CN101423815B - Recombinant acetone-butanol clostridium and construction method and use thereof - Google Patents
Recombinant acetone-butanol clostridium and construction method and use thereof Download PDFInfo
- Publication number
- CN101423815B CN101423815B CN2008102395607A CN200810239560A CN101423815B CN 101423815 B CN101423815 B CN 101423815B CN 2008102395607 A CN2008102395607 A CN 2008102395607A CN 200810239560 A CN200810239560 A CN 200810239560A CN 101423815 B CN101423815 B CN 101423815B
- Authority
- CN
- China
- Prior art keywords
- leu
- ile
- gly
- sequence
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Abstract
The invention discloses a recombinant acetone butanol clostridium, a method for constructing the same and application thereof. The method for constructing the recombinant acetone butanol clostridium is to introduce a DNA fragment containing an encoding gene of a hydrophilic part of a FoF1 type ATP synthase into an acetone butanol clostridium to construct a recombinant bacterium. The invention also discloses a method for producing butanol, which is to ferment and culture the recombinant bacterium constructed by the method for constructing the recombinant acetone butanol clostridium to produce the butanol. The yield of butanol produced through fermenting the recombinant acetone butanol clostridium constructed by the invention can reach as high as 13.7 grams per liter.
Description
Technical field
The present invention relates to recombinant acetone-butanol clostridium and construction process thereof and application.
Background technology
Along with the continuous minimizing of petroleum resources and climbing up and up of Nonrenewable resources price, developing eco-friendly bio-based product has become the strategic demand of transforming mode of economic growth, ensureing the ecological chain benign cycle, realize the sustainable development of socio-economy.Butanols (Butanol) is a kind of important chemical material, is mainly used in to make softening agent, solvent and extraction agent etc.Butanols is again a kind of novel biological fuel that has potentiality, and its calorific value, octane value and gasoline are suitable; Methyl tertiary butyl ether commonly used in oxygen level and the gasoline is close; Can corrosion pipeline, be convenient to pipe-line transportation; Steam forces down, and is safe, and can with gasoline with any than mixing.
Butanols can be produced two kinds of methods by fermentation method and petrochemical complex and produce.The fermentation process of butanols claims ABE again, and (Ethanol) fermentation prevails in 20 th Century, once is to be only second to alcoholic acid world's second largest fermentation industry for Acetone, Butanol.After the 1950's, because the maturation of petrochemical industry synthetic technology causes the fermentative Production butanols no longer to have the white war advantage, the butylic fermentation market of fading out gradually.After the seventies, along with the appearance of oil crisis and rising steadily of International Crude Oil, countries in the world increase day by day to the worry of energy security and resource security, and people begin to pay close attention to the fermentative production of butanols again.Along with biological fast development, the molecule mechanism of microorganisms producing butanols has obtained understanding more fully.Clostridium acetobutylicum (Clostridiumacetobutylicum) the ATCC824 genome sequence of delivering as calendar year 2001, the biosynthesizing of being familiar with butanols for people provides a complete frame diagram, then the proteomic techniques that grows up based on genome-based technologies, transcribe learn a skill, means such as metabolism network modelling are applied in the biosynthetic Mechanism Study of butanols, make people enter new epoch for the understanding of the biosynthesizing mechanism of butanols.
The biosynthesizing mechanism of understanding butanols except increasing the mankind to the natural understanding, be the more important thing is and utilized these understanding, goes to transform organism, enables to show the performance useful to the mankind.Papoutsakis leader's in 1992 study group expresses the key gene in the acetone route of synthesis for the first time in clostridium acetobutylicum, opened by the gene level operation acetone clostridial beginning.But in the ten years development process, transform the example of clostridium acetobutylicum and unlike other industrial producing strain, significant progress is arranged in the past by genetic method.Major cause can be summed up as two aspects, and the one, because clostridium acetobutylicum is a kind of bacterium of strictly anaerobic, culture device and condition that needs are special, this has just determined it not obtain extensive studies as other gets well foster or amphimicrobian bacterial strain; The 2nd, because the efficient of the genetic manipulation of clostridium acetobutylicum is very low, not only need special equipment for the operation of this bacterium, also need experience and technology, and workload is bigger.Had scientist to develop in 2007 fortunately and to be applicable to clostridial intron insert type gene knockout system, this will quicken the development of production of butanol metabolic engineering.
The biosynthetic process of butanols has more complicated pathways metabolism and regulatory mechanism than ethanol fermentation, lactic fermentation.There are some researches show that the key gene (as alcohol dehydrogenase gene adhE, butanols desaturase bdh) in the overexpression butanols route of synthesis can not improve the output of butanols.The main process of producing the butanols approach in the clostridium is to generate pyruvic acid by the glycolytic pathway decomposition glucose, and pyruvic acid produces butanols through series reaction again.Therefore improve the production of butanol ability and can pass through to strengthen the metabolic flux of glycolytic pathway, thereby increase the utilising efficiency of glucose, more pyruvic acid precursor will be provided like this.Glycolytic pathway carries out the reorganization of carbon skeleton except utilizing carbon source, also can provide cell physiological movable essential energy.In some bacterium, increase the metabolic flux that intracellular energy expenditure can strengthen glycolytic pathway.
Summary of the invention
The purpose of this invention is to provide a kind of recombinant acetone-butanol clostridium and construction process thereof and application.
The method of structure recombinant acetone-butanol clostridium provided by the present invention is that the dna fragmentation of encoding gene that will contain the hydrophilic segment of FoF1 type atp synthase imports and to make up the reorganization bacterium in the clostridium acetobutylicum.
Wherein, the dna fragmentation of the encoding gene of the hydrophilic segment of the described FoF1 of containing type atp synthase comprises the encoding gene of the hydrophilic segment of thiolase promotor and FoF1 type atp synthase according to this to the downstream from the upstream; The nucleotide sequence of described thiolase promotor is shown in the sequence in the sequence table 2.
The hydrophilic segment of described FoF1 type atp synthase comprises three kinds of albumen, described three kinds of albumen be following a) or b):
A) its aminoacid sequence is respectively sequence 3, sequence 4 and the sequence 5 in the sequence table;
B) in the aminoacid sequence that sequence 3, sequence 4 or sequence 5 limit in sequence table through replacing and/or disappearance and/or add one or several amino acid by a) deutero-protein.
For the albumen in making a) is convenient to purifying, label as shown in table 1 on proteinic N-terminal that can the aminoacid sequence shown in sequence 3, sequence 4 and/or the sequence 5 is formed in by sequence table or C-terminal connect.
The sequence of table 1. label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag?II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned b) but in the albumen synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.Above-mentioned b) the proteic encoding gene in can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 1, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.
The encoding gene of the hydrophilic segment of described FoF1 type atp synthase can be following 1) or 2) or 3) gene:
1) its nucleotide sequence is a sequence 1 in the sequence table;
2) dna molecular of the hydrophilic segment of dna sequence dna hybridization that under stringent condition, can limit with sequence in the sequence table 1 and coding FoF1 type atp synthase;
3) with 1) gene have the homology 90% or more and the dna molecular of the hydrophilic segment of the FoF1 type atp synthase of encoding.
Gene in the described step 3) is with 1) gene homology more than 95% is preferably arranged.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 68 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
The dna fragmentation of the encoding gene of the hydrophilic segment of the described FoF1 of containing type atp synthase is also through methylating modification.Described starting strain clostridium acetobutylicum is a clostridium acetobutylicum SMB-1 CGMCC № .2287 (Chinese patent: 200810102673.2).
The reorganization bacterium that is made up by the method for described structure recombinant acetone-butanol clostridium also belongs to protection scope of the present invention.
Wherein, described recombinant acetone-butanol clostridium can be clostridium acetobutylicum (Clostridiumacetobutylicum) SMB-1 (pITF1) CGMCC No.2796.
Another object of the present invention provides a kind of method of producing butanols.
The method of production butanols provided by the present invention is that the described recombinant acetone-butanol clostridium of fermentation culture is produced butanols.
Wherein, the substratum of every liter of fermentation culture is made up of following material: KH
2PO
40.5-1.0g; K
2HPO
43H
2O0.5-1.0g; MgSO
47H
2O 0.2-1.0g; MnSO
4H
2O 0.01-0.05g; FeSO
47H
2O 0.01-0.05g; NaCl 0.1-2.0g; Yeast powder 2.0-10.0g; (NH4)
2SO
40.5-4.0g; Glucose 40-80g.
The erythromycin that also contains 25-100mg/L in the described fermention medium, described fermentation culture conditions is 4.5-5.5 for fermentation pH, culture temperature 35-40 ℃, 180-250rpm.
The present invention is with FoF1 type atp synthase (the FoF1-type ATP synthase in the clostridium acetobutylicum, the encoding gene (atpAGD) of hydrophilic segment ATPase) (F1 part) is transformed in the clostridium cell, the free ATPase F1 part that overexpression atpAGD produces, ATP in the hydrolysis born of the same parents, thereby make the decline of ATP concentration in the cell, this like cell will be adjusted the metabolism of self to supply more ATP, main mode of metabolism of adjusting self strengthens glucolytic metabolic flux exactly, thereby has improved the fermentative production speed of butanols.The productive rate of the recombinant acetone-butanol clostridium fermentative production butanols that the present invention makes up can reach 13.7g/L.
Description of drawings
Fig. 1 is a recombinant plasmid pITF1 structural representation.
Fig. 2 identifies clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1) for PCR.
Embodiment
Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.
Yeast powder is available from Britain OXOID company (catalog number (Cat.No.) 1023098), and peptone is available from Britain OXOID company (catalog number (Cat.No.) 594566), and extractum carnis is available from Beijing bispin microbiological culture media products factory.
Every liter of reinforced clostridial medium (RCM) contains yeast powder 3.0g, peptone 10.0g, and extractum carnis 10.0g, glucose 5.0g, starch 10.0g, sodium acetate 3.0g, L-cysteine hydrochloride 0.5g, pH 6.8.
Every liter of fermention medium contains KH
2PO
40.75g; K
2HPO
43H
2O 0.75g; MgSO
47H
2O 0.4g; MnSO
4H
2O0.01g; FeSO
47H
2O 0.01g; NaCl 1.0g; Yeast extract 5.0g; (NH4)
2SO
42.0g; Glucose 65g.
Experimental result among the following embodiment is the mean value of three repeated experiments.
The clostridium acetobutylicum of the hydrophilic segment of embodiment 1, construction expression FoF1 type atp synthase
Adopt reagent such as N,O-Diacetylmuramidase, SDS to destroy the conventional bacterial genomes extracting method of cell walls, extract clostridium acetobutylicum (Clostridium acetobutylicum) ATCC 824 (American type culture collection, U.S. Pat 7432090) genomic dna, according to conventional PCR method, use high-fidelity DNA polymerase Pfu amplification thiolase promoter region (Pthl) and atpAGD gene coding region (atpA, atpG, three genes of atpD are in an operon), primer sees Table 1.
The nucleotide sequence of table 2. primer
| The primer title | Sequence | Restriction enzyme site |
| Pthl-F | agt gtcgactatattgataaaaataataatagtggg | Sal?I |
| Pthl-R | cgt ggatccttctttcattctaactaacctcc | BamH?I |
| atpAGD-F | gtcc ggatccatgaacataaaacctgaagagataacttcaataataaaaag | BamH?I |
| atpAGD-R | gtcc gaattcccttagctttccatcatttttttagctttttcttttacatc | EcoR?I |
The product cloning of pcr amplification thiolase promoter region in the pMD18-T carrier, is obtained the pMD18-T-Pthl carrier, order-checking, sequencing result shows that the nucleotide sequence of Pthl is shown in sequence in the sequence table 2.
With the product cloning of pcr amplification atpAGD gene coding region in the pMD18-T carrier, obtain the pMD18-T-atpAGD carrier, order-checking, sequencing result shows that the nucleotide sequence of atpAGD is shown in sequence in the sequence table 1, the hydrophilic segment of coding FoF1 type atp synthase, the hydrophilic segment of FoF1 type atp synthase contains albumen in 3, this in 3 proteic aminoacid sequence be respectively sequence 3 in the sequence table (by sequence in the sequence table 1 from 5 ' terminal 1-1515 position coding), sequence 4 (encoding from 5 ' terminal 1550-2395 position) and sequence 5 (sequence 1 is from 5 ' terminal 2411-3809 position coding in by sequence table) by sequence in the sequence table 1.
Sal I and BamH I enzyme are cut amplification thiolase promoter region (Pthl) that obtains and the pIMP1 carrier (Mermelstein that cuts through same enzyme, L.D., N.E.Welker, G.N.Bennett, and E.T.Papoutsakis. (1992) .Expression of cloned homologous fermentative genes inClostridium acetobutylicum ATCC 824.Bio/Technology.10:190-195) (Institute of Microorganism, Academia Sinica) connects structure recombinant vectors pIMP1-Pthl, is connected structure recombinant expression vector pITF1 (Fig. 1) with the atpAGD fragment that EcoR I enzyme is cut the pcr amplification acquisition with the pIMP1-Pthl of same double digestion with BamH I then.
Owing to proved among clostridium acetobutylicum (Clostridium acetobutlicum) ATCC 824 and contained restriction enzyme Cac824I, can cut unmethylated foreign DNA, therefore to clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 CGMCC № .2287 (Chinese patent:200810102673.2) transform before to the recombinant expression vector pITF1 modification that methylates. concrete operation step changes E.coli ER2275 (pAN1) (Mermelstein over to for the pITF1 that extracts from E.coliJM109; L.D.and E.T.Papoutsakis (1993). " In vivo methylation in Escherichia coli by theBacillus subtilis phage phi 3T I methyltransferase to protect plasmids fromrestriction upon transformation of Clostridium acetobutylicum ATCC 824. " Appl.Environ.Microbiol.59 (4): 1077-1081.) methylate in (Institute of Microorganism, Academia Sinica), obtain methylated recombinant expression carrier pITF1.
The competent substratum of preparation clostridium is reinforced clostridial medium (RCM).Clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 CGMCC № .2287 thalli growth is to OD
600=0.8 o'clock, collect thalline, with ETB solution (pH 7.4 for 270mM sucrose, 5mM SODIUM PHOSPHATE, MONOBASIC) washing thalline twice, use an amount of ETB solution suspension thalline at last, be distributed into 600 μ l/ and manage to be transformed.All operations keeps thalline to reach (4 ℃ centrifugal) on ice at anaerobic state.
Methylated recombinant expression vector pITF1 is mixed with thalline, place 10min on ice, then mixture is transferred in the 4mm electric shock cup and transforms, the electricity that uses transforms parameter: voltage 2.0kV, electric capacity 25 μ F, resistance ∞, the typical case is 12ms-19ms the electric shock time length.Electricity goes to bacterium liquid in the 10ml RCM substratum after transforming and finishing immediately, and rejuvenation 6-8h coats on the RCM flat board that contains 25 μ g/ml erythromycin, cultivates 36h for 37 ℃.
Picking erythromycin resistance colony inoculation extracts genomic dna behind the cultivation 24h in containing 50 μ g/ml erythromycin liquid nutrient mediums at random, carries out PCR with following primer and identifies.
pIMP1-F：gaggcaaatgaaatagattgacctccc；
pIMP1-R：gtgctgcaaggcgattaagttgggtaac。
PCR product electrophoresis result as shown in Figure 2, pITF1 has been transformed in the clostridium cell, this bacterial strain called after clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1).
Changed clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 of methylated pIMP1 carrier over to, called after clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pIMP1), in contrast.
Clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pIMP1) is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 10th, 2008 and (is called for short CGMCC, address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), deposit number is CGMCCNo.2800.
" 1 " representation DNA molecular weight standard among Fig. 2, " 2 " represent clostridium acetobutylicum (Clostridiumacetobutylicum) SMB-1 (pITF1), and " 3 " represent clostridium acetobutylicum (Clostridiumacetobutylicum) SMB-1 (pIMP1).
With clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1) in containing the RCM substratum of 50mg/L erythromycin 37 ℃ leave standstill and be cultured to logarithmic phase, as fermentation seed liquid.
Fermentation seed liquid is that 5% amount is inoculated in the 7L fermentor tank that the 3L fermention medium is housed according to volume percent, the erythromycin that adds 50mg/L simultaneously, auto-feeding 4M NaOH control fermentor tank pH is that 5.0 (pH is not initially controlled in fermentation, when fermented liquid pH drops to after 5.0, NaOH by auto-feeding 4mol/L controls pH automatically 5.0), 37 ℃, 220rpm ferments.With the fermented liquid of liquid chromatographic detection fermentation after 52 and 60 hours.With clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pIMP1) and clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 CGMCC № .2287 in contrast.The liquid chromatographic detection condition is: sample pre-treatments: the centrifugal 1min of 12000rpm, get supernatant liquor, with 0.22 μ m membrane filtration; Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4, flow velocity 0.5ml/min.The butanols standard substance are available from Sigma company (catalog number (Cat.No.): 4C006217); The retention time of standard substance is 40.9 minutes under as above chromatographic condition.
The result of the fermented liquid of table 1. liquid chromatographic detection 52 and 60 hours
| Bacterial strain | Fermentation period (h) | Butanols (g/L) | Acetone (g/L) | Ethanol (g/L) | Production of butanol rate (g/L/h) |
| Clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 CGMCC № .2287 | 60 | 12.3 | 3.9 | 1.3 | 0.21 |
| Clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pIMP1) | 60 | 12.5 | 3.9 | 1.1 | 0.21 |
| Clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1) | 52 | 13.7 | 2.7 | 2.0 | 0.26 |
Strain bacterium among clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1) is after fermentation 52 hours, butanols output in its fermented liquid is 13.7 (g/L), bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 10th, 2008 (is called for short CGMCC, address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), deposit number is CGMCCNo.2796.
Sequence table
＜110〉Institute of Microorganism, Academia Sinica
＜120〉recombinant acetone-butanol clostridium and construction process thereof and application
<130>CGGNARW82067
<160>5
<210>1
<211>3767
<212>DNA
＜213〉clostridium acetobutylicum (Clostridium acetobutylicum)
<400>1
atgaacataa?aacctgaaga?gataacttca?ataataaaaa?gtcagattga?gggatatgaa 60
agtaaattag?aaacagtaga?ttcaggtacg?ataatagaaa?taggtgatgg?tatcgctaga 120
atatacggct?tacaaaattg?tatggctggc?gaacttcttg?agtttccaaa?cgatgtgtat 180
ggaatggctc?taaatcttga?acaagacaat?gttggatgtg?ttttacttgg?ttcagaagaa 240
ggaatcaaag?aaggagacat?tgttaaaagt?acaggaaaag?ttgttgaagt?gcctgttggt 300
gaagaaatgc?ttggaagagt?agtaaatgct?cttggtcaac?caatagatgg?taaaggacca 360
attaaagcag?aagattcaaa?accagtagat?ataaaagcta?caggagttat?tgatagacaa 420
tcagttaatc?aaccacttca?aacaggtata?aaagccatag?actcaatgat?acctattgga 480
aaaggacaaa?gagaacttat?tataggagat?agacagacag?gtaaaactgc?tatagctatc 540
gatactatat?tgaatcaaaa?aggaaaagat?gtaatttgta?tatatgttgc?tataggtcaa 600
aaacaatcta?cagtagcaca?tatagttaat?acatttgaag?aaatgggagc?tatggattac 660
agcatagttg?tagcagcaac?tgcttcagat?tcagcaccac?ttcaatattt?agcaccatat 720
tcaggtgtaa?caattgcaga?aaactttatg?tttaaaggaa?aagatgtact?tattgtatat 780
gatgatcttt?caaagcacgc?tgttgcatac?agaacgatgt?cattactttt?acgtagacca 840
ccaggcagag?aggcataccc?tggagatgta?ttctacttac?attcaagact?tcttgaaaga 900
gctgctaaac?tttcacagaa?acttggagga?ggttctataa?cagcacttcc?tataatagaa 960
actcttgctg?gtgatgttgc?gggttacata?ccaacaaatg?ttatttctat?aacagatggt 1020
caaatattcc?ttgaatcaga?attattctat?gcaggacaaa?gaccagctgt?taactcaggt 1080
atatcagtat?ccagagttgg?tggtagtgct?caaattaaag?caatgaaaaa?actttcagga 1140
actttaagac?ttgagcttgc?acaatatagg?gaacttgctg?catttgctca?gtttggttct 1200
gaccttgata?aagaatctaa?aaagagactt?gaaaaaggta?aaagacttac?tgaaatgatg 1260
aaacagcctc?aatataagcc?aatgccagtt?gagaaacaaa?taatgatttt?atatgctgtt 1320
gtaaatgagt?atgtaatgga?tattgatgtt?tcaaaactta?gtgcatttga?aagtggatta 1380
tttgagtatg?tagatgctca?ttatagagac?ttaggtaagc?aaatacttga?gaaaaaagag 1440
ctaactgatg?atataagcag?tcagcttacc?aaagctatta?acgaatataa?aaagatattt 1500
ttagcagagg?aacagtagtt?aatgactttc?ctatgcagga?ggtgaagtaa?tggcaggagc 1560
aggacttatt?attataaaaa?gaagaattaa?gtctattacg?aatactaaaa?aaataacaaa 1620
cgccatggga?cttatagcca?cctctaattt?aagaaaatct?agacagaatc?tcgaagcgaa 1680
taaagcatat?tatgaagctt?ttaatgatgt?tataaataag?attgtaagtt?cttctagtaa 1740
gagcaactta?tatgtagctg?gaaataaaag?tgacaaaaaa?ctttatatag?ctttgacttc 1800
tgattctggt?ctttgtggag?gttttaacgg?agctgttgta?actgctgctg?acaatgttat 1860
gagaggggat?aaagataaat?ccttacttat?aactgttggt?caaaagggaa?tatcttattt 1920
taaaaggctt?aaatatgaga?ctttatccga?atacgttgat?attccaaacg?agccaggatt 1980
aaaagaagct?aaggaaatag?cagaccgtgc?tttaagtctt?tatgaaaaag?gcgaaatagg 2040
agaagttcat?gttatttata?ctcaatttct?ttctacggta?aatcaaaaag?ttgaggtaaa 2100
gaaggtactc?cctattgaac?ctaaaaagat?ggaaaaagtg?agtgtagctg?aatttgaacc 2160
agatgcagaa?attatacttg?aaaaagctat?aaggcttcat?attgaacagc?agttatttaa 2220
cttgttatta?aattctaagg?caagtgagca?ggcatctaga?atgtcctcaa?tggatagtgc 2280
tactaaaaat?gccaatgact?tacttgatgc?tttaaatatt?aagtataata?gaattagaca 2340
aagtgctatt?actcaagaaa?taacagaaat?agttggagga?gcggaagctc?tcaaataagg 2400
agggaaactg?atgccagaac?atgtaggtaa?aattgttcag?gtaataggac?ctgttgtgga 2460
tattaaattt?gatgcagaga?accttcctga?catctataat?tccatagaaa?tagatatggg 2520
agataataaa?aaactcattg?ctgaagttga?acaacatgta?ggagatgaca?tagtaagaac 2580
aatagcaatg?gaaggtactg?acggattaaa?aagaggaatg?gaagcagtta?acactggtaa 2640
accaatatct?gtaccagttg?gagaaaatgt?tttaggacgt?ctttttaatg?ttttaggtca 2700
gacaatagat?gaagcaggag?acatgaatgc?tgataagtat?tatccaattc?atagaccagc 2760
tccaaccttt?gaagaacaat?cagttcaacc?agaaatgttt?gaaacaggta?ttaaggttat 2820
agatttactt?gctccatatc?aaaagggtgg?aaaaatcggt?ttgttcggtg?gtgccggtgt 2880
tggtaaaaca?gttcttattc?aggaacttat?aaataatata?gcaaaagaac?acggtggatt 2940
atcagtattc?acaggtgttg?gagaaagaac?aagagaaggt?aatgaccttt?attatgaaat 3000
gaaagattca?ggagttataa?ataaaacagc?tctagtattt?ggtcagatga?atgaaccacc 3060
tggcgctaga?atgagagttg?ctttaacagg?acttacaatg?gctgaatatt?ttagagacaa 3120
aggtcaagat?gtgcttctat?ttatagataa?tatattcaga?tttacacaag?ctggttcaga 3180
ggtttcagct?ttacttggta?gaatacctag?tgccgttggt?tatcagccaa?cacttgcaaa 3240
tgaaatgggt?gctcttcaag?agagaataac?atcaacaaaa?cagggttcaa?tcacatccgt 3300
tcaggctgta?tatgttcctg?ctgatgacct?tacagaccca?gctccagcaa?caacatttac 3360
gcatcttgat?gcaacaacag?ttctttcaag?agaaatatca?aacttaggaa?tatatcctgc 3420
agttagtcct?cttgaatcaa?cttcaagaat?acttgatcca?agaattgttg?gagaagagca 3480
ttatgaagtt?gctaacaagg?ttaaacatat?acttgaaaga?tatcaagaac?ttcaagatat 3540
catagctata?cttggtgttg?atgaactttc?agatgaggat?agattgttag?ttggaagagc 3600
aagaagagta?cagagattct?tatctcaagc?ttttagtgtt?gctgaacaat?ttacaggaat 3660
gaaaggtcag?tttgtacctg?taaaagatac?tataagaagt?tttaaagaaa?tattagatgg 3720
taagtgtgat?gatcttccag?aagctgcatt?tttatttgca?ggaacaatag?aagatgtaaa 3780
agaaaaagct?aaaaaaatga?tggaaagcta?agg 3813
<210>2
<211>150
<212>DNA
＜213〉clostridium acetobutylicum (Clostridium acetobutylicum)
<400>2
tatattgata?aaaataataa?tagtgggtat?aattaagttg?ttagagaaaa?cgtataaatt 60
agggataaac?tatggaactt?atgaaataga?ttgaaatggt?ttatctgtta?ccccgtatca 120
aaatttagga?ggttagttag?aatgaaagaa 150
<210>3
<211>505
<212>PRT
＜213〉clostridium acetobutylicum (Clostridium acetobutylicum)
<400>3
Met?Asn?Ile?Lys?Pro?Glu?Glu?Ile?Thr?Ser?Ile?Ile?Lys?Ser?Gln?Ile
1 5 10 15
Glu?Gly?Tyr?Glu?Ser?Lys?Leu?Glu?Thr?Val?Asp?Ser?Gly?Thr?Ile?Ile
20 25 30
Glu?Ile?Gly?Asp?Gly?Ile?Ala?Arg?Ile?Tyr?Gly?Leu?Gln?Asn?Cys?Met
35 40 45
Ala?Gly?Glu?Leu?Leu?Glu?Phe?Pro?Asn?Asp?Val?Tyr?Gly?Met?Ala?Leu
50 55 60
Asn?Leu?Glu?Gln?Asp?Asn?Val?Gly?Cys?Val?Leu?Leu?Gly?Ser?Glu?Glu
65 70 75 80
Gly?Ile?Lys?Glu?Gly?Asp?Ile?Val?Lys?Ser?Thr?Gly?Lys?Val?Val?Glu
85 90 95
Val?Pro?Val?Gly?Glu?Glu?Met?Leu?Gly?Arg?Val?Val?Asn?Ala?Leu?Gly
100 105 110
Gln?Pro?Ile?Asp?Gly?Lys?Gly?Pro?Ile?Lys?Ala?Glu?Asp?Ser?Lys?Pro
115 120 125
Val?Asp?Ile?Lys?Ala?Thr?Gly?Val?Ile?Asp?Arg?Gln?Ser?Val?Asn?Gln
130 135 140
Pro?Leu?Gln?Thr?Gly?Ile?Lys?Ala?Ile?Asp?Ser?Met?Ile?Pro?Ile?Gly
145 150 155 160
Lys?Gly?Gln?Arg?Glu?Leu?Ile?Ile?Gly?Asp?Arg?Gln?Thr?Gly?Lys?Thr
165 170 175
Ala?Ile?Ala?Ile?Asp?Thr?Ile?Leu?Asn?Gln?Lys?Gly?Lys?Asp?Val?Ile
180 185 190
Cys?Ile?Tyr?Val?Ala?Ile?Gly?Gln?Lys?Gln?Ser?Thr?Val?Ala?His?Ile
195 200 205
Val?Asn?Thr?Phe?Glu?Glu?Met?Gly?Ala?Met?Asp?Tyr?Ser?Ile?Val?Val
210 215 220
Ala?Ala?Thr?Ala?Ser?Asp?Ser?Ala?Pro?Leu?Gln?Tyr?Leu?Ala?Pro?Tyr
225 230 235 240
Ser?Gly?Val?Thr?Ile?Ala?Glu?Asn?Phe?Met?Phe?Lys?Gly?Lys?Asp?Val
245 250 255
Leu?Ile?Val?Tyr?Asp?Asp?Leu?Ser?Lys?His?Ala?Val?Ala?Tyr?Arg?Thr
260 265 270
Met?Ser?Leu?Leu?Leu?Arg?Arg?Pro?Pro?Gly?Arg?Glu?Ala?Tyr?Pro?Gly
275 280 285
Asp?Val?Phe?Tyr?Leu?His?Ser?Arg?Leu?Leu?Glu?Arg?Ala?Ala?Lys?Leu
290 295 300
Ser?Gln?Lys?Leu?Gly?Gly?Gly?Ser?Ile?Thr?Ala?Leu?Pro?Ile?Ile?Glu
305 310 315 320
Thr?Leu?Ala?Gly?Asp?Val?Ala?Gly?Tyr?Ile?Pro?Thr?Asn?Val?Ile?Ser
325 330 335
Ile?Thr?Asp?Gly?Gln?Ile?Phe?Leu?Glu?Ser?Glu?Leu?Phe?Tyr?Ala?Gly
340 345 350
Gln?Arg?Pro?Ala?Val?Asn?Ser?Gly?Ile?Ser?Val?Ser?Arg?Val?Gly?Gly
355 360 365
Ser?Ala?Gln?Ile?Lys?Ala?Met?Lys?Lys?Leu?Ser?Gly?Thr?Leu?Arg?Leu
370 375 380
Glu?Leu?Ala?Gln?Tyr?Arg?Glu?Leu?Ala?Ala?Phe?Ala?Gln?Phe?Gly?Ser
385 390 395 400
Asp?Leu?Asp?Lys?Glu?Ser?Lys?Lys?Arg?Leu?Glu?Lys?Gly?Lys?Arg?Leu
405 410 415
Thr?Glu?Met?Met?Lys?Gln?Pro?Gln?Tyr?Lys?Pro?Met?Pro?Val?Glu?Lys
420 425 430
GlnIle?Met?Ile?Leu?Tyr?Ala?Val?Val?Asn?Glu?Tyr?Val?Met?Asp?Ile
435 440 445
Asp?Val?Ser?Lys?Leu?Ser?Ala?Phe?Glu?Ser?Gly?Leu?Phe?Glu?Tyr?Val
450 455 460
Asp?Ala?His?Tyr?Arg?Asp?Leu?Gly?Lys?Gln?Ile?Leu?Glu?Lys?Lys?Glu
465 470 475 480
Leu?Thr?Asp?Asp?Ile?Ser?Ser?Gln?Leu?Thr?Lys?Ala?Ile?Asn?Glu?Tyr
485 490 495
Lys?Lys?Ile?Phe?Leu?Ala?Glu?Glu?Gln
500 505
<210>4
<211>282
<212>PRT
＜213〉clostridium acetobutylicum (Clostridium acetobutylicum)
<400>4
Met?Ala?Gly?Ala?Gly?Leu?Ile?Ile?Ile?Lys?Arg?Arg?Ile?Lys?Ser?Ile
1 5 10 15
Thr?Asn?Thr?Lys?Lys?Ile?Thr?Asn?Ala?Met?Gly?Leu?Ile?Ala?Thr?Ser
20 25 30
Asn?Leu?Arg?Lys?Ser?Arg?Gln?Asn?Leu?Glu?Ala?Asn?Lys?Ala?Tyr?Tyr
35 40 45
Glu?Ala?Phe?Asn?Asp?Val?Ile?Asn?Lys?Ile?Val?Ser?Ser?Ser?Ser?Lys
50 55 60
Ser?Asn?Leu?Tyr?Val?Ala?Gly?Asn?Lys?Ser?Asp?Lys?Lys?Leu?Tyr?Ile
65 70 75 80
Ala?Leu?Thr?Ser?Asp?Ser?Gly?Leu?Cys?Gly?Gly?Phe?Asn?Gly?Ala?Val
85 90 95
Val?Thr?Ala?Ala?Asp?Asn?Val?Met?Arg?Gly?Asp?Lys?Asp?Lys?Ser?Leu
100 105 110
Leu?Ile?Thr?Val?Gly?Gln?Lys?Gly?Ile?Ser?Tyr?Phe?Lys?Arg?Leu?Lys
115 120 125
Tyr?Glu?Thr?Leu?Ser?Glu?Tyr?Val?Asp?Ile?Pro?Asn?Glu?Pro?Gly?Leu
130 135 140
Lys?Glu?Ala?Lys?Glu?Ile?Ala?Asp?Arg?Ala?Leu?Ser?Leu?Tyr?Glu?Lys
145 150 155 160
Gly?Glu?Ile?Gly?Glu?Val?His?Val?Ile?Tyr?Thr?Gln?Phe?Leu?Ser?Thr
165 170 175
Val?Asn?Gln?Lys?Val?Glu?Val?Lys?Lys?Val?Leu?Pro?Ile?Glu?Pro?Lys
180 185 190
Lys?Met?Glu?Lys?Val?Ser?Val?Ala?Glu?Phe?Glu?Pro?Asp?Ala?Glu?Ile
195 200 205
Ile?Leu?Glu?Lys?Ala?Ile?Arg?Leu?His?Ile?Glu?Gln?Gln?Leu?Phe?Asn
210 215 220
Leu?Leu?Leu?Asn?Ser?Lys?Ala?Ser?Glu?Gln?Ala?Ser?Arg?Met?Ser?Ser
225 230 235 240
Met?Asp?Ser?Ala?Thr?Lys?Asn?Ala?Asn?Asp?Leu?Leu?Asp?Ala?Leu?Asn
245 250 255
Ile?Lys?Tyr?Asn?Arg?Ile?Arg?Gln?Ser?Ala?Ile?Thr?Gln?Glu?Ile?Thr
260 265 270
Glu?Ile?Val?Gly?Gly?Ala?Glu?Ala?Leu?Lys
275 280
<210>5
<211>331
<212>PRT
＜213〉clostridium acetobutylicum (Clostridium acetobutylicum)
<400>5
Met?Pro?Glu?His?Val?Gly?Lys?Ile?Val?Gln?Val?Ile?Gly?Pro?Val?Val
1 5 10 15
AspIle?Lys?Phe?Asp?Ala?Glu?Asn?Leu?Pro?Asp?Ile?Tyr?Asn?Ser?Ile
20 25 30
Glu?Ile?Asp?Met?Gly?Asp?Asn?Lys?Lys?Leu?Ile?Ala?Glu?Val?Glu?Gln
35 40 45
His?Val?Gly?Asp?Asp?Ile?Val?Arg?Thr?Ile?Ala?Met?Glu?Gly?Thr?Asp
50 55 60
Gly?Leu?Lys?Arg?Gly?Met?Glu?Ala?Val?Asn?Thr?Gly?Lys?Pro?Ile?Ser
65 70 75 80
Val?Pro?Val?Gly?Glu?Asn?Val?Leu?Gly?Arg?Leu?Phe?Asn?Val?Leu?Gly
85 90 95
Gln?Thr?Ile?Asp?Glu?Ala?Gly?Asp?Met?Asn?Ala?Asp?Lys?Tyr?Tyr?Pro
100 105 110
Ile?His?Arg?Pro?Ala?Pro?Thr?Phe?Glu?Glu?Gln?Ser?Val?Gln?Pro?Glu
115 120 125
Met?Phe?Glu?Thr?Gly?Ile?Lys?Val?Ile?Asp?Leu?Leu?Ala?Pro?Tyr?Gln
130 135 140
Lys?Gly?Gly?Lys?Ile?Gly?Leu?Phe?Gly?Gly?Ala?Gly?Val?Gly?Lys?Thr
145 150 155 160
Val?Leu?Ile?Gln?Glu?Leu?Ile?Asn?Asn?Ile?Ala?Lys?Glu?His?Gly?Gly
165 170 175
Leu?Ser?Val?Phe?Thr?Gly?Val?Gly?Glu?Arg?Thr?Arg?Glu?Gly?Asn?Asp
180 185 190
Leu?Tyr?Tyr?Glu?Met?Lys?Asp?Ser?Gly?Val?Ile?Asn?Lys?Thr?Ala?Leu
195 200 205
Val?Phe?Gly?Gln?Met?Asn?Glu?Pro?Pro?Gly?Ala?Arg?Met?Arg?Val?Ala
210 215 220
Leu?Thr?Gly?Leu?Thr?Met?Ala?Glu?Tyr?Phe?Arg?Asp?Lys?Gly?Gln?Asp
225 230 235 240
Val?Leu?Leu?Phe?Ile?Asp?Asn?Ile?Phe?Arg?Phe?Thr?Gln?Ala?Gly?Ser
245 250 255
Glu?Val?Ser?Ala?Leu?Leu?Gly?Arg?Ile?Pro?Ser?Ala?Val?Gly?Tyr?Gln
260 265 270
Pro?Thr?Leu?Ala?Asn?Glu?Met?Gly?Ala?Leu?Gln?Glu?Arg?Ile?Thr?Ser
275 280 285
Thr?Lys?Gln?Gly?Ser?Ile?Thr?Ser?Val?Gln?Ala?Val?Met?Phe?Leu?Leu
290 295 300
Met?Thr?Leu?Gln?Thr?Gln?Leu?Gln?Gln?Gln?His?Leu?Arg?Ile?Leu?Met
305 310 315 320
Gln?Gln?Gln?Phe?Phe?Gln?Glu?Lys?Tyr?Gln?Thr
325 330
Claims (7)
1. method that makes up recombinant acetone-butanol clostridium is that the dna fragmentation of encoding gene that will contain the hydrophilic segment of FoF1 type atp synthase imports and makes up the reorganization bacterium in the clostridium acetobutylicum;
The dna fragmentation of the encoding gene of the hydrophilic segment of the described FoF1 of containing type atp synthase comprises the encoding gene of the hydrophilic segment of thiolase promotor and FoF1 type atp synthase successively to the downstream from the upstream; The nucleotide sequence of described thiolase promotor is shown in the sequence in the sequence table 2; The hydrophilic segment of described FoF1 type atp synthase comprises three kinds of albumen, and its aminoacid sequence is respectively sequence 3, sequence 4 and the sequence 5 in the sequence table;
The dna fragmentation of the encoding gene of the hydrophilic segment of the described FoF1 of containing type atp synthase is also through methylating modification.
2. method according to claim 1 is characterized in that: the nucleotide sequence of the encoding gene of the hydrophilic segment of described FoF1 type atp synthase is a sequence 1 in the sequence table.
3. method according to claim 1 and 2 is characterized in that: described clostridium acetobutylicum is clostridium acetobutylicum SMB-1CGMCC № .2287.
4. the recombinant acetone-butanol clostridium that makes up by arbitrary described method in the claim 1 to 3.
5. recombinant acetone-butanol clostridium according to claim 4 is characterized in that: described recombinant acetone-butanol clostridium is clostridium acetobutylicum (Clostridium acetobutylicum) SMB-1 (pITF1) CGMCC No.2796.
6. a method of producing butanols is that fermentation culture claim 4 or 5 described recombinant acetone-butanol clostridiums are produced butanols.
7. method according to claim 6 is characterized in that: the substratum of described fermentation culture comprises following material: KH
2PO
40.5-1.0g/L; K
2HPO
43H
2O 0.5-1.0g/L; MgSO
47H
2O 0.2-1.0g/L; MnSO
4H
2O0.01-0.05g/L; FeSO
47H
2O 0.01-0.05g/L; NaCl 0.1-2.0g/L; Yeast powder 2.0-10.0g/L; (NH4)
2SO
40.5-4.0g/L; Glucose 40-80g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102395607A CN101423815B (en) | 2008-12-12 | 2008-12-12 | Recombinant acetone-butanol clostridium and construction method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102395607A CN101423815B (en) | 2008-12-12 | 2008-12-12 | Recombinant acetone-butanol clostridium and construction method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101423815A CN101423815A (en) | 2009-05-06 |
| CN101423815B true CN101423815B (en) | 2010-12-22 |
Family
ID=40614695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102395607A Expired - Fee Related CN101423815B (en) | 2008-12-12 | 2008-12-12 | Recombinant acetone-butanol clostridium and construction method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101423815B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399215B (en) * | 2016-10-10 | 2021-09-03 | 大连理工大学 | Recombinant clostridium for efficiently producing butanol, construction method and application |
-
2008
- 2008-12-12 CN CN2008102395607A patent/CN101423815B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101423815A (en) | 2009-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102121888B1 (en) | Recombinant microorganisms and uses therefor | |
| CN103502435B (en) | Recombinant microorganism and application thereof | |
| ES2655214T3 (en) | Recombinant microorganisms that produce biodiesel | |
| AU2007316189B2 (en) | Process for the biological production of n-Butanol with high yield | |
| AU756284B2 (en) | Recombinant microorganisms capable of fermenting cellobiose | |
| CN101952430B (en) | Enhanced ethanol and butanol producing microorganisms and method for preparing ethanol and butanol using the same | |
| CN110438056B (en) | Construction and application of escherichia coli engineering bacteria for producing n-butyric acid | |
| EP2171075A2 (en) | Butanol production in a eukaryotic cell | |
| MX2011006081A (en) | Biosynthesis of commodity chemicals. | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| KR20080077080A (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| KR20160093648A (en) | Microorganisms and methods for the production of ketones | |
| CN101748069B (en) | Recombinant blue-green algae | |
| CN101423813B (en) | Recombinant clostridium and construction method and use thereof | |
| CN102199614A (en) | Engineering bacteria for stably producing isopropanol and butanol and construction method and application thereof | |
| CN104789487A (en) | Bacterial strain capable of respectively producing butyric acid and n-butanol and method for producing n-butanol | |
| CN101423815B (en) | Recombinant acetone-butanol clostridium and construction method and use thereof | |
| CN102618479A (en) | Clostridium capable of tolerating high-concentration butanol and construction method and application of clostridium | |
| CN101423814B (en) | Clostridium for synthesizing glutathion and construction method and use thereof | |
| CN101265474A (en) | Method for producing clostridium perfringens glycerin anhydrase incitant gene and 1,3-propanediol thereof | |
| CN101633691B (en) | Hydrogen production associated protein, coding genes thereof and application thereof | |
| JP2004089029A (en) | New cellobiose-assimilating microorganism | |
| Shanmugam et al. | Thermophilic Gram-Positive Biocatalysts for Biomass Conversion to Ethanol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101222 Termination date: 20171212 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |