CN114657193B - Method for improving sanguinarine content in macleaya cordata and application - Google Patents

Abstract

The invention discloses a method for improving the content of sanguinarine in macleaya cordata and application thereof. By silencing McSMT gene expression in the macleaya cordata or knocking out McSMT gene, the blood root alkali content in the macleaya cordata is improved. The invention adopts a CRISPR/Cas9 gene editing system to knock out McSMT genes, which is used for cultivating novel macleaya cordata germplasm for improving the blood root alkali content. The method mainly aims at the problem that the conventional breeding of the macleaya cordata cannot quickly obtain the germplasm material with high blood root alkali content, and the gene editing technology is applied to the macleaya cordata plant for the first time to obtain the macleaya cordata germplasm material with important application value.

Description

Method for improving sanguinarine content in macleaya cordata and application

Technical Field

The invention belongs to the technical field of macleaya cordata germplasm resource research, and particularly relates to a method for improving the blood root alkali content in macleaya cordata and application thereof.

Background

The benzylisoquinoline alkaloid mainly containing sanguinarine in the Macleaya cordata (Willd.) R.Br.) extract plays a very important role in the fields of cultivation and food safety, and has been widely applied to the cultivation industry of livestock, poultry, aquatic products and the like as a natural source substitute of feed antibiotics. However, in the existing wild variable family macleaya cordata resources, the content of the active ingredient sanguinarine is only in the range of 0.3-2.0% and is unstable, the sanguinarine content in the macleaya cordata is difficult to be obviously improved by utilizing the traditional breeding technology such as breeding, hybridization breeding and the like, and the problems of long breeding period and high cost are faced.

Site-directed modification of genes is one of the important methods in the field of biological research. With the development of science, more and more silencing technologies are rapidly developing. From classical MES random mutagenesis, T-DNA or transposon insertion inactivation to site-directed mutagenesis of Zinc Finger Structures (ZFs) and transcription activator-like effector nucleases (TALENs), these techniques greatly facilitate the progress of studying gene function. However, because zinc finger ribonuclease (ZFN) and transcription activator-like effector nuclease (TALENs) technologies require specific endonucleases to be designed for each target gene, and the construction process is cumbersome, the application range is greatly limited. Compared with other silencing systems, the CRISPR site-directed mutagenesis technology has incomparable advantages, and is gradually and widely applied to site-directed modification researches of genes.

The CRISPR/Cas system is found in escherichia coli at the earliest, is an acquired immune system of bacteria against exogenous DNA such as phage, and mainly depends on a ribonucleoprotein complex formed by crRNA and Cas protein to recognize a PAM structure on a target sequence, so that the invasive phage or plasmid is specifically cut. There are three main types of CRISPR systems, of which type II systems require only one Cas9 protein, crRNA and tracrRNA to function. There are studies showing that integrating crRNA with tracrRNA into sgRNA does not affect the effect of the CRISPR/Cas9 system. Three studies on successful application of CRISPR/Cas9 systems to plant gene modification were simultaneously published for the first time in the journal of natural biotechnology, month 8 of 2013. After that, the CRISPR/Cas9 system is widely applied to the researches on mode plants such as arabidopsis, tobacco, rice, sorghum and the like and crops, and the medicinal plant macleaya cordata can be considered to be further applied to the actual breeding researches on the basis of the constructed CRISPR/Cas9 gene editing system.

The McSMT gene in macleaya cordata is a key methyltransferase gene in the branch path of chelerythrine, and the enzyme is mainly used for catalyzing the corydaline to generate tetrahydroafricane, and then the serial conversion is carried out to generate the chelerythrine. The chelerythrine is branched into competing paths of the sanguinarine synthesis path, and the efficiency of the two paths is basically equivalent, if the chelerythrine synthesis path can be effectively cut off, only the sanguinarine synthesis path is reserved, and the macleaya cordata germplasm innovation aiming at improving the sanguinarine content can be possibly realized.

The invention comprises the following steps:

The primary purpose of the invention is to provide a method for improving the blood root alkali content in macleaya cordata. The method has novel conception and simple operation, so that the blood root alkali content in the macleaya cordata is obviously improved, and the method has wide practical production significance.

According to the invention, by silencing McSMT gene expression in the macleaya cordata or knocking out McSMT gene, the blood root alkali content in the macleaya cordata is improved, and the full-length sequence and CDS region sequence of the McSMT gene are shown as SEQ ID NO.1 and 2.

According to the method for improving the blood root alkali content in the macleaya cordata, mcSMT genes are knocked out by adopting a CRISPR/Cas9 gene editing system.

The method for improving the blood root alkali content in the macleaya cordata specifically comprises the following steps:

1) Designing and synthesizing a primer of a target locus of the macleaya cordata McSMT gene;

2) Constructing a macleaya cordata gene knockout vector;

3) Agrobacterium tumefaciens-mediated genetic transformation of macleaya cordata.

The method for improving the blood root alkali content in the macleaya cordata,

Step 1) designing and synthesizing a target locus primer of the macleaya cordata McSMT gene:

① . The design method comprises the steps of using plant genome editing target site design software to design a McSMT gene target site Guide1 in a coding region of a macleaya cordata McSMT gene avoiding intron regions, wherein the design principle of the target site is as follows: a. the target site mainly comprises 20 bases, and the 3' -end of the 20 bases is a PAM region of 3 bases of NGG with N being any base; b. the target site is selected at the front end of the gene coding region; c. the first base of the Guide1 sequence must be G, and when the first base of the designed Guide1 sequence is not G, it will be necessary to place a G base in front; preferably: the Guide1 sequence is GCCGCGGATGTGTGGGTACT; as shown in SEQ ID NO. 3;

② . Target site primer pairs pRGEB-SMT-Guide 1-Oligo 1 and pRGEB-SMT-Guide 1-Oligo 2 are designed by binding to the cohesive end of Bsa I cleavage site of pRGEB plasmid (purchased from vast Programme plasmid platform) with the gene target site Guide1 designed in ①, and the specific sequences are as follows:

pRGEB32-SMT-Guide 1-Oligo 1: GGCAGCCGCGGATGTGTGGGTACT; as shown in SEQ ID NO. 4; pRGEB32-SMT-Guide 1-Oligo 2: AAACAGTACCCACACATCCGCGGC as shown in SEQ ID NO. 5.

The method for improving the blood root alkali content in the macleaya cordata,

Step 2) construction of a macleaya cordata gene knockout vector:

① . Cutting pRGEB plasmid into linearization plasmid by Bsa I enzyme, electrophoresis, recovering and purifying target fragment;

② . Annealing and phosphorylating the synthesized target site Oligos sequence to obtain a target double-strand;

③ . The target double-stranded sequence in ② is connected with pRGEB linearization vector through ligase, the connection product is transfected into DH5 alpha competent cell cells, shake culture is carried out, antibiotic screening is carried out, colony PCR identification screening positive clone is carried out, and correct recombinant vector is identified as: pRGEB32-SMT1.

The method for improving the blood root alkali content in the macleaya cordata,

Step 3) agrobacterium tumefaciens-mediated genetic transformation of macleaya cordata:

① . Transforming the constructed recombinant plasmid pRGEB-SMT 1 into agrobacterium tumefaciens, shake culturing, and screening antibiotics to obtain agrobacterium tumefaciens single colony;

② . Selecting agrobacterium tumefaciens monoclonal to extract plasmids, carrying out PCR identification, screening, sequencing and amplification culture on positive clones, and carrying out macleaya cordata explant infection on bacterial liquid;

③ . And (3) performing co-culture on the infected macleaya cordata explants, and then performing screening culture to complete the whole tissue culture process so as to obtain the positive seedlings of the macleaya cordata gyrator.

The method for improving the blood root alkali content in the macleaya cordata,

Vector construction identification primer

M13R: GAGCGGATAACAATTTCACACAGG as shown in SEQ ID NO. 6;

pRGEB32-R: GACCCGAATTTGTGGACCTG as shown in SEQ ID NO. 7.

The method for improving the blood root alkali content in the macleaya cordata,

McSMT gene target site mutation identification primer:

SMT-F: ATGGATGCCAAATTAGAAGAAGCGA; as shown in SEQ ID NO. 8;

SMT-R: TGAAACTCAATGACATGGAGACCTT; as shown in SEQ ID NO. 9.

The method for improving the blood root alkali content in the macleaya cordata,

Identification of gene editing results:

Agrobacterium-mediated pRGEB-SMT 1 plasmid genetic transformation to obtain regenerated plant extracted total DNA, SMT-F/SMT-R primer pair is used to amplify target segment containing gene target site, and sequencing to identify the base mutation of the target site.

The second object of the invention is the application of the method for increasing the blood root alkali content in the macleaya cordata, which is used for cultivating new macleaya cordata germplasm for increasing the blood root alkali content. The method mainly aims at the problem that the conventional breeding of the macleaya cordata cannot quickly obtain the germplasm material with high blood root alkali content, and the gene editing technology is applied to the macleaya cordata plant for the first time to obtain the macleaya cordata germplasm material with important application value.

The invention has the beneficial effects that:

1. editing a benzyl isoquinoline alkaloid metabolic pathway in the macleaya cordata by utilizing a CRISPR/Cas9 gene editing technology for the first time; 2. successfully obtain the macleaya cordata plant with obviously improved blood root alkali content.

In the invention, the following components are added:

CRISPR/Cas9: abbreviation Clustered Regularly Interspaced Short Palindromic Repeats (regularly clustered interval short palindromic repeats)/CRISPR-associated protein 9 (CRISPR associated protein 9), is a third generation "genome site-directed editing technology".

The SMT gene is scoulerine-9-O-METHYLTRANSFERASE, is a methyltransferase gene, and can catalyze the production of tetrahydropalmatine from the corydalis amabilis in the biosynthesis process of benzyl isoquinoline alkaloids.

DNA: deoxyribonucleic acid is one of four biological macromolecules contained in biological cells.

And (2) PCR: polymerase chain reaction is a molecular biological technique for amplifying specific DNA fragments.

PAM: (Protospacer adjacent motif) a prosomain sequence adjacent motif, a short nucleotide motif found in crRNA molecules, can be specifically recognized and cleaved by Cas9 proteins.

Drawings

Fig. 1: design of target locus of macleaya cordata McSMT gene (the sequence of the shadow part is Guide1, and the sequence in the square frame is PAM region)

Fig. 2: pRGEB32 plasmid map;

fig. 3: the macleaya cordata McSMT gene edits the transgenic positive seedlings;

Fig. 4: amplifying an electrophoresis chart of a vector fragment of a knockout plant of the macleaya cordata McSMT gene;

description: m is DL2000 Marker, the number represents different plants, and the size of the target band is 616bp;

fig. 5: a macleaya cordata McSMT gene target site mutation and a corresponding peak diagram;

Fig. 6: comparing the content of chelerythrine branch path compounds;

Note that: the bar graph corresponds to the upper chelerythrine pathway compound, and(s) -tetrahydroberberine,(s) -cis-N-methyltetrahydrophobatin, allocryptopine, dihydrochelerythrine and chelerythrine are respectively arranged from left to right. Asterisks indicate significant differences (< 0.05, < P <0.01, < P <0.005, < P < 0.001);

Fig. 7: comparing the contents of the compounds in the paths before branching;

Note that: the bar graph corresponds to the upper part of the anterior approach compound, and from left to right, the compound comprises(s) -desmethyltrant linderamine,(s) -N-methyltrant linderamine, 3-hydroxy-N-methyltrant linderamine,(s) -reticuline and(s) -golden corydaline; asterisks indicate significant differences (< 0.05, < P <0.01, < P <0.005, < P < 0.001);

Fig. 8: comparing the compound content of the sanguinarine branch path;

Note that: the bar graph corresponds to the upper sanguinarine pathway compound, and the bar graph is respectively provided with(s) -garrulous leaf corydaline standard curve,(s) -oripavine,(s) -cis-N-methyl oripavine, protopine, dihydrosanguinarine and sanguinarine from left to right; asterisks indicate significant differences (×p <0.05, ×p <0.01, ×p <0.005, ×p < 0.001).

Detailed Description

The following examples are intended to further illustrate the invention, but not to limit it.

Example 1:

1) Designing and synthesizing a target locus primer of the macleaya cordata McSMT gene:

① . Using plant genome editing target site design software CRISPR-P2.0 (http:// CRISPR. Hzau. Edu. Cn/CRISPR2 /), a McSMT gene target site Guide1 (hatched sequence in fig. 1) was designed in the coding region of the macleaya cordata McSMT gene avoiding intronic regions, and the design principle of the target site was: a. the target site mainly comprises 20 bases, and the 3' -end of the 20 bases is a PAM region (Protospacer adjacent motif, PAM) of 3 bases of NGG (N is any base) (square frame part sequence in FIG. 1); b. the target site is selected at the front end of the gene coding region as much as possible; c. the first base of the Guide sequence must be G, and when the first base of the designed Guide sequence is not G, it will be necessary to prepend a G base. Fig. 1: design of target locus of macleaya cordata McSMT gene (the sequence of the shadow part is Guide1, and the sequence in the square frame is PAM region)

② . The target site primer pair pRGEB-SMT-Guide 1-Oligo 1 and pRGEB-SMT-Guide 1-Oligo 2 is designed by combining the gene target site Guide1 (20 bp) designed in ① with the adhesive end of the Bsa I cleavage site of the pRGEB plasmid (figure 2), the specific sequences are shown in Table 1, the shaded part is a base fragment complementary to the adhesive end of the Bsa I cleavage site of the pRGEB plasmid, and the primer synthesis is delegated to be completed by Beijing qing biological science and technology Co.

Table 1: mcSMT Gene target primer (the shaded portion is the fragment complementary to the cohesive end of the pRGEB plasmid Bsa I cleavage)

③ . Identification primer design and synthesis:

a. and using PRIMER PREMIER 6.0.0 primer design software to respectively design upstream and downstream primers of PCR amplification at about 300-400bp respectively at the upstream and downstream of the pRGEB carrier target site connecting site, wherein the primer sequences are shown in Table 2, and the target band 616bp of the recombinant plasmid amplification is mainly used for identifying the carrier construction result.

Table 2: vector construction identification primer

B. And using PRIMER PREMIER 6.0.0 primer design software to respectively design upstream and downstream primers of PCR amplification at about 300-400bp respectively at the upstream and downstream of McSMT gene target sites, wherein the primer sequences are shown in Table 3, and the amplified target band is about 703bp, and is mainly used for later target site mutation identification.

Table 3: mcSMT gene target site mutation identification primer

2) Construction of a macleaya cordata gene knockout vector:

① . The pRGEB plasmid was digested with Bsa I to form linearized plasmid, the reaction conditions were 37℃for 15min, 1% agarose gel electrophoresis was performed under 120V for 20min, the target fragment was recovered by gel cutting, and the target DNA was purified with gel recovery kit to a fragment size of about 15868bp.

② . And (3) carrying out annealing phosphorylation reaction on the synthesized target site Oligos sequences, wherein the reaction condition is that the temperature is 37 ℃, the reaction time is 30min, the reaction time is 95 ℃, the reaction time is 5min, and the reaction time is reduced to 25 ℃ at a cooling speed of 5 ℃/min, so that target double chains are obtained.

③ . The target double-stranded sequence in ② is connected with pRGEB linearization vector through ligase, the connection condition is that the mixture is placed for 10min at room temperature, 5 mu L of connection product is taken into 50 mu L of DH5 alpha competent cells, the mixture is mixed (added just after thawing on ice), the mixture is incubated for 30min on ice, heat shock is carried out for 90s at 42 ℃, then the mixture is immediately placed into ice water for standing for 3min, 500 mu L of LB liquid culture medium is added into a centrifuge tube, shake culture is carried out for 45min at 37 ℃ and 180R, the mixture is coated on LB solid screening medium containing kanamycin, positive clones are screened at 37 ℃, and colony PCR identification (M13R/pRGEB-R primer pair) is identified, and the right recombinant vector is identified as: pRGEB32-SMT1.

3) Agrobacterium tumefaciens mediated genetic transformation of macleaya cordata

① . Sucking 5 mu L of the constructed recombinant plasmid pRGEB-SMT 1, adding into 100 mu L of GV3101 agrobacterium tumefaciens competence which is just melted on ice, blowing and mixing for 20 times by a pipetting gun, transferring into a 100 mu L electric rotating cup, covering a cup cover, standing on ice for 5min, shocking in an Agr mode of an electroporation apparatus, standing on ice for 2min, adding 500 mu L of non-antibiotic LB liquid culture medium, placing in a shaking incubator at 28 ℃ and 180rpm for shaking culture for 2h, coating on LB solid screening culture medium containing kanamycin and rifampicin, culturing at 28 ℃ for 48h, and growing single agrobacterium tumefaciens colonies.

② . Selecting agrobacterium tumefaciens monoclonal to extract plasmids, screening positive clones by PCR identification (M13R/pRGEB-R primer pair), sequencing the plasmids by Beijing engine biotechnology Co., ltd., sequencing correct positive clones, performing amplification culture, and performing macleaya cordata explant (stem and leaf disc) infection when OD ₆₀₀ is 0.6-0.8.

② . Transferring the infected macleaya cordata explant to an MS culture medium containing acetosyringone for co-culture for three days, transferring to an MS screening culture medium containing hygromycin and timentin for screening culture, and completing the whole tissue culture process to obtain macleaya cordata gyrate positive seedlings (figure 3).

4) Identification of gene editing results:

The agrobacterium-mediated pRGEB-SMT 1 plasmid genetic transformation firstly obtains 12 regenerated plants, the plants grow well, the performances are consistent with that of wild plants, when the overground parts of the plants grow to 6-8cm high (figure 3), each plant shears a leaf and extracts total DNA, the result shows that 12 plants are transgenic positive plants (figure 4) in which plasmids are successfully transferred, the primers are used for amplifying target fragments containing gene target sites by using the SMT-F/SMT-R, the sequencing is used for identifying the base mutation of the target sites, the result shows that two types of single base insertion mutations appear at the target sites of McSMT genes, namely, one base "T" and one base "A" are inserted respectively (figure 5), and the sequencing peak diagrams of the 12 positive plants are single base set peaks of mutation sites, so that all the mutant plants are heterozygous mutations of both mutations.

Description: WT represents wild-type macleaya cordata sequencing results without mutations; KO-SMT1 represents McSMT gene target site mutation type 1; KO-SMT2 represents McSMT gene target site mutation type 2. In the figure, square frame bases are PAM sequences and target site sequences, sites indicated by triangles are cleavage sites of Cas9 proteins, and arrows are one base for gene mutation insertion.

5) Quantitative analysis of benzylisoquinoline alkaloid pathway compounds:

① . And (5) quantitatively analyzing the chelerythrine branched path compound. The compound content of the chelerythrine branch passage is quantitatively analyzed by using UPLC-QQQ MS for 6 plants McSMT gene knockout mutant plants and 6 whole plants of wild type plants (containing roots, stems and leaves), and the compound content is calculated according to peak areas and standard curves, so that the result is shown in figure 6, and compared with the wild type plants, after the branch passage key gene McSMT is knocked out, the(s) -corydaline cannot be effectively catalyzed to generate(s) -tetrahydropalmatine, and the compound content of(s) -tetrahydropalmatine,(s) -cis-N-methyltetraberberine, allocryptopine, dihydrochelvetine, chelerythrine and the like positioned at the downstream of the passage is obviously reduced to extremely low levels, so that the chelerythrine branch passage is effectively cut off.

② . Quantitative analysis of the compounds of the pre-branching pathway. The 6 McSMT gene knockout mutant plants and the 6 wild type plants (including roots, stems and leaves) were subjected to quantitative analysis for the compound content of the pre-branching passages, and the compound content was calculated according to peak areas and standard curves, as shown in fig. 7, and in the overall view, the compound content of the pre-branching compounds(s) -desmethyl-desmodium,(s) -N-methyl-desmodium, 3-hydroxy-N-methyl-desmodium,(s) -reticuline,(s) -corydaline and the like were significantly increased, except for(s) -reticuline, after the chelerythrine branching passages were cut off, compared with the wild type plants.

Note that: the bar graph corresponds to the upper part of the anterior approach compound, and from left to right, the compound comprises(s) -desmethyltrannine, tranquilization linderanine,(s) -N-methyltranquilization linderanine, 3-hydroxy-N-methyltranquilization linderanine,(s) -reticuline and(s) -golden corydaline. Asterisks indicate significant differences (< 0.05, < P <0.01, < P <0.005, < P < 0.001)

③ . Quantitative analysis of sanguinarine branch path compounds. The compound content of the sanguinarine branch path is quantitatively analyzed on 6 McSMT gene knockout mutant plants and 6 wild type plant whole plants (containing roots, stems and leaves), the compound content is calculated according to peak areas and standard curves, the result is shown in figure 8, compared with the wild type plants, after the celandine branch path key gene McSMT is knocked out, the compound content of the sanguinarine branch path compound(s) -garrulous leaf corydaline standard curves,(s) -papaverine,(s) -cis-N-methyl papaverine, protopine, dihydrosanguinarine, sanguinarine and the like is obviously improved except(s) -papaverine, especially the dihydrosanguinarine and sanguinarine are remarkably improved, and the average content is respectively improved by 4.95 times and 3.29 times.

Sequence listing

<110> Hunan agricultural university

<120> Method for increasing sanguinarine content in macleaya cordata and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1456

<212> DNA

<213> Macleaya cordata (willd.) r. Br.

<400> 1

atggatgcca aattagaaga agcgaataat ggctgctata tttcagaagc aggcaacttg 60

gggaggttga tatgccttcc catggctttg agagctgcaa ttgaactaaa tgtattcaat 120

atcatctctg aattcggacc cggagcacaa ctctcttcgc aagatttggt ggctaagatt 180

ccaacaacca atcctaatgc acacatctat ttagaacgaa tacttcgatt gctagccgca 240

agttcattcc tctctgtgac tacaagaact tcatcaaagt cctcgccgac atccatcatt 300

aatggccgta acggcaacat taatggtggt gatcaacatc acgataagaa agtagtaaca 360

gagagggtgt atgggttaac gaaggagtcg cgttgtttgg tgcctcgtga ggaggatgga 420

gtgtcattgg tgccaatgct gatgtttgtc gccgataaag tagtagtaga gagcttttat 480

aacctgaaag aggtggttct gcgacaaggg tgtgtgccgt ttgatatgac ccatggagtt 540

agtatctttg agtatgccgg gaaggagccg aggatgaaca aagtgttcaa tgaagccatg 600

ggagacttct ctgtcgttgc ttttgatgaa gtacttaagg tttacaatgg ttttgttgat 660

atgaaagaat tggttgatgt tgggggtgga attgggactt cacttagtaa catagtcgcc 720

aagtacccac acatccgcgg catcaatttt gacttgtctc atgttatctc tgttgcacct 780

aactacccag gttagctagc tactaattaa ttaggttctc tttctttctc tctctagatc 840

tctctctctc tctagcttga ctctcatata taaatattgt tcaaattgtt cattgagctg 900

gaacgcaggt gtggagcatg ttgcaggaga tatgtttgaa gagctaccaa aggcacaaaa 960

cattttgctt aaggtaagtt aaaaaattaa tcaaaactga tgataattaa aagctactaa 1020

aagcatatgt gtcccactac ttcaatacaa taaagtctga agagttgcct ttgaatagtt 1080

tttaataaag gtttgtgaaa agaaaacttg atcaattgca ttaatttact aaattttaat 1140

tatttcattg tatgcgcagt gggtactaca tgattgggac gacgagcagt gcctgaaatt 1200

gctaaagaat tgttggaatt cattgccgga gggcggaaag gtgatcgtga tcgagttcgt 1260

tataccttct gaaataggag ataatgcaga atccttcaat gcattaacac ccgatctcct 1320

tatgatggca ctgaatcctg gcggaaaaga acgaaaccta gttgaatttt atgatcttgc 1380

caatgctact ggattcacca aagctaagtc tcaccctatc tcccaaggtc tccatgtcat 1440

tgagtttcat aaatag 1456

<210> 2

<211> 1152

<212> DNA

<213> Macleaya cordata (willd.) r. Br.

<400> 2

atggatgcca aattagaaga agcgaataat ggctgctata tttcagaagc aggcaacttg 60

gggaggttga tatgccttcc catggctttg agagctgcaa ttgaactaaa tgtattcaat 120

atcatctctg aattcggacc cggagcacaa ctctcttcgc aagatttggt ggctaagatt 180

ccaacaacca atcctaatgc acacatctat ttagaacgaa tacttcgatt gctagccgca 240

agttcattcc tctctgtgac tacaagaact tcatcaaagt cctcgccgac atccatcatt 300

aatggccgta acggcaacat taatggtggt gatcaacatc acgataagaa agtagtaaca 360

gagagggtgt atgggttaac gaaggagtcg cgttgtttgg tgcctcgtga ggaggatgga 420

gtgtcattgg tgccaatgct gatgtttgtc gccgataaag tagtagtaga gagcttttat 480

aacctgaaag aggtggttct gcgacaaggg tgtgtgccgt ttgatatgac ccatggagtt 540

agtatctttg agtatgccgg gaaggagccg aggatgaaca aagtgttcaa tgaagccatg 600

ggagacttct ctgtcgttgc ttttgatgaa gtacttaagg tttacaatgg ttttgttgat 660

atgaaagaat tggttgatgt tgggggtgga attgggactt cacttagtaa catagtcgcc 720

aagtacccac acatccgcgg catcaatttt gacttgtctc atgttatctc tgttgcacct 780

aactacccag gtgtggagca tgttgcagga gatatgtttg aagagctacc aaaggcacaa 840

aacattttgc ttaagtgggt actacatgat tgggacgacg agcagtgcct gaaattgcta 900

aagaattgtt ggaattcatt gccggagggc ggaaaggtga tcgtgatcga gttcgttata 960

ccttctgaaa taggagataa tgcagaatcc ttcaatgcat taacacccga tctccttatg 1020

atggcactga atcctggcgg aaaagaacga aacctagttg aattttatga tcttgccaat 1080

gctactggat tcaccaaagc taagtctcac cctatctccc aaggtctcca tgtcattgag 1140

tttcataaat ag 1152

Claims (6)

1. A method for improving the content of sanguinarine in macleaya cordata is characterized in that the content of sanguinarine in macleaya cordata is improved by silencing McSMT gene expression in macleaya cordata or knocking out McSMT gene, and the full-length sequence and CDS region sequence of McSMT gene are shown as SEQ ID NO.1 and 2;

knocking out McSMT genes by using a CRISPR/Cas9 gene editing system;

The method specifically comprises the following steps:

1) Designing and synthesizing a primer of a target locus of the macleaya cordata McSMT gene;

2) Constructing a macleaya cordata gene knockout vector;

3) Agrobacterium tumefaciens-mediated genetic transformation of macleaya cordata;

Step 1) designing and synthesizing a target locus primer of the macleaya cordata McSMT gene:

① . Using plant genome editing target site design software, designing a McSMT gene target site Guide1 in a coding region of a macleaya cordata McSMT gene avoiding intron region, wherein the sequence of the Guide1 is GCCGCGGATGTGTGGGTACT;

② . Target site primer pairs pRGEB-SMT-Guide 1-Oligo 1 and pRGEB-SMT-Guide 1-Oligo 2 are designed by using the gene target site Guide1 designed in ① and combining pRGEB plasmid Bsa I enzyme cutting cohesive ends, and specific sequences are as follows:

pRGEB32-SMT-Guide 1-Oligo 1：GGCAGCCGCGGATGTGTGGGTACT；

pRGEB32-SMT-Guide 1-Oligo 2：AAACAGTACCCACACATCCGCGGC；

Step 2) construction of a macleaya cordata gene knockout vector:

① . Cutting pRGEB plasmid into linearization plasmid by Bsa I enzyme, electrophoresis, recovering and purifying target fragment;

② . Annealing and phosphorylating the synthesized target site Oligos sequence to obtain a target double-strand;

③ . The target double-stranded sequence in ② is connected with pRGEB linearization vector through ligase, the connection product is transfected into DH5 alpha competent cell cells, shake culture is carried out, antibiotic screening is carried out, colony PCR identification screening positive clone is carried out, and correct recombinant vector is identified as: pRGEB32-SMT1.

2. The method for increasing the blood root alkali content in macleaya cordata according to claim 1, wherein,

Step 3) agrobacterium tumefaciens-mediated genetic transformation of macleaya cordata:

① . Transforming the constructed recombinant plasmid pRGEB-SMT 1 into agrobacterium tumefaciens, shake culturing, and screening antibiotics to obtain agrobacterium tumefaciens single colony;

② . Selecting agrobacterium tumefaciens monoclonal to extract plasmids, carrying out PCR identification, screening, sequencing and amplification culture on positive clones, and carrying out macleaya cordata explant infection on bacterial liquid;

③ . And (3) performing co-culture on the infected macleaya cordata explants, and then performing screening culture to complete the whole tissue culture process so as to obtain the positive seedlings of the macleaya cordata gyrator.

3. The method for increasing the blood root alkali content in macleaya cordata according to claim 1, wherein,

Vector construction identification primer

M13R： GAGCGGATAACAATTTCACACAGG

pRGEB32-R：GACCCGAATTTGTGGACCTG。

4. The method for increasing the blood root alkali content in macleaya cordata according to claim 1, wherein,

McSMT gene target site mutation identification primer:

SMT-F：ATGGATGCCAAATTAGAAGAAGCGA；

SMT-R：TGAAACTCAATGACATGGAGACCTT。

5. The method for increasing the blood root alkali content in macleaya cordata according to claim 4, wherein,

Identification of gene editing results:

Agrobacterium-mediated pRGEB-SMT 1 plasmid genetic transformation to obtain regenerated plant extracted total DNA, SMT-F/SMT-R primer pair is used to amplify target segment containing gene target site, and sequencing to identify the base mutation of the target site.

6. Use of the method according to any one of claims 1-5 for breeding new germplasm of macleaya cordata with increased sanguinarine content.