ccggtactgc cgggcctctt gcgggatatc gtccattccg 480

acagcatcgc cagtcactat ggcgtgctgc tagcgctata tgcgttgatg caatttctat 540

gcgcacccgt tctcggagca ctgtccgacc gctttggccg ccgcccagtc ctgctcgctt 600

cgctacttgg agccactatc gactacgcga tcatggcgac cacacccgtc ctgtggatcc 660

tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt gctggcgcct 720

atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc atgagcgctt 780

gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc gccatctcct 840

tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct 900

tcctaatgca ggagtcgcat aagggagagc gtcgaccgat gcccttgaga gccttcaacc 960

cagtcagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtct 1020

tctttatcat gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt ttcggcgagg 1080

accgctttcg ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc ggaatcttgc 1140

acgccctcgc tcaagccttc gtcactggtc ccgccaccaa acgtttcggc gagaagcagg 1200

ccattatcgc cggcatggcg gccgacgcgc tgggctacgt cttgctggcg ttcgcgacgc 1260

gaggctggat ggccttcccc attatgattc ttctcgcttc cggcggcatc gggatgcccg 1320

cgttgcaggc catgctgtcc aggcaggtag atgacgacca tcagggacag cttcaaggat 1380

cgctcgcggc tcttaccagc ctaacttcga tcactggacc gctgatcgtc acggcgattt 1440

atgccgcctc ggcgagcaca tggaacgggt tggcatggat tgtaggcgcc gccctatacc 1500

ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg ggccacctcg acctgaatgg 1560

aagccggcgg cacctcgcta acggattcac cactccaaga attggagcca atcaattctt 1620

gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac atatccatcg cgtccgccat 1680

ctccagcagc cgcacgcggc gcatctcggg cagcgttggg tcctggccac gggtgcgcat 1740

gatcgtgctc ctgtcgttga ggacccggct aggctggcgg ggttgcctta ctggttagca 1800

gaatgaatca ccgatacgcg agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac 1860

ctgagcaaca acacattgca gtgaccaatc tgcggacacc ggacgagatt taa 1913

<210>4

<211>40

<212>DNA

< 213>artificial sequence

<400>4

atggattata cgctcacccg catagatcct aacggtgaga 40

<210>5

<211>40

<212>DNA

< 213>artificial sequence

<400>5

cattgcagtg accaatctgc ggacaccgga cgagatttaa 40

Claims (9)

1. albumen, the protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1.

2. the said proteic encoding sox of claim 1.

3. gene according to claim 2 is characterized in that: said protein coding gene is that encoding sequence is the dna molecular shown in the sequence 2 in the sequence table.

4. contain claim 2 or 3 said expression of gene boxes or recombinant expression vector or transgenic cell line or reorganization bacterium.

5. a hydrogen-producing engineering bacteria is the engineering bacteria that the said gene of claim 2 obtains among the deactivation E.aerogenes IAM1183.

6. engineering bacteria as claimed in claim 5 is characterized in that: said deactivation realizes through homologous recombination; Said homologous recombination imports said E.aerogenes IAM1183 with dna fragmentation P and realizes;

Said dna fragmentation P is followed successively by homology arm T to downstream from the upper reaches ₁, dna fragmentation M, homology arm T ₂Said homology arm T ₁With homology arm T ₂Can with said gene generation homologous recombination, the said gene of deactivation; Said dna fragmentation M is the antibiotics resistance fragment.

7. engineering bacteria as claimed in claim 6 is characterized in that: the dna fragmentation that said gene is made up of the nucleotide sequence shown in the sequence in the sequence table 2; Said homology arm T ₁The dna fragmentation of forming by the nucleotide sequence shown in the sequence in the sequence table 4; Said homology arm T ₂The dna fragmentation of forming by the nucleotide sequence shown in the sequence in the sequence table 5; Said dna fragmentation M is the tetracyclin resistance fragment.

8. engineering bacteria as claimed in claim 7 is characterized in that: the nucleotides sequence of said dna fragmentation P is classified the sequence 3 in the sequence table as.

9. the application of arbitrary said engineering bacteria in producing hydrogen in the claim 5 to 8.

Images