CN114657189A - Coptis chinensis alkaloid synthetic gene CYP719A, and coding protein and application thereof - Google Patents

Abstract

The invention discloses a coptis alkaloid synthetic gene CYP719A, the nucleotide sequence of which is shown in SEQ ID NO.1, or the nucleotide sequence shown in SEQ ID NO.1 is subjected to substitution and/or deletion and/or addition of one or more nucleotides and expresses the nucleotide sequence of a protein with the same function. The invention also discloses the protein coded by the gene, an expression vector and a recombinant bacterium containing the gene, and identifies the functions of the protein. The gene participates in the biosynthesis of coptis alkaloid and can be used for catalytically synthesizing tetrahydroberberine.

Description

Coptis chinensis alkaloid synthetic gene CYP719A, and coding protein and application thereof

Technical Field

The invention belongs to the technical field of plant molecular biology and plant genetic engineering, and particularly relates to a CYP719A gene participating in coptis alkaloid biosynthesis, and a coding protein and application thereof.

Background

Huang Lian has the actions of clearing heat and drying dampness, purging fire and removing toxicity, and is listed as the top grade in Shen nong Ben Cao Jing. In 2020 edition "Chinese pharmacopoeia" stipulates that the source of the Coptis medicinal material is the dried rhizome of goldthread root (Coptis chinensis Franch.) or Coptis deltoidea C.Y.Cheng et Hsiao or Yunnan Coptis (C.teeta Wall.). The active ingredients in the coptis root are mainly alkaloids, including berberine, coptisine, jateorhizine, epiberberine, african tetrandrine, palmatine, magnoflorine and the like. Modern pharmacological studies show that the coptis has the effects of resisting bacteria, inflammation and oxidation, reducing blood fat, inhibiting tumor cell invasion and angiogenesis, resisting hyperglycemia and obesity, reducing cholesterol and the like.

The active ingredients of medicinal plants are mainly complex secondary metabolites, the growth and development processes and the accumulation of the secondary metabolites are a series of very complex physiological and biochemical processes and the expression of complex characters, and the analysis of the biosynthesis pathway of the important active ingredients is one of the research hotspots in the field of synthetic biology at home and abroad. At present, berberine is mainly used for the research of the biosynthesis pathway of the coptis plant alkaloid, but the analytic research of the biosynthesis pathway of the alkaloid including berberine in the medicinal coptis plant is still lacked. The coptis chinensis is a large amount of traditional Chinese medicinal materials commonly used in China, and the medicinal history is long, so that the research on the biosynthesis path of the effective component alkaloid of the coptis chinensis has important research significance.

Disclosure of Invention

The invention aims to provide a novel CYP719A gene participating in alkaloid biosynthesis of coptis chinensis as well as a coding protein and application thereof.

In a first aspect of the present invention, there is provided a CYP719A gene involved in the biosynthesis of coptis alkaloid, whose nucleotide sequence is SEQ ID NO: 1 is shown in the specification; or the nucleotide sequence of the same functional protein expressed by the nucleotide sequence shown in SEQ ID NO.1 through substitution and/or deletion and/or addition of one or more nucleotides.

In a second aspect of the invention, the invention provides a protein encoded by the coptis alkaloid synthetic gene CYP719A, wherein the amino acid sequence of the protein is shown as SEQ ID NO. 2; or a derivative protein with the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.

In a third aspect of the present invention, there is provided a eukaryotic expression vector comprising the CYP719A gene according to the first aspect of the present invention.

Further, the eukaryotic expression vector is a pESC-His yeast expression vector.

In a fourth aspect of the invention, there is provided a host cell comprising a eukaryotic expression vector according to the third aspect of the invention.

Further, the host cell is a yeast.

In a fifth aspect of the present invention, there is provided a use of the host cell according to the fourth aspect of the present invention in the catalytic synthesis of tetrahydroberberine.

In a sixth aspect of the present invention, a method for catalytically synthesizing tetrahydroberberine is provided, which comprises the following steps:

(1) culturing the host cell of the fourth aspect of the invention;

(2) isolating the protein of interest from the culture;

(3) the separated target protein is used for catalyzing the tetrahydroAfrican tetrandrine to synthesize the tetrahydroberberine.

In a seventh aspect of the present invention, there is provided a transient expression vector comprising the CYP719A gene according to the first aspect of the present invention.

Further, the transient expression vector is pCAMBIA-1301.

In an eighth aspect of the present invention, there is provided a recombinant bacterium comprising the transient expression vector of the seventh aspect of the present invention.

Further, the recombinant bacterium is a recombinant agrobacterium.

The ninth aspect of the invention provides an application of the recombinant bacterium in the eighth aspect of the invention in catalytic synthesis of tetrahydroberberine.

The tenth aspect of the invention provides another method for catalytically synthesizing tetrahydroberberine, which comprises the following steps:

(1) infecting plants by the recombinant bacteria of the eighth aspect of the invention to enable the target protein to be highly expressed in the plants;

(2) injecting tetrandrine into plant;

(3) the target protein catalyzes the tetrahydroAfrican tetrandrine to synthesize the tetrahydroberberine in the plant body.

Further, the plant is tobacco.

The invention provides the coptis CYP719A gene for the first time, and the sequence of the gene is never reported, wherein the gene is obtained by taking cDNA reverse transcribed from rhizome RNA of the coptis as a template to amplify a coding sequence, and the obtained sequence is 1476 bp. The invention utilizes the Coptis CYP719A gene to construct a yeast expression vector to be converted into a yeast strain, and induces corresponding Coptis CYP719A protein, experiments prove that the Coptis CYP719A protein can catalyze tetrahydrofangchin to generate the important precursor tetrahydroberberine of berberine, and provides a method for synthesizing the tetrahydroberberine in vitro at a microbial level. Meanwhile, the coptis CYP719A gene is utilized to construct a vector to instantaneously transform the tobacco leaves, and experiments show that the coptis CYP719A gene can catalyze the generation of tetrahydroberberine, so that the method has a wide prospect in the aspect of culturing heterologous plants containing coptis alkaloids.

Drawings

FIG. 1: 1% agarose gel electrophoresis of the PCR amplification product of Coptidis rhizoma CYP719A CDS.

FIG. 2: yeast expression plasmid map carrying target gene.

FIG. 3: and (5) detecting the yeast expression LC-MS.

FIG. 4: plant transient expression plasmid map carrying target gene.

FIG. 5: and (4) detecting the tobacco transient expression LC-MS.

Detailed Description

The present invention will be described in detail below with reference to examples. It should be understood that the illustrated embodiments are exemplary only, and are intended to be illustrative of the invention rather than limiting. Various modifications and equivalents will be apparent to those skilled in the art based on the following examples and are intended to fall within the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions or the instruction book molecular cloning: laboratory guidelines, or according to the manufacturer's instructions in the recommended method.

Example 1 cloning of the Coptis chinensis CYP719A Gene

1.1 extraction of RNA from rhizome of Coptis chinensis

Extracting a rhizoma coptidis rhizome total RNA sample by using a Baitaig polysaccharide polyphenol total RNA extraction kit, and measuring the concentration by using a NanoDrop ultramicro spectrophotometer;

the purity of RNA is detected by 1% agarose gel electrophoresis, and after the electrophoresis is finished, the electrophoresis picture of the rhizoma coptidis rhizome total RNA on an ultraviolet gel imaging instrument is observed, two clear bands of 28S and 18S can be seen, and the brightness of the 28S band is about 2 times of that of the 18S band. The RNA extraction is complete, no degradation is caused, and the follow-up requirements can be met.

1.2 Synthesis of first Strand cDNA

Taking RNA stored AT-80 ℃, carrying out reverse transcription operation according to the instruction of the whole gold reverse transcription kit, wherein the reaction system and the program can refer to the instruction of the whole gold reverse transcription kit (catalog number: AT311), carrying out the reaction on ice, and storing cDNA after reverse transcription in a refrigerator AT-20 ℃ for later use.

1.3 cloning of the sequence of the coding region of the Coptis chinensis CYP719A Gene

Designing a specific primer according to a coding region sequence obtained from a coptis genome prediction result:

CYP719A-F:ATGGAGATGAGTCCACTGCT(SEQ ID NO.3)

CYP719A-R:TCAAACATTTCTACCAGCGATCC(SEQ ID NO.4)

taking coptis rhizome cDNA as a template to amplify a coding region sequence to obtain a target gene segment, wherein an amplification system and a program are as follows:

an amplification system:

and (3) amplification procedure:

detecting amplified target band with 1% agarose gel electrophoresis, wherein the amplified band is shown in FIG. 1, after electrophoresis, the target gene band is subjected to gel cutting recovery by using OMEGA gel recovery kit, and the gel cutting recovery operation refers to OMEGA gel recovery kit instruction (catalog number: D2500-01); the recovered gel product was ligated to a cloning vector pEASY-T1 (Beijing Quanjin Biotechnology Co., Ltd.). The ligated recombinant plasmid was transformed into competence with Trans1-T1 Phage Resistant by the following transformation procedures:

(1) taking 50 mu L of Trans1-T1 competent cells melted on ice bath, adding 1 mu L of recombinant plasmid, gently mixing uniformly, and placing in ice bath for 30 min;

(2) carrying out water bath heat shock at 42 ℃ for 30s, and then quickly transferring the tube into an ice bath for 2 min;

(3) adding 500 μ L of LB culture solution without antibiotics, mixing, placing in a shaker at 37 deg.C, culturing at 200rpm for 1h to recover bacteria;

(4) centrifuging at 12000rpm for 1min, sucking more supernatant with a pipette gun, reserving 100 μ L of the bacterial liquid at the bottom of the tube, coating the reserved bacterial liquid on an LB culture dish containing antibiotics (50 μ g/mL Amp), and standing overnight at 37 ℃.

And identifying the single colony growing on the culture dish by colony PCR, sending the positive clone bacterial liquid to Shanghai's worker Limited company for sequencing, wherein the sequencing result shows that the amplified coptis chinensis CYP719A gene cDNA sequence has 1476bp in size, and the specific sequence is shown in SEQ ID NO: 1, the amino acid sequence of the protein coded by the gene is shown in SEQ ID NO. 2.

And carrying out subsequent experiments after the sequencing is correct.

Example 2 expression of CYP719A Gene in Yeast and functional verification of the encoded protein

2.1 Yeast recombinant expression vector construction

SpeI is selected as an enzyme cutting site according to a target gene sequence and restriction enzyme information on a yeast expression vector sequence, the yeast expression vector used in the experiment is pESC-His plasmid provided by Chinese traditional medicine science research institute, and a plasmid map carrying the target gene is constructed successfully and is shown in figure 2. Synthesizing a target gene amplification primer with SpeI enzyme cutting sites and amplifying to obtain a target gene PCR product containing the enzyme cutting sites, wherein the amplification conditions, the procedures and the primers are as follows:

His-SpeI-F:CACTAAAGGGCGGCCGCACTAGTATGGAGATGAGTCCAC TGCTT(SEQ ID NO.5)

His-SpeI-R:CTTGTAATCCATCGATACTAGTTCAAACATTTCTACCAGC GATC(SEQ ID NO.6)

an amplification system:

and (3) amplification procedure:

selecting SpeI restriction enzyme of TaKaRa to perform single enzyme digestion on a target gene PCR product with an enzyme digestion site and a pESC-His empty vector, wherein an enzyme digestion system and a program are as follows:

a target gene enzyme digestion system:

an empty vector enzyme digestion system:

the enzyme digestion can be completed after incubation for 20min at 37 ℃. A1% agarose gel electrophoresis was used to determine whether a single cleavage was successful.

And after the enzyme digestion is successful, carrying out enrichment reaction on the two systems (10 reactions are carried out on each system), carrying out gel cutting recovery treatment on the enriched products, and recovering the enzyme digestion products of the target gene and the empty vector by using an OMEGA gel recovery kit.

The target gene was ligated to the digested plasmid using NEB T4 ligase (New England Biolabs) according to the following protocol:

a connection system:

and (3) connecting procedures:

the ligation product was transformed into DH 5. alpha. competent cells (Shanghai Diego Biotechnology Co., Ltd.) by the following transformation procedure:

a. taking out DH5a competent cells from-80 ℃, rapidly inserting the competent cells into ice, melting within 7-8min, taking 25 mu L of the melted DH5a competent cells into a new centrifuge tube, adding 10 mu L of the ligation product, slightly poking the bottom of the tube by hand to mix the cells evenly, and standing in ice for 25 min;

b.42 ℃ water bath heat shock for 45s, quickly putting back on ice and standing for 2 min;

c. adding 700 mu L of LB sterile liquid culture medium without antibiotics into a centrifuge tube, and placing the centrifuge tube in a shaker at 37 ℃ and 200rpm for incubation for 1 h;

d.12000rpm centrifugation for 1min to collect thallus, discard the supernatant, leave about 100u L bacterial liquid coated on LB + Amp (50u g/mL) plate, 37 degrees C, overnight.

And (3) selecting a monoclonal colony from the overnight plate for PCR detection, sending the detected positive clone bacterium liquid to Shanghai worker Limited for sequencing verification, naming the positive recombinant vector with correct sequencing as pESC-His-CYP719A, adding 60% glycerol, and storing in a refrigerator at-80 ℃ for later use.

2.2 Yeast transformation

And extracting recombinant plasmids in the positive clone bacterial liquid. In order to obtain a high concentration recombinant plasmid solution, a positive clone strain is cultured by incubating with LB + Amp (50. mu.g/mL) liquid medium with a volume of 40mL at 37 ℃ and 200rpm for 10h, and plasmid extraction is performed by using a plasmid miniextraction kit (Tiangen Biochemical technology Co., Ltd.) after incubation, wherein the plasmid extraction operation is as follows:

a. column equilibration step: adding 500 μ L of balance liquid BL into adsorption column CP3 (the adsorption column is placed into the collection tube), centrifuging at 12,000rpm for 1min, pouring off waste liquid in the collection tube, and placing the adsorption column back into the collection tube;

b. centrifuging 40mL of positive clone bacterial liquid at 12000rpm for 5min, collecting cells, removing supernatant, adding 750 mu L of solution P1, uniformly mixing, and subpackaging the bacterial liquid into 3 new centrifugal tubes of 1.5 mL;

c. 250. mu.L of solution P2 was added to each of 3 tubes, and the tubes were gently inverted 6 to 8 times to lyse the cells sufficiently. The mixing operation needs to be mild, violent shaking is not needed, the mixed bacterial liquid is clear and viscous, and the time used is not more than 5 min;

d. adding 350 mu L of the solution P3 into each centrifuge tube, immediately turning the centrifuge tube up and down gently for 6-8 times, and fully mixing the solution to obtain white flocculent precipitates in the tubes. Centrifuging at 12000rpm for 10min to precipitate white precipitate at the bottom of the tube;

e. the supernatant collected in the 3 centrifuge tubes of the previous step was transferred to the same adsorption column CP3 (the adsorption column was placed in the collection tube) using a pipette gun, taking care not to aspirate the pellet as much as possible. Centrifuging at 12000rpm for 1min, pouring off waste liquid in the collecting tube, and returning the adsorption column CP3 into the collecting tube, wherein the supernatant is excessive and the operation is repeated until the supernatant is completely transferred;

f. adding 600 μ L of rinsing solution PW (added with anhydrous ethanol) into adsorption column CP3, centrifuging at 12000rpm for 1min, removing waste liquid from the collection tube, and placing adsorption column CP3 into the collection tube.

g. Adding 600 μ L of rinsing solution PW (added with anhydrous ethanol) into adsorption column CP3, centrifuging at 12000rpm for 1min, removing waste liquid from the collection tube, and placing adsorption column CP3 into the collection tube.

h. Placing adsorption column CP3 into the collection tube, centrifuging at 12000rpm for 1min, opening the cover of the adsorption column, air drying in a fume hood for 5min, and removing residual rinsing liquid;

i. placing the adsorption column CP3 in a clean centrifuge tube, dripping 60 μ L sterile water to the middle part of the adsorption membrane, placing for 2min at room temperature, centrifuging at 12000rpm for 2min, collecting the plasmid solution in the centrifuge tube, sucking the solution at the bottom of the tube to the middle part of the adsorption membrane by a pipette gun, centrifuging at 12000rpm for 2min again to ensure the plasmid concentration, and detecting the concentration and quality of the finally obtained plasmid solution.

Yeast cells are prepared. The glycerol-preserved WAT11 strain was streaked out on YPD solid medium and cultured at 30 ℃ to grow a single colony at approximately 2-3 days. Selecting yeast single colony, placing in 10mL YPD liquid culture medium, shaking at 30 deg.C and 200rpm to OD₆₀₀After the culture medium is changed to 0.2-0.3, 40mL YPD liquid culture medium is added to continue shaking the bacteria until the concentration of the bacteria liquid is OD₆₀₀0.4-0.5. Centrifugation at 12000rpm for 5min, yeast cells were collected, the collected yeast cells were resuspended in 25mL of sterile water, centrifugation at 12000rpm for 5min, and the supernatant was discarded.

Preparation of yeast competent cells. The yeast cells collected after resuspension were added to 1mL of 100mM LiAc, mixed well, transferred to a sterilized 1.5mL centrifuge tube, centrifuged at 12000rpm for 30s, the LiAc at the upper layer was aspirated by a pipette gun, and the yeast cells were resuspended by adding 0.5mL of 100mM LiAc. The resuspended cells were aliquoted and centrifuged at 12000rpm for 1min at 50. mu.L per tube, and the LiAc layer was aspirated.

Transformation of yeast competent cells. Preparing a premixed solution required for transformation, adding a yeast expression vector (taking water as a blank control), uniformly mixing by vortex, carrying out water bath at 30 ℃ for 30min, carrying out heat shock at 42 ℃ for 25min, centrifuging at 12000rpm for 30s, sucking a supernatant, adding 1mL of YPD liquid culture medium, re-suspending cells, and carrying out water bath at 30 ℃ for 1 h. The formula of the premix is as follows:

and (5) transformation and screening. 100 mu L of yeast recombinant plasmid competent cells are sucked and coated on an SD-His defective plate, after 2d of culture at 30 ℃, single colonies grow on the plate, the single colonies are selected for PCR verification, and if the single colonies are verified to be positive clones, the target gene expression vector is transferred into a yeast strain, and the next step of induced expression can be carried out.

2.3 extraction of Yeast induced proteins

And (3) selecting the positive clone strains to 25mL of SD-His defective liquid culture medium, and culturing for about 60 hours in a shaking table at 30 ℃ and 250rpm until the yeast is deposited at the bottom of the tube and the culture solution is clear and bright. Centrifuging at 10000rpm for 5min to collect cells, adding 125mL YPL induced expression culture medium, culturing at 30 deg.C and 250rpm in a shaking table for about 15h, centrifuging at 10000rpm for 5min to collect cells, resuspending the cells with 15mL ice-bath TE + KCl solution, and standing at room temperature for 5 min. Cells were harvested by centrifugation at 10000rpm for 5min, resuspended in 500. mu.L ice-bath TESB solution and acid-washed glass beads were added until they just contacted the cell suspension surface. After shaking for 30s using a vortex shaker, the tube containing the cell fluid was inserted into ice, and after 30s of ice-bath, the tube was again shaken for 30s, and the operation was repeated 45 times to disrupt the cells. The disrupted cells were placed on ice, 10mL of TESB-washed glass beads were added, the supernatant was recovered, the supernatant was collected twice, centrifuged at 14000rpm for 15min, the supernatant was poured into a new tube, centrifuged at 14000rpm for 15min, the supernatant was again taken and placed in a new tube, and centrifuged at 14000rpm for 2 h. Centrifuging, removing supernatant to see white precipitate at the bottom of the tube, adding 50 μ L TEG to dissolve the precipitate, sucking out the precipitate with a pipette gun, transferring to a 1.5mL centrifuge tube to obtain CYP719A microsomal protein and pESC-His no-load induced microsomal protein, and storing at-80 deg.C for use.

2.4 in vitro microsomal enzymatic reaction

And (3) carrying out enzymatic reaction on the two yeast microsomal protein solutions, taking CYP719A microsomal protein reaction as a sample, and taking pESC-His idle induced microsomal protein as a reference substance. The enzymatic reaction system is 500 mu L, and the reaction system is as follows: 0.5mg microsomal protein, 100mM Tris-HCl (pH 7.5), 500uM NADPH, 100uM substrate (tetrahydrofangchin). Reaction conditions are as follows: incubate at 200rpm for 4h at 30 ℃.

And after the reaction is finished, adding ethyl acetate with the same volume into the reaction system for extraction, performing ultrasonic treatment for 20min, performing vortex oscillation for 2min, centrifuging at 12000rpm for 2min, collecting supernatant, drying ethyl acetate by using a vacuum freeze dryer, adding 200 mu L of methanol for dissolution, and filtering by using a 0.22 mu M microporous filter membrane for subsequent LC-MS detection. The results of the tests of the samples and the control group are shown in FIG. 3.

The LC-MS detection parameters were as follows: chromatographic column Welch

UHPLC C18 (2.1X 100mm, 1.8 um); the mobile phase consists of a mobile phase A and a mobile phase B, wherein the mobile phase A is 0.1% formic acid water, and the mobile phase B is 0.1% formic acid acetonitrile; the sample introduction amount is 10 mu L, the detection wavelength is 286nm, the flow rate is 0.8ml/min, and the column temperature is 35 ℃; adopting a gradient elution method, wherein the elution conditions are as follows: 0-5min 5% -15% B, 5-25min 15% -20% B, 25-32min 20% -25% B, 32-40min 25% -40% B, 40-50min 40% -90% B; the mass spectrum conditions are that the chemical mode is a point spray (ESI) positive ion mode, the capillary voltage is 4500V, the atomization pressure is 1bar, the desolvation gas is nitrogen, the flow rate is 6.0L/min, the desolvation temperature and the ion source temperature are both 180 ℃, the scanning range m/z is 100-ESI 1000, the LC-MS data collection software is MassLynx V4.1(Waters, USA), and sodium trifluoroacetate is used as the correction fluid for accurate molecular weight.

Example 3 transient expression of CYP719A Gene in tobacco and functional verification of encoded protein

3.1 construction of transient expression vectors

Bgl II is selected as an enzyme cutting site according to a target gene sequence and restriction enzyme information on a tobacco transient expression vector sequence, the tobacco transient expression vector used in the experiment is pCAMBIA-1301 plasmid provided by Chinese medicine science research institute, and plasmid map information carrying the target gene is shown in figure 4. Synthesizing a target gene amplification primer with BglII enzyme cutting sites, amplifying, selecting TaKaRa DNA Polymerase to obtain a target gene PCR product containing the enzyme cutting sites, wherein the primers, the reaction conditions and the program are as follows:

CYP-Bgl Ⅱ-F：GGCCAGATCTATGGAGATGAGTCCACTGCTTG(SEQ ID NO.7)

CYP-Bgl Ⅱ-R：GGCCAGATCTTCAAACATTTCTACCAGCGATC(SEQ ID NO.8)

and (3) an amplification system:

and (3) amplification procedure:

detecting whether the target gene band is successfully amplified by using 1 percent agarose gel electrophoresis, performing single enzyme digestion on a target gene PCR product with an enzyme digestion site and an empty vector by using Bgl II restriction enzyme (Saimer Feishell technology),

a target gene enzyme digestion system:

an empty vector enzyme digestion system:

the enzyme digestion can be completed after incubation for 20min at 37 ℃. The single digestion was checked for success by electrophoresis on a 1% agarose gel.

After the enzyme digestion is successful, enrichment reaction is carried out on the two systems (10 reactions are carried out on each system), the enrichment product is subjected to gel cutting recovery processing, and finally the purified product CYP719A with the concentration of 364.9 ng/. mu.L and the enzyme digestion plasmid with the concentration of 470 ng/. mu.L are obtained.

The target gene was ligated to the digested plasmid using NEB T4 ligase (New England Biolabs) in the following protocol:

a connection system:

and (3) connecting procedures:

and (5) detecting positive clone colonies. The ligation products were transformed into DH 5. alpha. competent cells (Shanghai Diwei Biotech Co., Ltd.), the transformation procedure was the same as that of DH 5. alpha. competent cells in yeast expression described above, cells were collected by centrifugation, the supernatant was discarded, and about 100. mu.L of the resulting cell suspension was spread on LB + Kan (50ug/mL) plates and incubated at 37 ℃ overnight.

And selecting a single colony to perform colony PCR detection, sequencing the positive clone bacterial liquid, if the sequencing is correct, indicating that the transient expression vector is successfully constructed, and adding 60% of glycerol, and storing in a refrigerator at-80 ℃ for later use, wherein the pCAMBIA-1301-CYP719A is named.

3.2 Agrobacterium competent transformation

The recombinant plasmid was extracted from the above-mentioned positive clone strain using a plasmid. In order to obtain a high-concentration recombinant plasmid solution, incubating the solution for 10 hours at 37 ℃ and 200rpm by using a liquid culture medium with the volume of 40mL LB + Kan (50 mu g/mL), culturing a positive clone strain, and extracting plasmids by using a plasmid miniextraction kit (Tiangen Biochemical technology Co., Ltd.) after incubation, wherein the plasmid extraction operation can refer to the plasmid extraction step in the yeast transformation step, and the finally obtained plasmid solution is subjected to concentration and quality detection;

the extracted tobacco transient expression plasmid is transferred into agrobacterium tumefaciens, and the specific operation is as follows:

a. taking Agrobacterium rhizogenes competent GV3101 (Shanghai Weidi Biotechnology Co., Ltd.) stored at-80 deg.C, melting part of the palm for a moment, and inserting into ice when in ice-water mixed state;

b. adding 25 μ L of Agrobacterium tumefaciens competence into 1 μ L of the extracted plant transient expression recombinant plasmid, lightly dialing the tube bottom with hand to mix them uniformly, standing on ice for 5min, liquid nitrogen for 5min, water bath at 37 deg.C for 5min, and ice bath for 5 min;

c. adding 700 μ L LB liquid medium without antibiotics, and culturing in shaker at 28 deg.C and 200rpm for 2-3 h;

d.12000rpm centrifugation for 1min to collect bacterial liquid, discard excessive supernatant, leave about 100. mu.L bacterial liquid and spread on LB + Kan (50. mu.g/mL) + Rif (20. mu.g/mL) solid culture medium plate, and culture at 28 deg.c for 2-3 days.

Selecting single colony from the plate for PCR positive clone detection, culturing the positive clone strain with 40mL LB + Kan (50 μ g/mL) + Rif (20 μ g/mL) liquid culture medium at 28 deg.C and 200rpm in a shaker, and detecting bacterial liquid concentration with ultraviolet spectrophotometer until OD₆₀₀The next induction can be carried out when the induction rate is about 1.0.

3.3 Agrobacterium Induction

Centrifuging the bacterial liquid at 12000rpm for 5min, discarding the supernatant, adding 25mL of sterile water to resuspend cells, centrifuging at 12000rpm for 5min, discarding the supernatant, and repeating the operation twice; add buffer to resuspend the cells and allow their OD₆₀₀Standing at room temperature for 3h, wherein the temperature is 0.5-0.6. The buffer was prepared as follows:

3.4 Agrobacterium infection of tobacco

Selecting healthy tobacco plants with at least 6 leaves, slowly injecting the heavy suspension liquid carrying the target gene plasmid and the no-load heavy suspension liquid from veins on the back of the tobacco leaves by using a sterile injector, and culturing for 3 d.

3.5 substrate injection and sample detection

And (4) injecting a substrate. Preparing 100 mu g/mL tetrahydroAfrican berberine solution (water is used as a solvent, 0.1% DMSO is added as a cosolvent), adopting the consistent method to inject the substrate solution into the tobacco leaves which are injected with the target gene plasmid and the empty load suspension, and culturing for 24h again.

And (4) detecting a sample. Taking experimental tobacco leaves (containing the carried target gene and the unloaded resuspension and the substrate) after 24h, freezing by liquid nitrogen, grinding into powder, drying in a freeze dryer for 48h, taking about 1.5g of the dried powder, adding 25mL of 80% methanol aqueous solution, performing ultrasonic treatment for 2h, centrifuging at 12000rpm for 1min, collecting supernatant, filtering by a 0.22 mu m microporous membrane, and detecting by LC-MS. The detection conditions were identical to those of the 2.4 detection conditions described above. The no-load induction group added with the substrate is taken as a control group, the carrier induction group carrying the target gene is taken as a sample, and the detection result is shown in figure 5.

Media and reagents used in the examples:

LB culture medium: 10g of tryptone, 5g of yeast extract, 5g of NaCl, and adding distilled water to 1000ml, wherein the pH value is 7.0;

YPD medium: 1% Bacto-yeast Extra, 2% Bacto-peptone and 2% glucose Dextrose without adjusting pH value, sterilizing at high temperature and high pressure, and adding 2% Bactoagar into solid culture medium;

YPL medium: 1% yeast extra, 2% peptone, 2% galactose;

TE buffer：50mM Tris-HCl(pH 7.5)，1mM EDTA；

TEK buffer: TE buffer containing 0.1M KCl;

TES buffer B: contains 0.6M sorbitol TE buffer;

TEG: TE buffer containing 20% glycerol;

1% agarose gel: weighing 0.5g of agarose, dissolving in 50mL of electrophoresis buffer TAE, heating in a microwave oven to completely melt the agarose, washing a bottle containing the agarose solution with cold water, adding 2.5 microliter of green fluorescent dye when the solution is cooled to be not too hot, uniformly mixing, pouring into a rubber plate, inserting a comb with a spot hole, and standing at room temperature for 10min to solidify the agarose.

Sequence listing

<110> Hubei university of traditional Chinese medicine

<120> coptis alkaloid synthetic gene CYP719A, and coding protein and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> Coptis chinensis (Coptis chinensis)

<400> 1

atggagatga gtccactgct tgtctgtgct actgtagcaa ttgtgtttgc cacaacaacc 60

ataatccgaa ttttattctc gtcctcgtca ttgccacaga tgaaatggcc aagcggtccg 120

agaaaattac caatcatagg gaacttgcac caactaggcg atgatgtgct ccatgtcgcc 180

ttggccaaac ttgcgaaagt tcacggtagt gtgatgacaa tctggattgg tagctggcgg 240

cccgtcattg tcatcagtga ccttgaaaag gcatgggagg ttcttgtgaa caagtcagca 300

gattatggag cgcgtgacat gcccgaaata actaaaattg catcagccag ctggcacacc 360

atatccacct cggatgctgg tcccttctgg cagaatgttc gtaagggact tcaaagtgga 420

gcaatgggtc ctttcaatgt tgccgcacaa aatcaatatc aagaaaggga catgaaacgc 480

ttgatcaaag ctatgagcga cgaagcagcc aacaacaatg gcatcgtcaa accacttgac 540

cacattaaaa agaacactgt caggttacta actcgcctta ttttcggtca gacctttgat 600

gataacaagt ttattgagtc tatgcattat gagattgaag atattattcg cattagtggc 660

tatgctcgtc ttgccgaggc attctattat gcaaagtacc tccccagtca caaaaaagcc 720

gagagagagg catttctggt gaagtgtaga gttgaagaat tggtgaggcc acttctctct 780

tcaaaccctc caacaaatag ctatttgtac tttcttctct cacagaattt cgaagaggaa 840

gttatcatat tttgcatttt tgagctgtac cttcttgggg tggacagtac ttcctctacc 900

actacatggg cactcgctta cttgatccgt gaacaaggag cacaagagaa gctctaccaa 960

gatattagga tgacactcgg tgatgtggat cttgtgaaga ttgaagatgt gaataaattg 1020

aagtatttgc aaggtgttgt taaagaaaca atgagaatga agccaattgc acctcttgct 1080

attccacaca agactgctaa ggaaactacg ttgatgggga ctaaggtagc caagggtaca 1140

cgaattatgg tgaaccttta cgccttgcat cataaccaaa acatatggcc tgatccttac 1200

aagttcatgc ctgagagatt cttggaaggt gaaactggta ctgcatataa caaagcaatg 1260

gaacaatcgt ttcttccctt cagtgctgga atgagaattt gcgcaggaat ggacttggga 1320

aagcttcagt ttgcttttgc tcttgctaac ttggtgaacg cattcaagtg gtcacgtgtt 1380

gaggaaggta agcttcctga tatgggcgag gaactatctt ttgttctcct aatgaaaacg 1440

ccacttgagg caaggatcgc tggtagaaat gtttga 1476

<210> 2

<211> 491

<212> PRT

<213> Coptis chinensis (Coptis chinensis)

<400> 2

Met Glu Met Ser Pro Leu Leu Val Cys Ala Thr Val Ala Ile Val Phe

1 5 10 15

Ala Thr Thr Thr Ile Ile Arg Ile Leu Phe Ser Ser Ser Ser Leu Pro

20 25 30

Gln Met Lys Trp Pro Ser Gly Pro Arg Lys Leu Pro Ile Ile Gly Asn

35 40 45

Leu His Gln Leu Gly Asp Asp Val Leu His Val Ala Leu Ala Lys Leu

50 55 60

Ala Lys Val His Gly Ser Val Met Thr Ile Trp Ile Gly Ser Trp Arg

65 70 75 80

Pro Val Ile Val Ile Ser Asp Leu Glu Lys Ala Trp Glu Val Leu Val

85 90 95

Asn Lys Ser Ala Asp Tyr Gly Ala Arg Asp Met Pro Glu Ile Thr Lys

100 105 110

Ile Ala Ser Ala Ser Trp His Thr Ile Ser Thr Ser Asp Ala Gly Pro

115 120 125

Phe Trp Gln Asn Val Arg Lys Gly Leu Gln Ser Gly Ala Met Gly Pro

130 135 140

Phe Asn Val Ala Ala Gln Asn Gln Tyr Gln Glu Arg Asp Met Lys Arg

145 150 155 160

Leu Ile Lys Ala Met Ser Asp Glu Ala Ala Asn Asn Asn Gly Ile Val

165 170 175

Lys Pro Leu Asp His Ile Lys Lys Asn Thr Val Arg Leu Leu Thr Arg

180 185 190

Leu Ile Phe Gly Gln Thr Phe Asp Asp Asn Lys Phe Ile Glu Ser Met

195 200 205

His Tyr Glu Ile Glu Asp Ile Ile Arg Ile Ser Gly Tyr Ala Arg Leu

210 215 220

Ala Glu Ala Phe Tyr Tyr Ala Lys Tyr Leu Pro Ser His Lys Lys Ala

225 230 235 240

Glu Arg Glu Ala Phe Leu Val Lys Cys Arg Val Glu Glu Leu Val Arg

245 250 255

Pro Leu Leu Ser Ser Asn Pro Pro Thr Asn Ser Tyr Leu Tyr Phe Leu

260 265 270

Leu Ser Gln Asn Phe Glu Glu Glu Val Ile Ile Phe Cys Ile Phe Glu

275 280 285

Leu Tyr Leu Leu Gly Val Asp Ser Thr Ser Ser Thr Thr Thr Trp Ala

290 295 300

Leu Ala Tyr Leu Ile Arg Glu Gln Gly Ala Gln Glu Lys Leu Tyr Gln

305 310 315 320

Asp Ile Arg Met Thr Leu Gly Asp Val Asp Leu Val Lys Ile Glu Asp

325 330 335

Val Asn Lys Leu Lys Tyr Leu Gln Gly Val Val Lys Glu Thr Met Arg

340 345 350

Met Lys Pro Ile Ala Pro Leu Ala Ile Pro His Lys Thr Ala Lys Glu

355 360 365

Thr Thr Leu Met Gly Thr Lys Val Ala Lys Gly Thr Arg Ile Met Val

370 375 380

Asn Leu Tyr Ala Leu His His Asn Gln Asn Ile Trp Pro Asp Pro Tyr

385 390 395 400

Lys Phe Met Pro Glu Arg Phe Leu Glu Gly Glu Thr Gly Thr Ala Tyr

405 410 415

Asn Lys Ala Met Glu Gln Ser Phe Leu Pro Phe Ser Ala Gly Met Arg

420 425 430

Ile Cys Ala Gly Met Asp Leu Gly Lys Leu Gln Phe Ala Phe Ala Leu

435 440 445

Ala Asn Leu Val Asn Ala Phe Lys Trp Ser Arg Val Glu Glu Gly Lys

450 455 460

Leu Pro Asp Met Gly Glu Glu Leu Ser Phe Val Leu Leu Met Lys Thr

465 470 475 480

Pro Leu Glu Ala Arg Ile Ala Gly Arg Asn Val

485 490

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggagatga gtccactgct 20

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaacattt ctaccagcga tcc 23

<210> 5

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cactaaaggg cggccgcact agtatggaga tgagtccact gctt 44

<210> 6

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cttgtaatcc atcgatacta gttcaaacat ttctaccagc gatc 44

<210> 7

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggccagatct atggagatga gtccactgct tg 32

<210> 8

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggccagatct tcaaacattt ctaccagcga tc 32

Claims (10)

1. A Chinese goldthread alkaloid synthetic gene CYP719A has a nucleotide sequence as follows:

(1) a nucleotide sequence shown as SEQ ID NO. 1;

(2) the nucleotide sequence shown in SEQ ID NO.1 is a nucleotide sequence which is obtained by substituting and/or deleting and/or adding one or more nucleotides and expressing the same functional protein.

2. The protein encoded by the coptis alkaloid synthetic gene CYP719A according to claim 1, wherein the amino acid sequence thereof is:

(1) a protein consisting of an amino acid sequence shown in SEQ ID NO. 2;

(2) and (3) derivative proteins with the same functions, wherein the amino acid sequences shown in SEQ ID NO.2 are substituted and/or deleted and/or added with one or more amino acid residues.

3. A eukaryotic expression vector containing the Coptidis rhizoma alkaloid synthesis gene CYP719A of claim 1.

4. A host cell comprising the eukaryotic expression vector of claim 3.

5. The use of the host cell of claim 4 for the catalytic synthesis of tetrahydroberberine.

6. A method for catalytically synthesizing tetrahydroberberine is characterized by comprising the following steps:

(1) culturing the host cell of claim 4;

(2) isolating the protein of interest from the culture;

(3) the separated target protein is used for catalyzing the tetrahydroAfrican tetrandrine to synthesize the tetrahydroberberine.

7. A transient expression vector comprising the Coptidis rhizoma alkaloid synthesis gene CYP719A according to claim 1.

8. A recombinant bacterium comprising the transient expression vector of claim 7.

9. The use of the recombinant bacterium of claim 8 in the catalytic synthesis of tetrahydroberberine.

10. A method for catalytically synthesizing tetrahydroberberine is characterized by comprising the following steps:

(1) infecting a plant with the recombinant bacterium of claim 8 to allow high expression of the target protein in the plant;

(2) injecting tetrandrine into plant;

(3) the target protein catalyzes the tetrahydroAfrican tetrandrine to synthesize the tetrahydroberberine in the plant body.

Images