CN101633691B - Hydrogen production associated protein, coding genes thereof and application thereof - Google Patents

Abstract

The invention discloses a hydrogen production associated protein, coding genes thereof and application thereof. The hydrogen production associated protein is a protein (a) and a protein (b), wherein the protein (a) has an amino acid sequence represented by the No.1 sequence 1 in a sequence table; and the protein (b) has an amino acid sequence that has substituents of one or more amino acid residues, lacks one or more amino acid residues or has one or more additional amino acid residues and is associated with the hydrogen production and derived from the sequence 1. The hydrogen production associated protein provided by the invention is named as LdhD, and a strain of engineering bacteria is obtained by inactivating the coding genes ldhd of the protein in the E.aerogenes IAM1183. The engineering bacteria have the advantages of strong environmental adaptability, wide substrate range, strong substrate using ability, high hydrogen producing efficiency, and the suitability for biological hydrogen production and have great instruction significance for hydrogen production by the E.aerogenes.

Description

A kind of hydrogen production associated protein and encoding gene thereof and application

Technical field

The present invention relates to a kind of hydrogen production associated protein and encoding gene thereof and application.

Background technology

Nowadays the fossil energy system of having set up since the world industry revolution of 18th century is being faced with two challenges greatly: 1) the fossil energy reserves reduce day by day, are faced with exhausted danger; 2) burning of fossil oil has produced a large amount of pollution substances, particularly CO ₂The Greenhouse effect that the isothermal chamber gas purging causes, the environment of depending on for existence to the mankind brings huge threat.Therefore, the renewable and clean energy resource of Sustainable Development, progressively substituting fossil energy is the grand strategy problem that concerns national energy security, environmental safety and social stability peaceful development.

Hydrogen Energy is as substituting one of clean energy the future that has potentiality, is energy carrier efficiently, has energy density height, cleaning, renewable, products of combustion and be water and characteristics such as pollution-free, is very good renewable energy source.At present, hydrogen mainly transforms (account for hydrogen source 96%) and water electrolysis hydrogen production (accounting for 4%) from the reformation of fossil oil, fails to break away from the dependence to original fossil energy.Therefore, how to utilize renewable resources to obtain the concern widely that hydrogen is subjected to people constantly.Biological hydrogen production is one of important channel that addresses this problem.Biological hydrogen production have normal temperature and pressure reaction, mild condition, environmentally friendly, can utilize discarded biological substance to be advantages such as substrate, can be with environmental pollution improvement, reduce disposal of pollutants and interrelate, be very good hydrogen production process.

The research of modern biological hydrogen production starts from the energy dilemma of the seventies in 20th century, and since the nineties, along with the further understanding of people to Greenhouse effect, biological hydrogen production has caused people's extensive attention more as the hydrogen production process of Sustainable development.Bio-hydrogen production technology comprises optical drive process and two kinds of routes of anaerobically fermenting.The former utilizes photosynthetic bacterium or algae directly conversion of solar energy to be hydrogen, is a very ideal process, but because the light utilising efficiency is very low, factors such as photoreactor difficult design are difficult to push to use at no distant date.What the latter adopted is the hydrogenogens anaerobically fermenting, and its advantage is that product hydrogen speed is fast, reactor design simple and can combines with discarded biological utilization, with respect to the former the easier industrial application that realizes in the near future.

Fermentation method hydrogen manufacturing starts from middle nineteen sixties, and the nineties comes into one's own, but progress and little.Late nineteen nineties is to the beginning of this century, and people recognize that ferment for hydrogen production is easier and realize industrialization in the near future, have increased the scientific research input of dark ferment for hydrogen production aspect greatly, have produced the basic research result of a collection of relevant culture process.The research of the hydrogen production process that combines with the abandoned biomass processing in recent years greatly increases, some of them have reached the pilot scale level, but mainly concentrate on reactor type design, the technical study, and the mixed culture hydrogen generation efficiency is lower than pure culture, total transformation efficiency is not high, and this is the bottleneck place of ferment for hydrogen production just also.Solving the key of ferment for hydrogen production bottleneck, is to realize technological breakthrough, improves the hydrogen yield.Studies show that, only, can't fundamentally break through the low problem of hydrogen generation efficiency, must pay attention to the research and development of highly effective hydrogen yield bacterial classification from the angle of technology.

For many years, the hydrogenogens kind of using in the dark ferment for hydrogen production mainly comprises enterobacter (Enterobacter), fusobacterium (Clostridium), Escherichia (Escherichia) and bacillus (Bacillus), and is wherein maximum with the correlative study of enterobacter and fusobacterium especially.Fusobacterium produces the hydrogen rate and can reach 2.36mol/mol glucose, enteroaerogen belongs to product hydrogen rate and reaches as high as 3mol/mol glucose (being 6mol/mol sucrose) [Kumar, N.and Das, D.Bioprocess Engineering 23,205-208 (2000)], [Kumar, N.andDas, D.Process Biochemistry 35,589-593 (2000)].With clostridium (Clostridium sp) is that the mechanism of the obligatory anaerobic bacteria fermentation and hydrogen production of representative is: generate pyruvic acid after the glucose glycolysis, in forming the acetic acid process, a part of electronics forms hydrogen by ferredoxin under the effect of hydrogen enzyme.One mole glucose can form 4 mol of hydrogen and 2 molecule acetic acid.Therefore, in the time of the obligatory anaerobic bacteria fermentation and hydrogen production, must follow organic acid formation such as acetic acid.Amphimicrobian hydrogenogens E.aerogenes separates approach by sugar and tricarboxylic acid cycle (TCA) approach produces NADH and ATP, the hydrogen enzyme is converted to hydrogen by NADH with proton, producing hydrogen theoretical transformation rate is that 1 mole of glucose forms 12mol hydrogen, is far longer than the hydrogen yield of obligatory anaerobic bacteria.Therefore, E.aerogenes is the important bacterial classification of the efficient ferment for hydrogen production technology of exploitation.

Along with the develop rapidly of biotechnology, the simple bacterial screening and the optimization of culture process can not have been satisfied the demand that improves hydrogen generation efficiency.The research of ferment for hydrogen production need enter cell interior, by the transformation of hydrogen enzyme and metabolism network thereof being strengthened the hydrogen process of producing.On gene pool, can obtain at present to surpass gene order [the Paulette M.Vignais of 100 kinds of hydrogen enzymes, Bernard Billoud, Jacques Meyer.FEMS MicrobiologyReviews 25,455-501 (2001)], but still have the hydrogenase gene of a large amount of known hydrogenogens strains not cloned as yet, seeking more hydrogenase gene is the important directions [Kalia of biological hydrogen production research, V.C., Lal, S., Ghai, R., Mandal, M.and Chauhan, A.Trends in Biotechnology 21,152-156 (2003)].Different hydrogen enzymes have different functions, compare with other enzyme system, and people are also very limited to the understanding of hydrogen enzyme.

At present, the more clearly of research is the gene of colibacillary hydrogen enzyme I, II, III and IV, and they all belong to Ni-Fe hydrogen enzyme, relevant with product hydrogen [Andrews, S.C., Berks of hydrogen enzyme III wherein with IV, B.C., Mcclay, J., Ambler, A., Quail, M.A., Golby, P.and Guest, J.R.Microbiology143,3633-3647 (1997)], and I, II are relevant with suction hydrogen process.The hydrogen enzyme of fusobacterium all belongs to iron hydrogen enzyme, and three clostridial iron hydrogen enzymes have sequencing result, but not clear about its subsidiary gene, regulatory mechanism.Be cloned into clostridial iron hydrogenase gene, and in photosynthetic bacterium, obtained heterogenous expression, strengthened the product hydrogen process of photosynthetic bacteria.The expression of clostridial iron hydrogenase gene in intestinal bacteria be not success but, may be since clostridium and intestinal bacteria for [the Yasuo Asada that causes inequality of the subsidiary gene system of iron hydrogen expression of enzymes, Yoji Koike, JorgSchnackenberg, Masato Miyake, Ieaki Uemura, Jun Miyake.Biochimica etBiophysica Acta 1490,269-278 (2000)].Recently, the method by iron hydrogen enzyme conserved sequence design such as Mishra J. clones the iron hydrogen enzyme about 450bp from E.cloacae IIT-BT08, and in the intestinal bacteria that do not produce hydrogen heterogenous expression, verified its function, the result shows that this hydrogen enzyme is positioned at tenuigenin [Mishra, J., Kumar, N., Ghosh, A.K.and Das, D.International Journal of Hydrogen Energy27,1475-1479 (2002)], [Mishra, J., Khurana, S., Kumar, N., Ghosh, A.K.andDas, D.Biochemical and Biophysical Research Communications 324,679-685 (2004)].The early-stage Study of enteroaerogen E.aerogenes shows, on its cytolemma, the NADH effect that produces in hydrogen enzyme and the cell generates hydrogen [Nakashimada, Y., Rachman, M.A., Kakizono, T.andNishio, N.International Journal of Hydrogen Energy 27,1399-1405 (2002)].Therefore study hydrogen enzyme characteristic, gene and the biological function explore thereof of this Pseudomonas, significant for the technological breakthrough that realizes raising enteroaerogen product hydrogen yield.

Studies show that to what intestinal bacteria produced the hydrogen process intestinal bacteria can directly utilize formic acid, also the formic acid that can produce in assimilation glucide metabolic process is substrate, and under the effect of formic acid lyase system, decompose formic acid generates CO ₂And H ₂[Akihito?Yoshida，Taku?Nishimura，Hideo?Kawaguchi，1?Masayuki?Inui，andHideaki?Yukawa*.Appl?Environ?Microbiol.71：6762-6768(2005)]。It is to produce the fastest approach of hydrogen that formic acid produces the hydrogen approach.

Enteroaerogen is a facultative anaerobe, and fast growth under anaerobic can produce hydrogen, and advantage such as it is wide to have the substrate of utilization scope, and growth adaptability is strong, is the bacterial strain with good industrial proterties.Existing many reports about enteroaerogen product hydrogen, but be mostly aspect technology and cultivation [E.Palazzi, B.Fabiano, P.Perego.Bioproeess Eng.22:205-213 (2000) .], the relevant relevant gene of hydrogen that produces is also without any report.Studies show that, enteroaerogen has the utilize formic acid similar with intestinal bacteria and produces the ability [Tatsuo of hydrogen, K., Shigeharu, T.Mar Biotechnol.7:112-118 (2005) .], and it has the hydrogen of suction process, [the Y.L Ren. that exists that inhales the hydrogen enzyme is promptly arranged, X.H.Xing., C.Zhang., and Z.X.Gou.Biotechnol Lett.27 (14): 1029-1033 (2005) .].Metabolic analysis shows, with glucose be substrate when carrying out ferment for hydrogen production, in its metabolic end product, concentration of lactic acid is near 70%, this also is that to cause in the fermenting process that medium pH descends too fast, thus when suppressing thalli growth and having reduced fermentation to the major cause of the more effective utilization of substrate.

Summary of the invention

The purpose of this invention is to provide a kind of hydrogen production associated protein and encoding gene thereof and application.

Hydrogen production associated protein provided by the invention, name is called LdhD, derives from enteroaerogen E.aerogenesIAM1183, is following (a) or protein (b):

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and with produce hydrogen relevant by sequence 1 deutero-protein.

In order to make the albumen in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG
	8	DYKDDDDK
			Strep-tag?II	8	WSHPQFEK
c-myc	10	EQKLISEEDL

Above-mentioned (b) but in the albumen synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.Proteic encoding gene in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Described proteic encoding gene (ldhd) also belongs to protection scope of the present invention.

Described proteic encoding gene specifically can be following 1) or 2) or 3) dna molecular:

1) its encoding sequence is the dna molecular shown in the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

3) with 1) or 2) dna sequence dna that limits has 90% above homology, and the identical function protein DNA molecule of encoding.

Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

The expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain described proteic encoding gene all belong to protection scope of the present invention.

The present invention also protects a hydrogen-producing engineering bacteria, is that the ldhd gene obtains described in the deactivation E.aerogenes IAM1183.

Described deactivation realizes by homologous recombination, specifically is to change realization by this affine single cross of parents.

Described homologous recombination specifically can import E.aerogenes IAM1183 with suicide carrier pGP704-ldhd and realize; Described suicide carrier pGP704-ldhd be in the multiple clone site insertion sequence table of pGP704 sequence 2 from 5 ' terminal the 363rd to 898 recombinant vectors that deoxyribonucleotide obtains.

The present invention also protects suicide carrier pGP704-ldhd, be in the multiple clone site insertion sequence table of pGP704 sequence 2 from 5 ' terminal the 363rd to 898 recombinant vectors that deoxyribonucleotide obtains.

The transgenic cell line or the reorganization bacterium that contain described suicide carrier pGP704-ldhd all belong to protection scope of the present invention.

Described engineering bacteria can be applicable to biological hydrogen production.

The present invention is a starting strain with the enteroaerogen (E.aerogenes) with highly effective hydrogen yield potentiality, by the ldhd gene in the enteroaerogen (E.aerogenes) is carried out deactivation, obtain a strain hydrogen production potential and improved, utilized the strong engineering bacteria of glucose ability, can be applicable to biological hydrogen production, to utilizing enteroaerogen hydrogen manufacturing, has huge directive significance.

The engineering bacteria that the present invention obtains has the following advantages:

1) starting strain E.aerogenes IAM1183 is a facultative anaerobe, all can grow fast under aerobic, anaerobic condition, and is strong to environmental compatibility; Utilize its carry out biological hydrogen production have the substrate of utilization scope wide, utilize the substrate ability strong and produce the hydrogen advantage of higher, be to have the potential strain excellent that is applied to industrial biological hydrogen preparing.

2) engineering bacteria that obtains of the present invention is except having original bacterium 1) advantage, it is stronger also to have the substrate utilization ability, the characteristics that hydrogen production potential further improves.

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.

Description of drawings

Fig. 1 is the PCR electrophorogram of ldhd gene

Fig. 2 is that the PCR of suicide vector pGP704-ldhd identifies figure

Fig. 3 is monoclonal antibody and the two anti-screening figure of engineering bacteria E.aerogenes IAM1183-Δ ldhd

Fig. 4 is that the PCR of engineering bacteria E.aerogenes IAM1183-Δ ldhd identifies figure

Fig. 5 is the growth curve of engineering bacteria E.aerogenes IAM1183-Δ ldhd

Fig. 6 is the pH change curve in the engineering bacteria E.aerogenes IAM1183-Δ ldhd process of growth

Fig. 7 is the product hydrogen situation of engineering bacteria E.aerogenes IAM1183-Δ ldhd

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Used primer is as follows among the present invention:

Ldh-fw：ATGAAAATCGCSGTTTATAG；

Ldh-rw：TTAGACGATGGCGTTCGGAC；

Ldh-E-fw：cg GAATTCCCGCGCTTACCAGCGTACC；

Ldh-E-rw：cg GAATTCGTCAGGAAAGCCTGATGCCC；

Primer-Pgp-1-fw：CATGCGCTCCATCAAGAAGA；

Primer-Pgp-2-rw：GTGGGTCTCGCGGTATCATT。

Culture medium prescription and purposes related in following examples are as follows:

(1) LB substratum (L ^-1): peptone 10g, yeast soak powder 5g, NaCl 10g, agar powder 15g (adding during solid medium); Be used for bacterial classification short term storage and activation culture.

(2) dextrose culture-medium (L ^-1): glucose 15g, peptone 5g, K ₂HPO ₄3H ₂O 14g, KH ₂PO ₄6g, (NH ₄) ₂SO ₄2g, MgSO ₄7H ₂O 0.2g; Be used for ferment for hydrogen production.

The acquisition of embodiment 1, enteroaerogen ldhd gene

According to the D-serum lactic dehydrogenase of having delivered (D-lactate dehydrogenase) gene order, design a pair of degenerate primer Ldh-fw and Ldh-rw.Genomic dna with enteroaerogen (E.aerogenes IAM1183) (available from using microbe institute of Tokyo Univ Japan (IAM) strain library) is that template is carried out pcr amplification.

The PCR product is carried out agarose gel electrophoresis detect, electrophorogram is seen Fig. 1.Among Fig. 1, the 1:PCR product; 2:Marker.

The result shows, obtained the band that molecular weight is about 900bp.With 4 ℃ of preservations of this PCR product, serve extra large Invitrogen Corporation order-checking, sequencing result shows that the nucleotide sequence that increases is seen the sequence 2 of sequence table, encoding amino acid sequence is the protein of the sequence 1 of sequence table.

Through online comparison, the D-lactatedehydrogenase gene of sequence 2 and Klebsiella pneumoniae subsp has 84% highest homology, and the D-lactate dehydrogenase albumen of sequence 1 and Klebsiella oxytoca and Klebsiella pneumoniae subsp has highest homology.With the DNA called after ldhd gene of nucleotide sequence shown in sequence 2, with the protein called after LdhD albumen of aminoacid sequence shown in sequence 1.

The acquisition of embodiment 2, enteroaerogen E.aerogenes IAM1183-Δ ldhd

One, the structure of suicide vector pGP704-ldhd

Design a pair of primer Ldh-E-fw, the Ldh-E-rw that has EcoR I restriction enzyme site.Genomic dna with enteroaerogen (E.aerogenes IAM1183) is that template is carried out pcr amplification, obtains the fragment of bp more than 540.The EcoRI enzyme is cut the PCR product, with the pGP704[Kolter that EcoR I enzyme is cut, R.Inuzuka, M.and Helinski, D. (1978) .Cell 15:1199-1208, Miller, V.and Mekalanos, J. (1988) .J.Bact.170:2575-2583] connect.Connect product Transformed E .coli DH5 α (the precious biotech firm in Dalian), in the screening of LB paraxin (24mg/mL) resistant panel, the transformant that picking is correct extracts plasmid and carries out the PCR evaluation, and is specific as follows:

According to a pair of primer Primer-Pgp-1-fw of the sequences Design on the pGP704 and Primer-Pgp-2-rw.With primer Ldh-E-fw and Primer-Pgp-2-rw recombinant plasmid is carried out PCR and identify, see the swimming lane 1 of Fig. 2.Equally, with primer Primer-Pgp-1-fw and Ldh-E-rw recombinant plasmid is carried out PCR and identify, see the swimming lane 2 of Fig. 2.Among Fig. 2, swimming lane 3 is the pGP704 plasmid, and swimming lane 4 is Marker.The result shows, has obtained the recombinant plasmid of expection, with its called after pGP704-ldhd suicide vector.

Two, the acquisition of enteroaerogen E.aerogenes IAM1183-Δ ldhd

1, with the pGP704-ldhD suicide vector, the mode by electricity transforms imports original bacterium E.aerogenesIAM1183.

2, the E.aerogenes IAM1183 after will transforming, 37 ℃ of rejuvenation 45 minutes are coated on the enterprising row filter of LB solid plate that contains paraxin (24mg/mL).

3, picking is containing the bacterium colony of growing on the chlorampenicol resistant flat board, is transferred on the two resistance LB flat boards that contain penbritin (100mg/mL) and paraxin (24mg/mL), cultivates 12h.The bacterium colony that to grow on two resistant panel, picking is to new two resistance LB flat boards.

Monoclonal antibody screening and two anti-results of screening are seen Fig. 3.Among Fig. 3, left side figure is two anti-results of screening, and right figure is the monoclonal antibody results of screening.Observe the well-grown of finding 2# bacterium and 5# bacterium.

Extract the genomic dna of 2# bacterium and 5#, use primer Ldh-E-fw and Primer-Pgp-2-rw (A) respectively; Primer-Pgp-2-fw and Ldh-E-rw (B); Ldh-E-fw and Ldh-E-rw (C) carry out PCR as primer to the DNA of 2# and 5# and identify that the result as shown in Figure 4.Among Fig. 4, the 1:2# transformant carries out the product of PCR with primer A; The 2:2# transformant carries out the product of PCR with primer B; The 3:2# transformant carries out the product of PCR with primer C; The 4:5# transformant carries out the product of PCR with primer A; The 5:5# transformant carries out the product of PCR with primer B; The 6:5# transformant carries out the product of PCR with primer C.

The result shows: the 2# transformant is consistent with expected result, is correct transformant; The 5# transformant does not obtain the characteristic strip of expecting, is the false positive thalline.With 2# bacterium called after engineering bacteria E.aerogenes IAM1183-Δ ldhd.

The growth characteristics of embodiment 3, engineering bacteria, product hydrogen performance and metabolism stream

One, the growth characteristics of engineering bacteria, product hydrogen performance and metabolism stream under the shake-flask culture condition

Respectively engineering bacteria E.aerogenes IAM1183-Δ ldhd and wild bacterium E.aerogenes IAM1183 are carried out shake-flask culture, detect their growth characteristics, product hydrogen performance and metabolism stream, concrete steps are as follows:

Dress 20mL dextrose culture-medium inserts substratum with the engineering bacteria after the activation in the 70mL serum bottle, carries out shake-flask culture; Wild bacterium after will activating simultaneously carries out the shake-flask culture of similarity condition, in contrast.

(1) seed culture: activatory engineering bacteria (or wild bacterium) is seeded to the 15ml centrifuge tube that contains 5ml LB substratum, and 37 ℃, 170rpm, airbath overnight incubation obtain kind of a daughter bacteria.

(2) anaerobism shake-flask culture: will plant daughter bacteria and be seeded to the 70ml serum bottle (using the air in nitrogen replacement culturing bottle top and the substratum in advance) that contains the 20ml dextrose culture-medium, inoculum size is 2.5% (v/v).37 ℃, 170rpm, airbath were cultivated 24 hours.

Utilize spectrophotometer (UV-1206, SHIMADZU company (Japan)) to measure the growing state of thalline; Utilize pH meter (CHN060 (828), ORION company (U.S.)) to measure the changing conditions of pH.Cultivate and after 16 hours meta-bolites is detected.Behind fermented product centrifuging and taking supernatant, filter.Utilize the output and the composition of high-pressure liquid chromatography metabolite.High-pressure liquid phase gas spectrum is (HPLC-10A, SHIMADZU company (Japan).Three repetitions are established in test, and all results are multiple mean value three times, represent with mean+SD.

The OD of engineering bacteria and wild bacterium ₆₀₀Variation see Fig. 5, the pH of the nutrient solution of engineering bacteria and wild bacterium changes and sees Fig. 6.The product hydrogen situation of engineering bacteria and wild bacterium changes sees Fig. 7; The metabolic flux analysis of engineering bacteria the results are shown in Table 2.

The metabolic flux analysis (n=3) of table 2E.aerogenes IAM1183-Δ ldhd engineering bacteria

The result shows: the 1) OD of engineering bacteria ₆₀₀Obviously improve.2) the pH value lowering speed of engineering bacteria is less than wild bacterium, and when pH=5.5, no longer descends.3) utilization ratio of engineering bacteria glucose reaches 100%, is higher than the utilization ratio 57.7% of wild bacterium, illustrates that the deactivation of Δ ldhd can effectively increase the flux that produces the hydrogen pathways metabolism, produces the hydrogen yield thereby improve cell.3) growing amount of engineering bacteria lactic acid is much smaller than wild bacterium.5) 2 of engineering bacteria, 3-butyleneglycol, succsinic acid and alcoholic acid yield all increase to some extent than wild bacterium, and above-mentioned substance all is to rely on NADH in the born of the same parents and the meta-bolites that produces, demonstrate the increase of available reducing power in the born of the same parents, and this is an essential condition that helps producing hydrogen.6) acetate of engineering bacteria and ethanol production sum have the raising of certain amplitude than wild type strain, show that formic acid produces the hydrogen approach and is reinforced in producing the hydrogen process, have reached the effect of the product hydrogen of expection.

Two, jar fermentation

For hydrogen production potential and the substrate utilization ability and the metabolism flow direction that detects engineering bacteria E.aerogenes IAM1183-Δ ldhd, carry out following operation:

The E.aerogenes IAM1183-Δ ldhd engineering bacteria that activation is good is inoculated in the LB substratum of 30mL, and incubated overnight obtains seed liquor.The 60mL seed liquor is inoculated in the 5L fermentor tank that contains the 3L dextrose culture-medium, and 37 ℃ are carried out anaerobically fermenting.Detect amounts of hydrogen and the meta-bolites produced, the same step 1 of method.The operation of wild bacterium is the same, in contrast.The results are shown in Table 3.

The hydrogen output and the metabolic flux analysis of table 3 E.aerogenes IAM1183-Δ ldhd engineering bacteria

The result shows: 1) output of engineering bacteria hydrogen is 1.9 times of wild bacterium.2) growing state of engineering bacteria is better than original bacterium, whole OD ₆₀₀Be 1.5 times of original bacterium.3) engineering bacteria pH lowering speed is much smaller than wild bacterium, and when dropping to 5.5, then no longer descends, and along with the prolongation of incubation time, pH value is slightly gone up, and illustrates that the organic acid of generation is partially consumed.4) utilization ratio of engineering bacteria glucose can reach 98.9%, much larger than 85.8% of wild bacterium.5) growing amount of engineering bacteria lactic acid is far smaller than wild bacterium.6) engineering bacteria succsinic acid, formic acid, acetate, 2,3-butyleneglycol, alcoholic acid output are greater than wild bacterium.

Test shows, the deactivation meeting of target gene is caused the variation of corresponding enzymic activity in the born of the same parents, and then changes metabolic flux, increases the output of target product.The biological character that hydrogen is produced in the fermentation of engineering strain E.aerogenes IAM1183-Δ ldhd is better than wild bacterium far away, is to have potentiality hydrogen manufacturing bacterial classification.

Sequence table

＜110〉Tsing-Hua University

＜120〉a kind of hydrogen production associated protein and encoding gene thereof and application

<130>CGGNARY81498

<160>2

<210>1

<211>329

<212>PRT

＜213〉enteroaerogen (E.aerogenes)

<400>1

Met?Lys?Ile?Ala?Val?Tyr?Ser?Thr?Lys?Gln?Tyr?Asp?Lys?Lys?Tyr?Leu

1 5 10 15

Gln?His?Val?Asn?Asp?Thr?Tyr?Gly?Phe?Glu?Leu?Glu?Phe?Phe?Asp?Phe

20 25 30

Leu?Leu?Thr?Glu?Lys?Thr?Ala?Lys?Thr?Ala?Asn?Gly?Cys?Glu?Ala?Val

35 40 45

Cys?Ile?Phe?Val?Asn?Asp?Asp?Gly?Ser?Arg?Pro?Val?Leu?Glu?Glu?Leu

50 55 60

Lys?Ala?Tyr?Gly?Val?Lys?Tyr?Ile?Ala?Leu?Arg?Cys?Ala?Gly?Phe?Asn

65 70 75 80

Asn?Val?Asp?Leu?Asp?Ala?Ala?Lys?Glu?Leu?Gly?Leu?Arg?Val?Val?Arg

85 90 95

Val?Pro?Ala?Tyr?Ser?Pro?Glu?Ala?Val?Ala?Glu?His?Ala?Val?Gly?Met

100 105 110

Met?Met?Ser?Leu?Asn?Arg?Arg?Ile?His?Arg?Ala?Tyr?Gln?Arg?Thr?Arg

115 120 125

Asp?Ala?Asn?Phe?Ser?Leu?Glu?Gly?Leu?Thr?Gly?Phe?Thr?Met?His?Gly

130 135 140

Lys?Thr?Ala?Gly?Val?Ile?Gly?Thr?Gly?Lys?Ile?Gly?Val?Ala?Thr?Leu

145 150 155 160

Arg?Ile?Leu?Lys?Gly?Phe?Gly?Met?Arg?Leu?Leu?Ala?Phe?Asp?Pro?Tyr

165 170 175

Pro?Ser?Ala?Ala?Ala?Leu?Asp?Leu?Gly?Val?Glu?Tyr?Val?Asp?Leu?Pro

180 185 190

Thr?Leu?Tyr?Ala?Gln?Ser?Asp?Val?Ile?Ser?Leu?His?Cys?Pro?Leu?Thr

195 200 205

Glu?Glu?Asn?Tyr?His?Leu?Leu?Asn?His?Ala?Ala?Phe?Glu?Gln?Met?Lys

210 215 220

Asp?Gly?Val?Met?Val?Ile?Asn?Thr?Ser?Arg?Gly?Ala?Leu?Ile?Asp?Ser

225 230 235 240

Gln?Ala?Ala?Ile?Asp?Ala?Leu?Lys?His?Gln?Lys?Ile?Gly?Ala?Leu?Gly

245 250 255

Met?Asp?Val?Tyr?Glu?Asn?Glu?Arg?Asp?Leu?Phe?Phe?Glu?Asp?Lys?Ser

260 265 270

Asn?Asp?Val?Ile?Gln?Asp?Asp?Val?Phe?Arg?Arg?Leu?Ser?Ala?Cys?His

275 280 285

Asn?Val?Leu?Phe?Thr?Gly?His?Gln?Ala?Phe?Leu?Thr?Ala?Glu?Ala?Leu

290 295 300

Ile?Ser?Ile?Ser?Gln?Thr?Thr?Leu?Asp?Asn?Leu?Arg?Gln?Val?Asp?Ala

305 310 315 320

Gly?Glu?Thr?Cys?Pro?Asn?Ala?Ile?Val

325

<210>2

<211>990

<212>DNA

＜213〉enteroaerogen (E.aerogenes)

<400>2

atgaaaatcg?ccgtttatag?tacgaagcag?tacgataaaa?agtaccttca?gcatgttaat 60

gatacatatg?gctttgaact?cgaatttttc?gacttcctgt?taaccgaaaa?aaccgcgaaa 120

acggccaacg?gctgtgaagc?cgtgtgcata?tttgtcaacg?atgacggcag?ccgtccggtg 180

ctggaagagc?tgaaagcata?cggggtgaag?tacatcgccc?tgcgctgcgc?cgggtttaac 240

aacgtcgatc?tggatgcggc?aaaagagctg?ggtctgcgcg?ttgtccgcgt?tcccgcctat 300

tcgccggaag?ccgtggctga?acatgccgtc?ggcatgatga?tgtcgttgaa?ccgccgcatc 360

caccgcgctt?accagcgtac?ccgcgatgct?aacttctcgc?tggaaggctt?aaccggcttt 420

accatgcacg?gtaaaaccgc?cggggtgatc?gggaccggca?aaatcggcgt?cgccacgctg 480

cgtattctga?aagggtttgg?catgcgcctg?ctggcgttcg?atccctatcc?aagcgccgca 540

gcgctggatc?tcggcgtcga?gtatgttgat?ttgccgacgc?tgtatgcaca?gtccgatgtg 600

atctccctgc?actgtccgct?gacggaagag?aactaccatc?tgctgaatca?tgcggcgttt 660

gagcaaatga?aagacggcgt?gatggtgatc?aacaccagcc?gcggggcgct?gattgattct 720

caggcggcga?tcgatgcgct?gaaacaccag?aaaatcgggg?cgctgggcat?ggacgtgtat 780

gagaacgaac?gcgacctgtt?cttcgaagat?aagtccaatg?acgtgattca?ggatgacgtc 840

ttccgtcgcc?tgtctgcctg?tcataacgtg?ttgttcaccg?ggcatcaggc?tttcctgacc 900

gccgaagcgc?tgatcagcat?ttcacaaacg?accctggata?acctgcgcca?ggtcgatgct 960

ggcgaaacct?gtccgaacgc?catcgtctaa 990

Claims (14)

1. albumen, the protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1.

2. the described proteic encoding gene of claim 1.

3. gene according to claim 2 is characterized in that: described proteic coding gene sequence is the dna molecular shown in the sequence 2 in the sequence table.

4. contain claim 2 or 3 described expression of gene boxes.

5. the recombinant expression vector that contains claim 2 or 3 described genes.

6. the transgenic cell line that contains claim 2 or 3 described genes.

7. the reorganization bacterium that contains claim 2 or 3 described genes.

8. a hydrogen-producing engineering bacteria is the engineering bacteria that the described gene of claim 2 obtains among the deactivation E.aerogenes IAM1183.

9. engineering bacteria as claimed in claim 8 is characterized in that: described deactivation realizes by homologous recombination.

10. engineering bacteria as claimed in claim 9 is characterized in that: described homologous recombination imports E.aerogenes IAM1183 with suicide carrier pGP704-ldhd and realizes; Described suicide carrier pGP704-ldhd be in the multiple clone site insertion sequence table of pGP704 sequence 2 from 5 ' terminal the 363rd to 898 recombinant vectors that deoxyribonucleotide obtains.

11. suicide carrier pGP704-ldhd, be in the multiple clone site insertion sequence table of pGP704 sequence 2 from 5 ' terminal the 363rd to 898 recombinant vectors that deoxyribonucleotide obtains.

12. contain the transgenic cell line of the described suicide carrier of claim 11.

13. contain the reorganization bacterium of the described suicide carrier of claim 11.

14. the application of arbitrary described engineering bacteria in producing hydrogen in the claim 8 to 10.

Images