CN114686412B - Bacillus subtilis mutant strain and application thereof in production of alginic acid lyase - Google Patents
Bacillus subtilis mutant strain and application thereof in production of alginic acid lyase Download PDFInfo
- Publication number
- CN114686412B CN114686412B CN202110431043.5A CN202110431043A CN114686412B CN 114686412 B CN114686412 B CN 114686412B CN 202110431043 A CN202110431043 A CN 202110431043A CN 114686412 B CN114686412 B CN 114686412B
- Authority
- CN
- China
- Prior art keywords
- alginic acid
- ser
- bacillus subtilis
- gly
- acid lyase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/02—Carbon-oxygen lyases (4.2) acting on polysaccharides (4.2.2)
- C12Y402/02003—Poly(beta-D-mannuronate) lyase (4.2.2.3)
Abstract
The invention relates to the technical field of genetic engineering, in particular to a bacillus subtilis mutant strain and application thereof in production of alginic acid lyase. The bacillus subtilis mutant strain is obtained by screening through an ultraviolet mutagenesis method, is preserved in China center for type culture collection (CCTCC NO: M2020698) of the university of Wuhan and Wuhan in China on the 11 th month 6 th year of 2020, can be widely applied to fermentation production of alginic acid lyase, is beneficial to reducing the production cost of the enzyme, and has wide application prospect.
Description
Technical Field
The invention relates to the technical field of genetic engineering and microbial transformation, in particular to a bacillus subtilis mutant strain and application thereof in production of alginic acid lyase.
Background
The biological energy source is used as a new energy source which can replace petroleum in the future, has the characteristics of being renewable, low in pollution and the like, and has wide research prospect. Bioenergy can be divided into three types according to the raw materials used, and the first type of bioenergy is produced by taking grain crops and sugar-producing crops as raw materials, and is called first generation bioenergy. Although the production technology is quite mature, the development of the technology is limited because of the problems of high price of raw materials and competing with grains and the contradiction between the existence and the development of human beings. The second category is energy sources such as ethanol produced by fermentation using lignocellulose as a raw material, and is called a second generation biofuel technology. However, bioenergy using lignocellulose as a raw material encounters bottlenecks in the technical aspects of pretreatment, enzymatic hydrolysis, conversion rate and the like, and large-scale commercial production cannot be realized up to now. Seaweed biomass such as alginic acid is considered as a potential approach to solving the energy crisis as a raw material of the third generation bioenergy. The U.S. department of energy has been under study for many years, and has been under development in japan, germany, india, etc. Related researchers believe that the production of biofuels using algae and their extracts, such as alginic acid, has broad prospects. Algal biofuel is likely to be one of the most important renewable energy sources in the future.
Currently, the methods of alginic acid degradation can be divided into three main categories: one type is a chemical degradation method, and an acid hydrolysis method is widely adopted before, and the method has complex operation steps and severe reaction conditions. In addition, there are also oxidative degradation methods of hydrogen peroxide; the second category is physical degradation methods, such as ultrasonic degradation of alginic acid; the third category is an alginic acid lyase enzymolysis method, the condition of the enzymatic degradation of alginic acid is mild, the process is controllable, the yield is high, the method is green and safe, the environment is friendly, the action mechanism is clear, the product is determined, and enzyme preparations with different substrate specificities can be selected singly or in combination according to the specific target product requirement. The enzyme degradation alginic acid can also provide information in terms of sequence, configuration and the like in the reaction process, so that the enzyme degradation alginic acid is more suitable for the degradation of alginic acid and the preparation of alginic acid oligosaccharide, and therefore, biodegradation represented by an enzymolysis method is necessary to gradually replace traditional chemical degradation, and the enzyme degradation alginic acid has a dominant role in future commercial production.
Alginic acid lyase is widely available in three main categories, the first category being microorganisms such as marine bacteria, soil bacteria, fungi, etc., the second category being marine mollusks and echinoderms such as conch, sea cucumber, abalone, etc., and the third category being plants such as kelp, etc. At present, most of the production of alginic acid lyase depends on alginic acid decomposing bacteria. For example, shen Hong and the like find that a microbubble strain Microbulbifer sp.SH-1 with high yield of alginic acid lyase can be used for producing the alginic acid lyase by fermentation, and can also directly degrade brown algae. Zhang Xu Sphingomonas sp. ZHO was isolated from homemade seaweed compost and 4 alginic acid lyase genes were cloned from this strain for complete degradation of alginic acid. Li et al purified and studied the alginic acid lyase Aly-SJ02 of Pseudomonas sp.SM 0524 with an enzymatic activity as high as 65.4U/mg. The vibrio alginolyticus BH17 is separated from rotten kelp with high purity, the enzyme activity reaches 83U/mL, and is superior to the enzyme activity of most strains reported at present.
Alginate decomposing bacteria have been studied and used as an alginate lyase producer, and as the energy crisis has been increased in recent years, alginate decomposing bacteria have also played an important role in producing bioenergy from algal biomass such as alginic acid. The further excavation of the production strain of the high-yield alginic acid lyase is of great significance for sustainable development of ecological environment and economy and effective utilization of ocean resources.
Disclosure of Invention
The invention provides a bacillus subtilis for solving the problems in the prior artBacillus subtilis) Mutant strains and their use in the production of alginic acid lyase. The applicant screens the obtained mutant strain by ultraviolet mutagenesis method, can greatly improve the expression quantity of the alginic acid lyase and reduce the production cost of the enzyme, thereby being beneficial to promoting the wide application of the enzyme.
In one aspect, the invention provides a bacillus subtilis engineering bacterium carrying a recombinant plasmid expressing alginic acid lyase.
The amino acid sequence of the alginic acid lyase is SEQ ID NO. 1, and the encoding nucleotide sequence thereof is SEQ ID NO. 2.
The invention provides a bacillus subtilis mutant strain, which is obtained by taking the bacillus subtilis engineering strain as a starting strain through an ultraviolet mutagenesis method.
The bacillus subtilis mutant bacteria are named as bacillus subtilis AH-29 #Bacillus subtilisAH-29) has been preserved in China center for type culture Collection, with the preservation number of CCTCC NO: M2020698, university of Wuhan, china, at 11 and 6 months of 2020.
The invention also provides a method for producing the alginic acid lyase, which takes the bacillus subtilis mutant strain as a fermentation strain.
The invention firstly constructs and obtains bacillus subtilis BS ALH308 of high-efficiency recombinant expression alginic acid lyase, then takes the strain as an initial strain, and screens and obtains a mutant strain bacillus subtilis AH-29 by an ultraviolet mutagenesis method. The mutant strain has shake flask fermentation enzyme activity as high as 350U/ml, 20L tank fermentation enzyme activity as high as 3888U/ml, and 52.3% and 42.6% higher than that of the parent strain respectively, thus unexpected technical effects are achieved. The optimal action temperature of the alginic acid lyase produced by the mutant bacteria is 50 ℃, the optimal action pH value is 8.5, and the alginic acid lyase is consistent with the original strain. The mutant strain bacillus subtilis AH-29 provided by the invention can be widely applied to fermentation production of alginic acid lyase, is beneficial to reducing the production cost of the alginic acid lyase and promotes popularization and application of the alginic acid lyase.
Drawings
FIG. 1 is a graph showing the pH-relative enzyme activity of the action of Bacillus subtilis AH-29 producing alginic acid lyase;
FIG. 2 shows the temperature-relative enzyme activity curve of the produced alginic acid lyase by Bacillus subtilis AH-29.
Detailed Description
The method of the present invention is further described below with reference to examples, in which the experimental methods without specific conditions are not specified, and may be performed under conventional conditions, such as those described in the molecular cloning experimental guidelines written by j. The present invention may be better understood and appreciated by those skilled in the art by reference to examples. However, the method of implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.
The culture medium in the embodiment of the invention comprises the following components in parts by weight:
LB plate: 1% of tryptone, 0.5% of yeast powder, 1% of NaCl and 1.5% of agar;
LB liquid medium: 1% of tryptone, 0.5% of yeast powder and 1% of NaCl;
minimum salt solution: k (K) 2 HPO 4 14 g/L，KH 2 PO 4 6 g/L，（NH 4 ） 2 SO 4 2 g/L, trisodium citrate 1 g/L, mgSO 4 •7H 2 O 0.2 g/L；
GMI solution: 95.6 ml of the lowest salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml% yeast powder juice;
GMII solution: 96.98 ml of 1-min salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast powder juice and 1M MgCl 2 0.25 ml，1 M CaCl 2 0.05 ml；
Beef extract peptone medium: beef extract 0.5%, peptone 1%, naCl 0.5%, agar 1.5%, pH 7.2.
The present invention will be described in detail with reference to the following embodiments.
EXAMPLE 1 construction of Bacillus subtilis expression vector
1.1 Gene cloning
According to NCBI publication report, an alginic acid lyase gene was artificially synthesized and according to Bacillus subtilis @Bacillus subtilis) Is optimized. PCR amplification was performed using the synthesized gene as a template, using the following primers:
primer szx-F: GGCGTTCAGCAACATGAGCGCGCAGGCTGCATCACTGACAAATCCTGGCT;
primer szx-R: GTCCTCTGTTAACCTCGAGTTATTATTAATCATGTGTATGTTCCAGGCTA.
The PCR amplification conditions were: 94 ℃ for 2min;94℃30s,58℃30s,72℃1min,30 cycles; and at 72℃for 5min. And (5) recovering PCR amplification products by using a gel recovery kit.
1.2 sequencing analysis
The amplified product recovered in 1.1 was ligated to pSZX303 plasmid to obtain a recombinant plasmid, which was sent to Beijing Hua big gene research center for sequencing analysis. Sequencing results show that the gene sequence of the amplified alginic acid lyase is SEQ ID NO. 1, and the coding amino acid sequence is SEQ ID NO. 2. The applicant designated this gene as ALH and the recombinant plasmid constructed was designated ALY-pSZX308. The results of the multiple clones demonstrated that no amplification errors occurred.
Example 2 transformation and screening
A freshly activated Bacillus subtilis 1A751 (Bacillus subtilis A751 (apr-, his-, npr-, eglSΔ102, bglT/bglSΔEV)) (Wolf M, et al microbiology 1995 141:281-90) host was inoculated from LB plate into 5ml GM I solution, shake-cultured at 30℃and 125rpm overnight to give culture broth A; transferring 2ml of culture solution A into 18ml of GM I solution, and culturing at 37 ℃ and 250rpm for 3.5 hours to obtain culture solution B; transferring 10ml of culture solution B into 90ml of GM II solution, culturing at 37deg.C and 125rpm for 90min to obtain culture solution C; and (3) centrifugally collecting thalli in the culture solution C at 5000g for 10min, lightly suspending the thalli by using 10ml of GM II solution, wherein the suspended thalli is competent cells. Then, an appropriate amount of the recombinant plasmid of example 1 was added to 0.5mL competent cells, and the mixture was subjected to shaking culture at 37℃and 200rpm for 30 minutes, and then plated on LB plates (containing 5. Mu.g/mL chloramphenicol), and cultured overnight at 37℃to examine and verify transformants the next day.
Inoculating positive transformant into liquid fermentation medium (yeast extract 0.5%, tryptone 0.5%, glucose 1%, K) 2 HPO 4 1.8%) and fermenting in shake flask at 37deg.C for 48 hr, centrifuging at 5000g for 10min, collecting supernatant, and measuring the enzyme activity of alginic acid lyase in the supernatant.
The applicant named the positive transformant with the highest fermentation enzyme activity as bacillus subtilis BS ALH 308%Bacillus subtilis BS ALH308) The enzyme activity of alginic acid lyase in the supernatant reaches 230U/mL.
The method for measuring the enzyme activity of alginic acid lyase comprises the following steps:
1. definition of enzyme activity unit:
at 40 ℃ and pH7.5, the substrate sodium alginate is degraded per minute to generate unsaturated bonds, and at 235nm, the absorbance is increased by 0.1 to obtain 1 enzyme activity unit, which is expressed as U/g (U/mL).
2. Principle of:
alginic acid lyase may cleave glycosidic bonds in alginic acid molecules by beta-elimination reactions, yielding non-reducing ends with unsaturated double bonds located between the non-reducing ends C4, C5 of the product, and yielding maximum uv absorbance at 235 nm.
3. Measurement method
(1) Liquid sample: the mixture is diluted to proper times by buffer solution, the absorbance value OD235 is controlled to be between 0.22 and 0.35, and the enzyme activity is about 0.5U/mL.
(2) Measurement procedure
Enzyme reaction: three 15mm test tubes are taken, 1.8mL of substrate is added, water bath at 40 ℃ is used for preheating for 5min, 0.2mL of diluted enzyme solution is added, accurate timing is achieved, vortex oscillation is carried out, heat preservation is carried out at 40 ℃ for 10min, the test tubes are taken out from the water bath, 2mL of phosphoric acid stop solution is immediately added, vortex oscillation is carried out, and the test tubes are placed on a test tube rack outside the water bath kettle.
Blank: 15mm by 150mm test tubes were taken, 1.8mL of substrate was added, preheated in a 40℃water bath for 5min, 0.2mL of buffer was added, vortexed, incubated at 40℃for 10min, the test tubes were removed from the water bath and immediately added with 2mL of phosphate stop solution, vortexed, and the test tubes were placed on a test tube rack outside the water bath.
Colorimetric: immediately after the blank and enzyme reaction for each sample was terminated, a color was measured at 235nm and absorbance values A0 and A were recorded.
Remarks:
calculate x= (A0-a sample) ×2×n/(t×0.1)
Wherein:
x-enzyme activity, U/mL or U/g
2-volume coefficient of adding 2mL of phosphoric acid stop solution
t (min) -enzymatic reaction time (in the linear range of the enzymatic reaction)
0.1-system coefficient, i.e. the absorbance increase unit is converted to 0.1
N-dilution factor
Is simplified: enzyme activity (U/mL) = (A0-a sample) ×2×n.
EXAMPLE 3 UV mutagenesis screening
Mutation caused by ultraviolet mutagenesis is very random, and the effect of mutation is also random and difficult to predict. Therefore, in order to obtain effective positive mutation, the skilled person is usually required to perform multiple rounds of ultraviolet mutagenesis, the screening effort is large, and there is a possibility that effective positive mutation cannot be obtained. However, since the equipment required for ultraviolet mutagenesis is simple and low in cost, and a large number of mutants can be obtained in a short time, it is still a commonly used mutagenesis breeding method.
The applicant constructed the recombinant strain Bacillus subtilis BS ALH308 as described in example 2Bacillus subtilis BS ALH 308) is an original strain, which is genetically modified by ultraviolet mutagenesis method to further increase the yield of alginic acid lyase.
3.1 Ultraviolet mutagenesis
Streaking and inoculating an original strain bacillus subtilis BS ALH308 on a beef extract peptone slant culture medium containing 50 mug/mL chloramphenicol, and culturing at 37 ℃ for 48 hours; washing all bacteria on the inclined plane with 5mL of 0.85% physiological saline, and transferring into a sterile test tube containing glass beads; vortex oscillating for 10min to completely make into single cell thallus; transferring all the bacterial suspension into a 15mL centrifuge tube, centrifuging at 6000rpm for 3min, and collecting bacterial cells; removing the supernatant, and suspending the thalli with 10mL of 0.85% physiological saline; washing the cells twice, and finally adjusting the cell concentration to 10 8 /mL。
The 9W ultraviolet lamp switch is turned on and preheated for about 30min. Taking sterile plate with diameter of 9cm, adding above cells to give a concentration of 10% 8 10mL of a/mL bacterial suspension is placed into a sterile magnetic stirrer; opening magnetic stirrer, opening dish cover, stirring at a vertical distance of 15cm for 1min, covering the dish cover, and closingAnd (5) incubating for 30min in the dark by using an ultraviolet lamp.
The irradiated bacterial suspension is diluted to 10 by a 10-fold dilution method of 0.85 percent physiological saline -1 ～10 -6 The method comprises the steps of carrying out a first treatment on the surface of the Take 10 -4 、 10 -5 、10 -6 Three dilutions of each 100 μl of the bacterial suspension were plated with beef extract peptone plates, three plates were plated for each dilution, and the entire plate surface was uniformly coated with sterile glass rods. The evenly coated flat plate is wrapped by black cloth or newspaper and then placed at 37 ℃ for overnight culture.
Picking single colony growing on the plate, and streaking and purifying on a beef extract peptone plate containing 50 mug/mL chloramphenicol; selecting single colony, streaking and inoculating to beef extract peptone inclined plane containing 50 mug/mL chloramphenicol for seed preservation; co-enrichment was screened for 99 mutant strains.
3.2 Shake flask screening
The enriched 99 mutant strains were simultaneously inoculated with the starting strain Bacillus subtilis BS ALH308 in a fermentation medium (yeast extract 0.5%, tryptone 0.5%, glucose 1%, K) 2 HPO 4 1.8%) and performing shake flask fermentation, centrifuging for 48h at 5000g for 10min to collect supernatant, and respectively measuring alginic acid lyase enzymatic activity in the supernatant.
The results show that the enzyme activities of two mutant bacteria with highest alginic acid lyase activities in the fermentation supernatant are 253U/ml and 237U/ml respectively, and the enzyme activities are only improved by 10.1% and 6.6% respectively compared with that of bacillus subtilis BS ALH308, and the effect is not obvious.
The applicant continuously carries out 6 rounds of ultraviolet mutagenesis screening according to the method to finally obtain a mutant strain with the yield of the alginic acid lyase being obviously higher than that of the starting strain, which is named as bacillus subtilis AH-29%Bacillus subtilisAH-29). After 48h of the mutant strain is fermented in a shaking bottle, the enzyme activity of alginic acid lyase in the fermentation supernatant is 350U/mL, and is improved by 52.3% compared with the original strain.
3.3 Fermentation in 20L tank
Mutant strain AH-29 and single colony of the parent strain are respectively selected and inoculated in 0.6L seed culture medium (tryptone 1%, yeast powder 0.5% and NaCl 1%), and are subjected to shaking culture at 34 ℃ and 210rpm for 8 hours; will be0.6L of seed culture solution is completely inoculated into 12L of fermentation medium (yeast extract 0.5%, tryptone 0.5%, glucose 1%, K) 2 HPO 4 1.8%) was fermented at 34℃for 36 hours in a 20L fermenter, and then the enzyme activities of alginic acid lyase in the fermented supernatants were separately examined.
The results show that the enzyme activity of alginic acid lyase in the fermentation supernatant of mutant strain AH-29 is improved by 42.6% compared with that of the starting strain, which is up to 3888U/ml, and unexpected technical effects are obtained. Multiple fermentation experiments also demonstrated that mutant AH-29 produced alginic acid lyase levels remained stable.
EXAMPLE 4 analysis of the enzymatic Properties of the alginate lyase produced by Bacillus subtilis AH-29
4.1 optimal pH analysis
The fermentation supernatants of Bacillus subtilis AH-29 were diluted with buffers having pH values of 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, respectively, and the enzyme activities of alginic acid lyase in the fermentation supernatants were measured at 40℃and calculated as relative enzyme activities with the highest enzyme activity being 100%, and a pH-relative enzyme activity curve was made. As a result, as shown in FIG. 1, the optimum pH for the alginic acid lyase produced by Bacillus subtilis AH-29 of the mutant strain obtained by the present invention was 8.5, which was consistent with the optimum pH for the alginic acid lyase produced by the starting strain.
4.2 optimal temperature analysis
The enzyme activity of alginic acid lyase in the fermentation supernatant of Bacillus subtilis AH-29 was measured at 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95℃and pH 6.5, respectively, and the relative enzyme activity was calculated with the highest enzyme activity being 100%, and a temperature-relative enzyme activity curve set was made. As shown in FIG. 2, the optimum action temperature of the mutant strain Bacillus subtilis AH-29 produced alginic acid lyase obtained by the invention is 50 ℃, and is consistent with the optimum action temperature of the starting strain produced alginic acid lyase.
In conclusion, the mutant strain bacillus subtilis AH-29 obtained by screening by an ultraviolet mutagenesis method can obviously improve the yield of alginic acid lyase, the fermentation enzyme activity of a 20L tank is up to 2888U/ml, the yield is improved by 42.6% compared with that of the starting strain, and the enzymatic property of the mutant strain for producing the alginic acid lyase is unchanged compared with that of the starting strain.
The applicant has prepared Bacillus subtilis AH-29 as the mutant in 2020, 11 and 6 daysBacillus subtilisAH-29) is preserved in China center for type culture collection (CCTCC NO: M2020698) of university of Wuhan in Wuhan, china.
Sequence listing
<110> Weifang Kangdi En Biotechnology Co., ltd
Blue green island biological group Co.Ltd
<120> a Bacillus subtilis mutant strain and its use in the production of alginic acid lyase
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1728
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgaaaatca acaggttact tcctttcagc atttcccttc tgttcagcgc ctcggcactg 60
gcaagcttga ccaacccggg ctttgaaaac cagttcagcg gctggagcga tacggaccca 120
tccgccatct caggcgatgc cgccagtggc agttactcgg ccaaaattac cggttcttca 180
ggacgagtgg atcaacaggt cgctttggac actaacaccc aataccggct gaccgccgag 240
gtactgggta gtggcgtgat tggcatcaac attggcggca ccgtgcacga cgaacgggta 300
aacacctcca gctggacaac ggtgaccgtg gagtttgact ccggctccgc gagcagcggc 360
gaggtgttcg caaagtacaa cgacggtacc ggccggttcg acgacttcac tctctcggtg 420
atcggctctt ctggaggctc cggagaatgt gtaaacggag aagccatcga tatcgtttcg 480
gccagcgatg acggaaccaa tgacggccac acgcccgatc ttgccataga cggcaatctg 540
gccgactcct cccggtggtc ctccttgggc gacggaaagg ctatcactct ggacctaggc 600
tctgtctcca ccatcgacac catccgaacc gcctggtaca aagccgatga acgcaccgcc 660
tatttcgacg ttgaagtatc ggaagatggc agcaactggt cttcggtcct aacgaatacc 720
caatcccagg gaaccgaagg gttcgcctca aattcattca acgaggctga tgctcgctat 780
gtccgtatcg tcggccatgg aaattcgagc aatgaatgga acagtctgat cgaagtgcag 840
gtgggttgcg gcgattttgc cgatgacacg agcacccctc ccccggcctc tggaagtctt 900
gaccccaacc ttgccccctc gggaaacttt gacttgagtc gatggtacct gagtgtgccc 960
actgacactg acaatagtgg tacggcggac agcatcaaag aaaacgagct aaactccggt 1020
tatgaggaca gtgagtactt ctatacgggc tctgatggag gcatggtatt caagtgtcct 1080
atcgatggtt ttaaaacctc taccaacacc agctatactc gcaccgaact gcgggagatg 1140
ttgcgcgccg gcgacaccag tatcgcgact cagggggtaa ataaaaataa ctgggtattt 1200
gggagtgcac cgtcctccga tcggaatgat gcgggtggcg tagacggcaa tatgacagcg 1260
actctcgcag tgaatcacgt cactacgacg ggaagcaata gccaggtggg acgcgtcatc 1320
atcggtcaaa ttcacgccaa cgatgatgaa ccactgcgcc tgtactatcg aaagcttccc 1380
gggaatagta aaggctcaat ctactttgct catgaaccca acggcggtag cgactcctgg 1440
tacgagctga tcggcagccg gtcgagcagc gcctcagacc ctagtgacgg gattgcactt 1500
gatgaagttt tcagctacga aatcgacgtt acttatgaca ctctgacggt cactatttac 1560
cgcgacggca aaaaccctgt ctcagagtcg gtgaatatga gcagcagcgg ctatagtagc 1620
ggtggccagt atatgtactt taaagcgggc gtatataacc agaacaactc tggtaacagc 1680
gacgactacg tccaagccac attctactcc cttgagcaca cccacgat 1728
<210> 2
<211> 576
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Lys Ile Asn Arg Leu Leu Pro Phe Ser Ile Ser Leu Leu Phe Ser
1 5 10 15
Ala Ser Ala Leu Ala Ser Leu Thr Asn Pro Gly Phe Glu Asn Gln Phe
20 25 30
Ser Gly Trp Ser Asp Thr Asp Pro Ser Ala Ile Ser Gly Asp Ala Ala
35 40 45
Ser Gly Ser Tyr Ser Ala Lys Ile Thr Gly Ser Ser Gly Arg Val Asp
50 55 60
Gln Gln Val Ala Leu Asp Thr Asn Thr Gln Tyr Arg Leu Thr Ala Glu
65 70 75 80
Val Leu Gly Ser Gly Val Ile Gly Ile Asn Ile Gly Gly Thr Val His
85 90 95
Asp Glu Arg Val Asn Thr Ser Ser Trp Thr Thr Val Thr Val Glu Phe
100 105 110
Asp Ser Gly Ser Ala Ser Ser Gly Glu Val Phe Ala Lys Tyr Asn Asp
115 120 125
Gly Thr Gly Arg Phe Asp Asp Phe Thr Leu Ser Val Ile Gly Ser Ser
130 135 140
Gly Gly Ser Gly Glu Cys Val Asn Gly Glu Ala Ile Asp Ile Val Ser
145 150 155 160
Ala Ser Asp Asp Gly Thr Asn Asp Gly His Thr Pro Asp Leu Ala Ile
165 170 175
Asp Gly Asn Leu Ala Asp Ser Ser Arg Trp Ser Ser Leu Gly Asp Gly
180 185 190
Lys Ala Ile Thr Leu Asp Leu Gly Ser Val Ser Thr Ile Asp Thr Ile
195 200 205
Arg Thr Ala Trp Tyr Lys Ala Asp Glu Arg Thr Ala Tyr Phe Asp Val
210 215 220
Glu Val Ser Glu Asp Gly Ser Asn Trp Ser Ser Val Leu Thr Asn Thr
225 230 235 240
Gln Ser Gln Gly Thr Glu Gly Phe Ala Ser Asn Ser Phe Asn Glu Ala
245 250 255
Asp Ala Arg Tyr Val Arg Ile Val Gly His Gly Asn Ser Ser Asn Glu
260 265 270
Trp Asn Ser Leu Ile Glu Val Gln Val Gly Cys Gly Asp Phe Ala Asp
275 280 285
Asp Thr Ser Thr Pro Pro Pro Ala Ser Gly Ser Leu Asp Pro Asn Leu
290 295 300
Ala Pro Ser Gly Asn Phe Asp Leu Ser Arg Trp Tyr Leu Ser Val Pro
305 310 315 320
Thr Asp Thr Asp Asn Ser Gly Thr Ala Asp Ser Ile Lys Glu Asn Glu
325 330 335
Leu Asn Ser Gly Tyr Glu Asp Ser Glu Tyr Phe Tyr Thr Gly Ser Asp
340 345 350
Gly Gly Met Val Phe Lys Cys Pro Ile Asp Gly Phe Lys Thr Ser Thr
355 360 365
Asn Thr Ser Tyr Thr Arg Thr Glu Leu Arg Glu Met Leu Arg Ala Gly
370 375 380
Asp Thr Ser Ile Ala Thr Gln Gly Val Asn Lys Asn Asn Trp Val Phe
385 390 395 400
Gly Ser Ala Pro Ser Ser Asp Arg Asn Asp Ala Gly Gly Val Asp Gly
405 410 415
Asn Met Thr Ala Thr Leu Ala Val Asn His Val Thr Thr Thr Gly Ser
420 425 430
Asn Ser Gln Val Gly Arg Val Ile Ile Gly Gln Ile His Ala Asn Asp
435 440 445
Asp Glu Pro Leu Arg Leu Tyr Tyr Arg Lys Leu Pro Gly Asn Ser Lys
450 455 460
Gly Ser Ile Tyr Phe Ala His Glu Pro Asn Gly Gly Ser Asp Ser Trp
465 470 475 480
Tyr Glu Leu Ile Gly Ser Arg Ser Ser Ser Ala Ser Asp Pro Ser Asp
485 490 495
Gly Ile Ala Leu Asp Glu Val Phe Ser Tyr Glu Ile Asp Val Thr Tyr
500 505 510
Asp Thr Leu Thr Val Thr Ile Tyr Arg Asp Gly Lys Asn Pro Val Ser
515 520 525
Glu Ser Val Asn Met Ser Ser Ser Gly Tyr Ser Ser Gly Gly Gln Tyr
530 535 540
Met Tyr Phe Lys Ala Gly Val Tyr Asn Gln Asn Asn Ser Gly Asn Ser
545 550 555 560
Asp Asp Tyr Val Gln Ala Thr Phe Tyr Ser Leu Glu His Thr His Asp
565 570 575
Claims (3)
1. A bacillus subtilis mutant strain is characterized in that the preservation number of the mutant strain is CCTCC NO: M2020698.
2. Use of the bacillus subtilis mutant strain according to claim 1 for the production of alginic acid lyase.
3. A method for producing alginic acid lyase by using the bacillus subtilis mutant strain according to claim 1 as a fermentation strain.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011601370 | 2020-12-29 | ||
| CN2020116013702 | 2020-12-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114686412A CN114686412A (en) | 2022-07-01 |
| CN114686412B true CN114686412B (en) | 2023-05-26 |
Family
ID=82135654
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110431043.5A Active CN114686412B (en) | 2020-12-29 | 2021-04-21 | Bacillus subtilis mutant strain and application thereof in production of alginic acid lyase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114686412B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789227A (en) * | 2013-12-04 | 2014-05-14 | 青岛蔚蓝生物集团有限公司 | High-alkaline protease yield bacillus subtilis strain |
| CN109957536A (en) * | 2017-12-14 | 2019-07-02 | 青岛蔚蓝生物集团有限公司 | A kind of bacillus subtilis and its application in alginate lyase production |
-
2021
- 2021-04-21 CN CN202110431043.5A patent/CN114686412B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789227A (en) * | 2013-12-04 | 2014-05-14 | 青岛蔚蓝生物集团有限公司 | High-alkaline protease yield bacillus subtilis strain |
| CN109957536A (en) * | 2017-12-14 | 2019-07-02 | 青岛蔚蓝生物集团有限公司 | A kind of bacillus subtilis and its application in alginate lyase production |
Non-Patent Citations (2)
| Title |
|---|
| Miaomiao Wang et al..Cloning and expression of the sucrose phosphorylase gene in Bacillus subtilis and synthesis of kojibiose using the recombinant enzyme.《Microb Cell Fact》.2018,第17卷(第17期),第1-9页. * |
| 毕江涛等.甘草内生真菌分离及其抑菌活性初探.《草业科学》.2013,第30卷(第30期),第357-364页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114686412A (en) | 2022-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109957536B (en) | Bacillus subtilis and application thereof in production of alginate lyase | |
| CN110452845B (en) | Escherichia coli for producing sucrose phosphorylase | |
| CN103468624B (en) | Genetic engineering bacteria used for high efficient production of mycose | |
| CN110484471B (en) | Acid-resistant strain for high yield of bacterial cellulose and method for producing bacterial cellulose by using acid-resistant strain | |
| CN110257410B (en) | Gene for encoding algin lyase | |
| WO2020228458A1 (en) | Method and application for knocking out spo iiq and pcf genes to increase fermentation and enzyme production of bacillus licheniformis | |
| CN109988799A (en) | A kind of glycerol -2- alpha-glucosyl enzyme is preparing the application in 2- α-glycosylglycerol | |
| CN114214251B (en) | Bacillus subtilis for producing D-psicose and culture method and application thereof | |
| CN112342232B (en) | Construction method of recombinant dextran sucrase escherichia coli suitable for diglycoside transfer function | |
| CN112941052B (en) | Chitosanase OUC-T613 and application thereof | |
| CN111484954A (en) | Pseudomonas nigricans for producing alginate lyase | |
| CN113528553B (en) | Codon-optimized N-acetylglucosamine transferase gene and application thereof | |
| JP4067970B2 (en) | Thermophilic microorganism Bacillus coagulans SIM-TDSM14043 for producing L (+)-lactate from fermentable sugars and mixtures thereof | |
| JP2021509285A (en) | Streptomyces sericolor mutant strain, beta-agarase production method using this, and neo-agarooligosaccharide production method using this | |
| CN110144341B (en) | Alginate lyase mutant | |
| CN114686412B (en) | Bacillus subtilis mutant strain and application thereof in production of alginic acid lyase | |
| JP2023534879A (en) | N-Acetylglucosamine-producing strain and method for construction and use thereof | |
| CN114480205B (en) | Bacillus amyloliquefaciens and application thereof in brewing of solid-state fermentation vinegar | |
| CN112725372B (en) | Multi-enzyme complex vector for improving expression of welan gum and recombinant bacterium for high yield of welan gum | |
| CN109576240A (en) | A kind of amylosucrase mutant and the preparation method and application thereof | |
| CN114686503B (en) | Coli mutant strain for stabilizing high-yield alginic acid lyase | |
| CN113493747A (en) | Mutant strain of high-yield cyclodextrin glucosyltransferase and application thereof | |
| CN114958702B (en) | Stable and high-yield algin lyase colibacillus mutant strain | |
| CN109161504A (en) | One plant of vibrio marinopraesens and its separation method and application | |
| CN113403332B (en) | Alpha-agarase gene and application of coding enzyme thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |