CN113265388B - Tobacco system for producing ajmaline - Google Patents

Abstract

The invention discloses a vinca-derived tryptophan decarboxylase TDC, which has a nucleotide sequence of SEQ ID NO. 1 and can be used for producing ajmaline in a tobacco system. The invention takes tobacco as a mode chassis system, takes TDC, SLS, STR, NPF2.9, SGD and HYS as biological elements, constructs fusion genes, realizes the heterologous biosynthesis of the ajmaline, and has development prospect.

Description

Tobacco system for producing ajmaline

Technical Field

The invention belongs to the technical field of biosynthesis, and particularly relates to a tobacco system for producing ajmaline, and particularly relates to application of vinca-derived Tryptophan Decarboxylase (TDC) in producing ajmaline through expression in the tobacco system.

Background

Catharanthus roseus (Catharanthus roseus) is an important medicinal plant and contains abundant monoterpene indole alkaloid compounds. The hetero-yohimbine alkaloids are an important class of pharmaceutical compounds in the vinca rosea (Stavrinides et al, 2016). Ajmalicine (CAS No.:483-04-5, raubasine) is one of the heterothimbine alkaloids, and has been commercialized for the treatment of hypertension. The biomass of catharanthus roseus is low despite the high content of the ajmaline in the catharanthus roseus, and cannot meet the increasing social demand.

Based on metabolic engineering or synthetic biological strategies, heterologous synthesis of ajmaline is an effective means to meet the ever-increasing market demand. Currently, genes involved in the synthesis of ajmalicine and other heteroyohimbine alkaloids in vinca have been identified (Miettinen et al, 2014, stavrinides et al, 2016, 2015), which lays the foundation for the subsequent synthetic biological studies of ajmalicine and heteroyohimbine alkaloids.

Tobacco is an important model chassis system for synthetic biology research due to its large biomass and easy expression of plant-derived genes. This system has been successfully used for the heterologous synthesis of artemisinin and precursors, paclitaxel precursors, saponins and iridoids (Farhi et al, 2011 fuentes et al, 2016, li et al, 2019 malhotra et al, 2016, miettinen et al, 2014 paddon et al, 2013 reed et al, 2017), providing an important reference for the subsequent synthetic biology of the heterotrophic huntingine alkaloids in tobacco.

Disclosure of Invention

In order to realize biosynthesis of the ajmalicine in plants such as tobacco and the like, the tobacco is used as a model chassis system, an agrobacterium expression vector is constructed by a key gene obtained by cloning in catharanthus roseus, and heterologous expression is carried out in the tobacco through a tobacco transient expression system. Meanwhile, based on a synthetic biology strategy, the obtained key genes are used for constructing different fusion genes/proteins, so that the content of the ajmaline in the tobacco is further improved, and the biosynthesis of the ajmaline in the tobacco is realized for the first time.

Specifically, the present invention includes the following technical means.

A Tryptophan Decarboxylase (TDC) which is a polypeptide selected from the group consisting of:

(a) A polypeptide having the amino acid sequence of SEQ ID NO 1 (CrTDC);

(b) A polypeptide having 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO 1.

Wherein the amino acid sequence of SEQ ID NO. 1 is:

MGSIDSTNVAMSNSPVGEFKPLEAEEFRKQAHRMVDFIADYYKNVETYPVLSEVEPGYLRKRIPETAPYLPESLDDIMKDIQKDIIPGMTNWMSPNFYAFFPATVSSAAFLGEMLSTALNSVGFTWVSSPAATELEMIVMDWLAQILKLPKSFMFSGTGGGVIQNTTSESILCTIIAARERALEKLGPDSIGKLVCYGSDQTHTMFPKTCKLAGIFPNNIRLIPTTVETDFGISPQVLRKMVEDDVAAGYVPLFLCATLGTTSTTATDPVDSLSEIANEFGIWIHVDAAYAGSACICPEFRHYLDGIERVDSLSLSPHKWLLAYLDCTCLWVKQPHLLLRALTTNPEYLKNKQSDLDKVVDFKNWQIATGRKFRSLKLWLILRSYGVVNLQSHIRSDVAMAKMFEEWVRSDSRFEIVVPRNFSLVCFRLKPDVSSLDVEEVNKKLLDMLNSTGRVYMTHTIVGGIYMLRLAVGSSLTEEHHVRRVWDLIQKLTDDLLKEA(SEQ ID NO:1)。

the second object of the present invention is to provide a gene encoding the above tryptophan decarboxylase TDC, such as SEQ ID NO: 1.

For example, the gene encoding the polypeptide of SEQ ID NO. 1 (CrTDC) (TDC gene for short) may be the nucleotide sequence shown in SEQ ID NO. 2, or a polynucleotide having 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO. 2.

Wherein, the nucleotide sequence of SEQ ID NO. 2 is:

ATGGGCAGCATTGATTCAACAAATGTAGCCATGTCCAATTCTCCAGTTGGAGAATTTAAGCCACTTGAAGCTGAGGAATTCCGAAAACAAGCCCATCGTATGGTAGATTTCATAGCCGATTATTACAAAAATGTGGAAACATATCCGGTCCTTAGCGAAGTCGAACCTGGATATCTCCGAAAACGTATCCCCGAAACCGCTCCTTACCTCCCCGAATCACTCGACGACATCATGAAAGATATTCAGAAGGATATTATCCCAGGAATGACAAATTGGATGAGCCCTAATTTTTATGCATTTTTTCCTGCCACTGTTAGTTCAGCTGCCTTTTTAGGAGAAATGTTGTCTACTGCCCTAAATTCAGTAGGCTTTACTTGGGTTTCTTCACCAGCCGCCACCGAATTAGAAATGATTGTTATGGATTGGTTGGCTCAGATCCTTAAACTCCCCAAATCTTTCATGTTTTCAGGTACGGGTGGCGGCGTCATCCAAAACACCACTAGTGAGTCCATTCTTTGTACAATCATTGCCGCCCGGGAAAGGGCCCTGGAGAAGCTCGGTCCCGATAGTATTGGAAAACTTGTCTGTTACGGATCAGATCAAACCCATACCATGTTCCCAAAAACTTGCAAATTGGCGGGAATTTTCCCGAATAATATTAGGTTAATACCTACAACCGTCGAAACGGATTTCGGCATCTCACCTCAAGTTCTACGAAAAATGGTCGAGGATGACGTGGCGGCCGGATATGTACCGCTGTTCTTATGCGCTACCCTGGGTACCACCTCGACCACGGCTACCGATCCTGTGGACTCACTTTCTGAAATCGCTAACGAGTTTGGTATTTGGATCCACGTGGATGCGGCTTATGCGGGCAGCGCCTGTATATGTCCCGAGTTCAGACATTACTTGGATGGAATCGAGCGAGTTGACTCACTGAGTCTGAGTCCACACAAATGGCTACTCGCTTACTTAGATTGCACTTGCTTGTGGGTCAAGCAACCACATTTGTTACTAAGGGCACTCACTACGAATCCTGAGTATTTAAAAAATAAACAGAGTGATTTAGACAAAGTTGTGGACTTCAAAAATTGGCAAATCGCAACGGGACGAAAATTTCGGTCGCTTAAACTTTGGCTCATTTTACGTAGCTATGGAGTTGTTAATTTACAGAGTCATATTCGTTCTGACGTCGCAATGGCGAAAATGTTCGAAGAATGGGTTAGATCAGACTCCAGATTCGAAATTGTGGTACCAAGAAACTTTTCTCTTGTTTGTTTTAGATTAAAGCCTGACGTTTCGAGTTTAGATGTAGAAGAAGTGAATAAGAAACTTTTGGATATGCTTAACTCGACGGGACGAGTTTATATGACTCATACTATTGTGGGAGGCATATACATGCTAAGACTGGCTGTTGGCTCATCGCTAACTGAAGAACATCATGTACGCCGTGTTTGGGATTTGATTCAAAAATTAACCGATGATTTGCTCAAAGAAGCTTGA(SEQ ID NO:2)。

in a second aspect of the present invention, there is provided a vector comprising the above gene.

Preferably, the vector further comprises genes encoding secoStrychnos synthsase (SLS), strictosidine Synthsase (STR), strictosidine beta-D type glucosidase (SGD), nitrate transporter NPF2.9, and yohimbine alkaloid synthase HYS, respectively.

The secoStrychnos nux-vomica glycoside synthase (SLS) may be a polypeptide (CrSLS, or SLS 1) having an amino acid sequence of SEQ ID NO. 3, or a polypeptide having 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO. 3.

Wherein, the amino acid sequence of SEQ ID NO. 3 is:

MEMDMDTIRKAIAATIFALVMAWAWRVLDWAWFTPKRIEKRLRQQGFRGNPYRFLVGDVKESGKMHQEALSKPMEFNNDIVPRLMPHINHTINTYGRNSFTWMGRIPRIHVMEPELIKEVLTHSSKYQKNFDVHNPLVKFLLTGVGSFEGAKWSKHRRIISPAFTLEKLKSMLPAFAICYHDMLTKWEKIAEKQGSHEVDIFPTFDVLTSDVISKVAFGSTYEEGGKIFRLLKELMDLTIDCMRDVYIPGWSYLPTKRNKRMKEINKEITDMLRFIINKRMKALKAGEPGEDDLLGVLLESNIQEIQKQGNKKDGGMSINDVIEECKLFYFAGQETTGVLLTWTTILLSKHPEWQERAREEVLQAFGKNKPEFERLNHLKYVSMILYEVLRLYPPVIDLTKIVHEDTKLGPYTIPAGTQVMLPTVMLHREKSIWGEDATEFNPMRFADGVANATKNNVTYLPFSWGPRVCLGQNFALLQAKLGLAMILQRFTFDVAPSYVHAPFTILTVQPQFGSHVIYKKLES(SEQ ID NO:3)。

preferably, the gene (SLS gene or SLS1 gene for short) encoding the above-mentioned polypeptide of SEQ ID NO. 3 (CrSLS or SLS 1) may be the nucleotide sequence shown in SEQ ID NO. 4, or a polynucleotide having homology of 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more with SEQ ID NO. 4.

Wherein, the nucleotide sequence of SEQ ID NO. 4 is:

ATGGAGATGGATATGGATACCATTAGAAAGGCAATTGCTGCCACTATTTTTGCATTGGTAATGGCTTGGGCATGGAGAGTGTTGGATTGGGCATGGTTTACTCCTAAGAGGATCGAGAAACGTCTAAGGCAGCAAGGTTTTAGAGGAAATCCTTATAGATTCTTGGTTGGAGATGTTAAGGAGAGTGGAAAAATGCATCAAGAAGCCTTGTCTAAACCCATGGAGTTCAACAATGATATTGTTCCTCGCCTCATGCCACATATTAACCACACTATCAATACTTACGGTAGGAATTCCTTTACATGGATGGGAAGGATTCCAAGAATTCATGTTATGGAACCTGAACTTATTAAGGAAGTATTGACCCACTCAAGCAAATACCAAAAGAACTTTGATGTTCACAATCCCCTTGTTAAGTTCCTTCTCACCGGAGTTGGAAGCTTTGAGGGTGCAAAATGGTCAAAACACAGAAGAATTATTTCCCCTGCCTTCACTCTTGAGAAACTAAAGTCAATGCTGCCAGCTTTTGCCATATGCTACCATGACATGTTGACCAAATGGGAGAAAATAGCTGAAAAACAAGGATCCCATGAAGTTGATATCTTTCCCACGTTTGATGTTTTAACAAGTGATGTGATTTCAAAGGTTGCATTTGGTAGCACATATGAAGAAGGAGGCAAAATCTTCAGACTATTGAAAGAACTCATGGATCTCACAATTGACTGCATGAGAGATGTCTACATTCCAGGATGGAGCTACTTGCCAACCAAGAGGAACAAGAGGATGAAAGAAATTAACAAAGAGATCACAGATATGCTAAGGTTCATCATCAACAAGAGAATGAAGGCTTTGAAGGCTGGAGAGCCAGGTGAGGATGACTTGCTGGGAGTATTGTTGGAATCAAACATTCAAGAAATTCAAAAGCAAGGAAACAAGAAGGATGGTGGAATGTCAATCAATGATGTAATTGAGGAGTGCAAATTGTTCTACTTTGCTGGTCAAGAAACTACTGGAGTTTTACTGACATGGACCACCATCTTATTGAGCAAGCACCCTGAGTGGCAAGAGCGAGCTAGAGAAGAAGTTCTCCAAGCCTTTGGCAAGAATAAACCTGAATTTGAACGCTTAAATCACCTCAAATATGTGTCTATGATCTTGTACGAGGTTCTAAGGTTGTACCCACCAGTGATTGATCTAACCAAGATTGTCCACGAGGACACAAAGTTAGGTCCGTACACAATTCCTGCAGGAACACAAGTGATGTTGCCAACAGTAATGCTTCACAGAGAGAAGAGCATTTGGGGAGAAGATGCAACAGAATTCAACCCAATGAGATTTGCTGATGGAGTTGCCAATGCAACCAAGAACAATGTCACATATTTGCCATTCAGTTGGGGACCTAGGGTTTGTCTTGGCCAAAACTTTGCACTTCTGCAAGCAAAATTAGGATTGGCAATGATTTTACAACGCTTCACGTTTGATGTTGCTCCATCCTATGTTCATGCTCCTTTTACCATTCTCACAGTTCAACCCCAGTTTGGTTCTCATGTCATCTACAAGAAGCTTGAGAGCTAG(SEQ ID NO:4)。

the strictosidine beta-D type glucosidase (SGD) is a polypeptide having an amino acid sequence of SEQ ID NO. 5 (CrSGD) or a polypeptide having 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO. 5.

Wherein, the amino acid sequence of SEQ ID NO. 5 is:

MGSKDDQSLVVAISPAAEPNGNHSVPIPFAYPSIPIQPRKHNKPIVHRRDFPSDFILGAGGSAYQCEGAYNEGNRGPSIWDTFTNRYPAKIADGSNGNQAINSYNLYKEDIKIMKQTGLESYRFSISWSRVLPGGNLSGGVNKDGVKFYHDFIDELLANGIKPFATLFHWDLPQALEDEYGGFLSDRIVEDFTEYAEFCFWEFGDKVKFWTTFNEPHTYVASGYATGEFAPGRGGADGKGNPGKEPYIATHNLLLSHKAAVEVYRKNFQKCQGGEIGIVLNSMWMEPLNETKEDIDARERGLDFMLGWFIEPLTTGEYPKSMRALVGSRLPEFSTEDSEKLTGCYDFIGMNYYTTTYVSNADKIPDTPGYETDARINKNIFVKKVDGKEVRIGEPCYGGWQHVVPSGLYNLLVYTKEKYHVPVIYVSECGVVEENRTNILLTEGKTNILLTEARHDKLRVDFLQSHLASVRDAIDDGVNVKGFFVWSFFDNFEWNLGYICRYGIIHVDYKTFQRYPKDSAIWYKNFISEGFVTNTAKKRFREEDKLVELVKKQKY(SEQ ID NO:5)。

the gene encoding SEQ ID NO. 5 is a nucleotide sequence shown in SEQ ID NO. 6, or a polynucleotide having 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO. 6.

Wherein, the nucleotide sequence of SEQ ID NO. 6 is:

ATGGGATCTAAAGATGATCAGTCCCTTGTTGTTGCCATTTCTCCAGCTGCTGAACCAAATGGAAATCATTCTGTCCCCATCCCATTCGCCTACCCCAGTATCCCCATTCAACCTAGAAAGCACAACAAGCCCATCGTTCATCGTCGAGATTTCCCCTCAGATTTCATCTTGGGTGCCGGAGGATCTGCTTATCAGTGTGAGGGTGCATATAATGAAGGCAACCGCGGTCCCAGTATATGGGATACTTTCACAAACCGATATCCAGCCAAAATAGCTGATGGATCTAATGGCAATCAAGCCATCAATTCTTACAATTTGTACAAGGAAGATATCAAGATTATGAAGCAAACAGGCTTGGAATCATATAGGTTTTCAATTTCATGGTCAAGAGTATTGCCAGGTGGAAATCTATCCGGTGGAGTGAATAAAGATGGTGTCAAGTTCTATCATGACTTTATAGATGAGCTTCTAGCCAATGGCATCAAACCCTTTGCAACTCTCTTCCACTGGGATCTTCCCCAAGCTCTTGAAGACGAGTATGGAGGCTTCTTGAGTGATCGAATTGTGGAAGATTTTACGGAGTATGCAGAATTTTGCTTTTGGGAATTCGGTGACAAAGTAAAATTTTGGACGACTTTCAATGAACCACATACTTATGTTGCAAGTGGATATGCCACTGGTGAATTTGCACCAGGAAGAGGTGGTGCAGATGGCAAGGGGAACCCTGGCAAAGAACCCTATATAGCGACACATAATTTACTTCtTTCTCACAAAGCTGCTGTGGAAGTATATAGGAAAAATTTTCAGAAATGTCAAGGAGGTGAAATTGGAATTGTACTTAATTCAATGTGGATGGAGCCTCTCAATGAAACCAAAGAaGATATTGATGCTCGGGAAAGGGGTCTTGATTTCATGCTCGGATGGTTCATAGAGCCATTAACAACGGGTGAATACCCAAAATCCATGAGAGCTCTTGTAGGAAGCCGTCTTCCAGAATTTTCAACAGAAGATTCCGAAAAATTAACAGGATGCTATGATTTTATCGGAATGAATTATTATACAACTACTTATGTTTCTAATGCAGACAAAATTCCCGATACTCCGGGTTACGAAACAGATGCTCGAATTAATAAGAATATTTTTGTCAAAAAAGTTGATGGGAAGGAAGTGCGCATTGGTGAACCGTGCTATGGGGGATGGCAGCATGTTGTTCCATCTGGACTCTACAATCTCTTGGTTTACACTAAGGAGAAATACCATGTTCCAGTGATTTATGTCTCAGAATGTGGTGTGGTTGAGGAAAATAGAACCAACATATTACTTACAGAAGGTAAAACCAACATATTACTTACAGAAGCTCGTCACGATAAACTCAGGGTTGATTTTCTACAAAGTCATCTCGCTAGCGTGCGAGATGCTATTGATGATGGTGTGAATGTAAAAGGATTCTTTGTTTGGTCATTCTTCGACAACTTCGAATGGAATTTGGGATATATATGCCGTTATGGAATTATCCATGTTGATTATAAAACTTTTCAAAGATATCCAAAGGATTCTGCCATATGGTACAAGAATTTCATTAGTGAAGGATTTGTTACGAATACAGCTAAAAAGAGATTCCGAGAAGAAGATAAACTAGTTGAGTTAGTCAAGAAGCAAAAATACTAA(SEQ ID NO:6)。

the amino acid sequence of the isocoumarin Synthetase (STR) can be GenBank accession number CAA43936, and the coding gene can be GenBank accession number X61932.

The amino acid sequence of the nitrate transporter NPF2.9 can be GenBank accession number AQM73449, and the coding gene can be GenBank accession number KX372303.

The amino acid sequence of the homoyohimbine alkaloid synthase HYS can be GenBank accession No. ANQ45225, and the coding gene can be GenBank accession No. KU865325.

As a preferred embodiment, in the above vector, TDC, SLS, STR, SGD, NPF2.9 and the genes (or biological elements) encoding HYS are fused via a fusion protein linker (linker), for example, two to two. In this case, these genes linked to each other are referred to as fusion genes.

Preferably, the above-mentioned fusion protein linker (linker) may be a self-cleavable 2A peptide or self-cleaving polypeptide 2A (self-cleaving 2A peptide, 2A), which may be selected from P2A, E2A, T2A, F2A, but is not limited thereto.

In one embodiment, the vector is preferably an Agrobacterium expression vector, such as Agrobacterium binary expression vector pCambia2301.

In a third aspect of the present invention, there is provided an Agrobacterium transformed with the above-mentioned vector.

In a third aspect, the invention provides the use of an agrobacterium as described above for producing ajmaline by infecting a crop suitable for expression of ajmaline with an agrobacterium as described above, and producing ajmaline using the crop as a biosynthetic system.

Preferably, the crop is tobacco.

For example, tobacco can be infested with the Agrobacterium described above, followed by feeding tryptophan and loganin, harvesting the tobacco lamina and extracting the ajmaline.

The invention takes tobacco as a mode chassis system for the first time, takes TDC, SLS, STR, NPF2.9, SGD and HYS as biological elements, constructs different fusion genes, realizes the heterologous biosynthesis of the ajmaline, provides a new synthetic biology approach for the production of the ajmaline, and has development and application potentials.

Drawings

FIG. 1 shows HPLC-MS detection of oxymorphone and precursors from infested tobacco. Wherein tryptamine is tryptamine, secologanin is secoStrychnos nux-vomica glycoside, stricotosine is isocoumarin, cathenamine is a precursor of ajmaline (CAS No.74924-23-5, also a precursor of tetrahydropicatine), and Ajmalicine is ajmaline; standard is total ion flow graph (TIC) of tryptamine, seco-Strychnos secologanin, ajmalicine; the Control was tobacco infected with the blank plasmid pCambia2301 (EV).

FIG. 2 shows the detection of the content of the ajmaline in infected tobacco, the left graph is a TIC graph, and the right graph D is a bar graph. Wherein A shows a TIC chart of a standard product, and ajm is ajmaline; tha is tetrahydropicatine; b shows a TIC plot of the generation of ajmaline in tobacco lamina by the NT01 combination (TDC + SLS + STR + NPF2.9+ SGD + HYS); c shows a TIC plot of the production of ajmaline in an in vitro reaction of combined NT 01; right panel D shows the determination of the amount of ajmaline in tobacco lamina for combination EV and NT 01. NT01 is the combination of TDC, SLS1, STR, NPF2.9, SGD, HYS isolated genes, EV is the infection of blank plasmid pCambia2301.

FIG. 3 shows the detection of the content of oxymorphone in tobacco leaves infected with the isolated and fused genes. The left graph is a TIC graph and the right graph D is a bar graph. Wherein, A shows a TIC chart of a standard product, and ajm is ajmaline; tha is tetrahydropicatine; b shows a TIC graph of the generation of ajmaline in tobacco lamina by NT01 combinations (combinations of TDC, SLS1, STR, NPF2.9, SGD, HYS isolated genes); c shows a TIC graph of the generation of the ajmaline in the tobacco leaves by the NT02 fusion gene combination (the combination of TDC-P2A-SLS1+ STR-T2A-NPF2.9+ SGD-F2A-HYS fusion genes); the right panel D shows the determination of the content of oxymorphone in tobacco leaves for the isolated gene combination NT01 and the fusion gene combination NT 02.

Detailed Description

The invention takes tobacco as a mode chassis system, key genes TDC, SLS, STR, NPF2.9, SGD and HYS obtained by cloning in catharanthus roseus are taken as biological elements to construct an agrobacterium expression vector, and the tobacco transient expression system is used for heterologous expression in the tobacco. Meanwhile, different fusion genes are constructed from the obtained key genes based on a synthetic biology strategy, so that the content of the ajmaline in the tobacco is further improved, and the biosynthesis of the ajmaline in the tobacco is realized for the first time.

Since the newly discovered Tryptophan Decarboxylase (TDC) is derived from Vinca rosea (C)Catharanthus roseus), sometimes referred to herein as CrTDC for SEQ ID No. 1 and its encoding gene, SEQ ID No. 2, is referred to as the TDC gene or CrTDC gene, while the gene fragment in the vector plasmid is referred to as the biological element TDC. Similarly, the newly discovered secologlycoside synthetase SEQ ID NO 3 is sometimes referred to as CrSLS or SLS1 for short, and its encoding gene SEQ ID NO 4 is referred to as SLS1 gene or CrSLS gene, while the gene fragment in the vector plasmid is referred to as the biological element SLS or SLS1. The newly discovered isochronin beta-D type glucosidase SEQ ID NO:5 is sometimes abbreviated as CrSGD, and its encoding gene SEQ ID NO:6 is referred to as SGD gene or Cr SGD gene, while the gene fragment in the vector plasmid is referred to as biological element SGD.

By analogy, the coding gene (GenBank accession number: X61932) of the strictosidine synthase STR (GenBank accession number: CAA 43936) can be called STR gene, and the gene fragment in the vector plasmid can be called biological element STR; the gene encoding the nitrate transporter NPF2.9 (GenBank accession No.: AQM 73449) (GenBank accession No.: KX 372303) can be referred to as NPF2.9 gene, and the gene fragment in the vector plasmid can be referred to as the biological element NPF2.9; the gene encoding the heteroyohimbine alkaloid synthase HYS (GenBank accession No.: ANQ 45225) (GenBank accession No.: KU 865325) may be referred to as the HYS gene, and a fragment of this gene in the vector plasmid may be referred to as the biological element HYS.

In the vector plasmids of the invention, self-cleaving polypeptide 2A is used to ligate biological elements TDC, SLS, STR, NPF2.9, SGD and HYS, achieving the goal of expressing these polycistrons on a single vector. The 2A peptide has a short structure, has good expression balance of upstream and downstream genes, and can realize 'simultaneous transcription and translation'. The more popular self-cleavable linkers are capable of performing a cleavage process by themselves, independent of protease, resulting in cleavage of both domains. These self-cleaving linkers are typically self-cleaving in the sequence NPG ↓ P, usually as 2A short peptides. The 2A peptide was originally found in Foot and Mouth Disease Virus (FMDV), a small "self-cleaving" peptide identified therefrom, having an average length of 18-22 amino acids. 2A short peptides are typically derived from the protein sequence of a virus, for example P2A denotes a peptide derived from porcine teschovirus-1; E2A represents a virus derived from equine rhinitis virus (equine rhinitis A virus); F2A is derived from foot-and-Mouth Disease Virus (foot and foot Disease Virus); T2A is derived from the virus of the poina fusca. Due to different self-cleavage efficiency, 2A short peptides have certain difference.

In this context, sometimes for the sake of descriptive simplicity, the names of proteins such as the CrTDC protein are mixed with the names of the genes (DNA) encoding them, and the person skilled in the art will understand that they represent different substances in different descriptive contexts. For example, for CrTDC (gene), when used to describe tryptophan decarboxylase function or class, refers to a protein; when described as a gene, reference is made to the gene encoding the tryptophan decarboxylase, and so on, as will be readily understood by those skilled in the art.

The invention has clear sequences of tryptophan decarboxylase CrTDC, secoStrychnos nux-vomica glycoside synthetase CrSLS (SLS 1) and isochinacoside beta-D type glucosidase CrSGD which are newly found in catharanthus roseus, so that the encoding genes, an expression cassette and a plasmid containing the genes and a transformant containing the plasmid can be easily obtained by a person skilled in the art. These genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction means well known to those skilled in the art.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

In the examples herein, reference is made to the amounts, concentrations and concentrations of various substances, wherein the percentages refer to mass percentages unless otherwise indicated.

In the examples, if no specific description is made about the operation temperature, the temperature is usually room temperature (15 to 30 ℃).

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing in the examples were performed by Shanghai Sangni Biotech Co., ltd.

The molecular biological experiments in the examples include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to "molecular cloning experimental manual" (third edition), sambrook, d.w. rasel (american), translation of huang peitang et al, scientific press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

The PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.

LB culture medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, pH 7.0.

HPLC-MS detection conditions of the ajmaline and the precursor:

target metabonomics detection was performed using the Agilent 1260Infinity HPLC-MS system. The chromatographic column is an Agilent C18 column (chromatographic column: 3.5um,4.0 multiplied by 100 mm); the mobile phases were 0.1% aqueous formic acid (a) and chromatographically pure acetonitrile (B), separated according to the following gradient: 0-2min,5% by weight B;22min,40% by weight B;25min,60% by weight B;28min,95% by weight B;35min,5% B, flow rate 0.8mL/min, column equilibration 5min. The total analysis time was 40min. The mass spectrum is a single quadrupole mass spectrum and is carried out according to the default parameters of an Agilent manufacturer.

Example 1 extraction and reverse transcription of Total RNA

The vinca leaf is ground into powder by liquid nitrogen, 100mg of the ground powder is taken out of a centrifuge tube with 1.5mL of RNA free, and then RNA extraction is carried out according to the instruction of the RNA extraction kit of the holotype gold. The extracted RNA is directly reverse transcribed to produce cDNA.

Mu.g of RNA is taken and reverse transcription is carried out by utilizing a full-type gold reverse transcription kit to produce cDNA.

Example 2 cloning of genes

2.1 cloning of the target Gene

Using Catharanthus roseus cDNA obtained by reverse transcription as a template, amplification was carried out using the primers shown in Table 1 as follows

Fastpfu Flyb. Mu.l, dNTP (2.5 mM) 4. Mu.L, each 2. Mu.L of primers (10. Mu.M), cDNA 1. Mu.L,

fastpfu Fly DNA polymerase 1. Mu.L, supplemented with ddH ₂ O to a final volume of 50. Mu.L. PCR reaction procedure: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min30s,35 cycles, final extension at 72 ℃ for 5min, and storage at 16 ℃. The PCR product was purified using the Agarose Gel Fragment Recovery Kit Ver.2.0 from Axygen. TDC, SLS, STR, NPF2.9, SGD and HYS gene fragments are respectively obtained.

TABLE 1 primers for Gene amplification

Wherein, F is a forward primer; r is a reverse primer.

2.2 cloning of fusion genes

Using the plasmid containing the target gene obtained in step 2.1 as a template, the amplification of the fusion gene was carried out using the primers shown in Table 2 in the following system

Fastpfu Flyb. Mu.l, dNTP (2.5 mM) 4. Mu.L, each 2. Mu.L of primers (10. Mu.M), cDNA 1. Mu.L,

fastpfu Fly DNA polymerase 1. Mu.L,supplemented ddH ₂ O to a final volume of 50. Mu.L. PCR reaction procedure: pre-denaturation at 98 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min for 30s,35 cycles, final extension at 72 ℃ for 5min, and storage at 16 ℃. The PCR product was purified using the Agarose Gel Fragment Recovery Kit Ver.2.0 from Axygen. TDC, SLS1, STR, NPF2.9, SGD and HYS gene fragments with fusion protein joint 2A peptide genes are respectively obtained.

TABLE 2 primers for amplification of fusion genes

Wherein, F is a forward primer; r is a reverse primer.

2.3 construction of Agrobacterium expression vectors

The agrobacterium binary expression vector pCambia2301 (Invitrogen company) is subjected to enzyme digestion for 12h at 37 ℃ by using appropriate restriction enzymes BamHI and SalI, an enzyme digestion product is purified by using a gel recovery kit (Axygen company), and the purified fragment in the step 2.2 and the enzyme digestion vector are subjected to homologous recombination by using a homologous recombinase according to the operation of a specification to obtain an expression vector.

Example 3 Agrobacterium competent transformation

1 mu g of expression vector with correct sequencing and GV3101 competent cells are taken to be incubated on ice for 30 minutes, quickly frozen by liquid nitrogen for 5min, thermally shocked at 37 ℃ for 5min, placed on ice for 5min, added with 1mL of LB culture medium and placed on a shaking table at 28 ℃ for resuscitation for 4 hours. The whole cells were plated on kanamycin-resistant and rifamycin-resistant LB plates and cultured in 28 ℃ incubator for 2-4 days.

Example 4 Agrobacterium infection

Single colonies were picked from kanamycin and rifamycin resistant medium plates and cultured in LB (Kan + Rif) tubes for 48h to OD ₆₀₀ Is more than or equal to 2.0. Incubate overnight (12 h) at 28 ℃. After the cells were collected, MMA buffer (10 mM MES, 10mM MgC) was usedl ₂ And 100 μ M acetosyringone) for 3h, and then injecting tobacco with a needle-less syringe. Feeding substrates (100 mg/mL tryptophan and 100mg/mL Loganin) 4 days after infecting tobacco, and collecting tobacco leaves 1 day later for target metabonomics analysis.

Example 5 Metabonomics analysis

5.1 newly discovered enzymes and genes of Catharanthus roseus origin related to the synthesis of monoterpene indole alkaloids

Through gene sequencing, three new genes are discovered, namely a tryptophan decarboxylase gene, wherein the nucleotide sequence of the tryptophan decarboxylase gene is SEQ ID NO. 2, and the amino acid sequence of the coded tryptophan decarboxylase CrTDC is SEQ ID NO. 1; the nucleotide sequence of the seco-strychnos nux-vomica glycoside synthetase gene is SEQ ID NO. 4, and the amino acid sequence of the encoded seco-strychnos glycoside synthetase CrSLS (or SLS 1) is SEQ ID NO. 3; the nucleotide sequence of the isocorynin beta-D type glucosidase gene is SEQ ID NO. 6, and the amino acid sequence of the coded isocorynin beta-D type glucosidase CrSGD is SEQ ID NO. 5.

5.2 synthetic biology System for Ammonidine in tobacco

FIG. 1 shows a graph of the detection of timoloid and precursors in infested tobacco, reflecting the function of different enzymes in the biosynthesis of timoloid. Wherein tryptamine is tryptamine, secologanin is secoStrychnos nux-vomitoxin, stricotisidine is isocoumarin, cathenamine is a precursor of ajmaline (CAS No.74924-23-5, also a precursor of tetrahydropicatine), and Ajmalicine is ajmaline. Standard is the HPLC retention time of tryptamine, secologanin, ajmalicine. Control was tobacco infected with the empty vector pCambia2301 (EV).

As can be seen from FIG. 1, only tryptamine was expressed when only tryptophan decarboxylase TDC was cloned in tobacco; when only the seconux vomica glycoside synthetase SLS1 is cloned, only the seconux vomica glycoside is expressed; when TDC + SLS1+ STR is cloned, tryptamine, seconux vomica glycoside and strictosidine can be expressed, but cathenamine and ajmalicine are not expressed; when TDC + SLS1+ STR + SGD is cloned, tryptamine, strictosidine and cathenamine can be expressed, but no ajmaline is expressed; after cloning TDC + SLS1+ STR + SGD + HYS, the ajmaline and its precursor compound can be expressed, and a complete biosynthesis system is formed.

5.3 content detection of Amazone in infected tobacco

FIG. 2 shows the detection of the content of the ajmaline in infected tobacco, the left graph is a TIC graph, and the right graph D is a bar graph. Wherein, A shows a TIC chart of a standard product, and ajm is ajmaline; tha is tetrahydropicatine; b shows a TIC plot of the generation of ajmaline in tobacco lamina by the NT01 combination (TDC + SLS1+ STR + NPF2.9+ SGD + HYS); c shows a TIC graph of the in vitro biochemical reaction of NT01 to form the ajmaline; d shows the content determination of control and NT01 in tobacco lamina. The combination of NT01 produced ajmalicine, but infection of tobacco with only the empty plasmid pCambia2301 (EV) did not.

5.4 detection of content of ajmaline in tobacco leaf infected by fusion gene

FIG. 3 shows the detection of the content of the oxymorphone in tobacco leaves infected with the fusion gene. The left graph is a TIC graph and the right graph D is a bar graph. Wherein A shows a TIC chart of a standard product, and ajm is ajmaline; tha is tetrahydropicatine; b shows a TIC graph of the generation of ajmaline in tobacco lamina by NT01 combinations (combinations of TDC, SLS1, STR, NPF2.9, SGD, HYS isolated genes); c shows a TIC graph of the generation of the ajmaline in the tobacco leaves by the NT02 fusion gene combination (the combination of TDC-P2A-SLS1+ STR-T2A-NPF2.9+ SGD-F2A-HYS fusion genes); the right panel D shows the determination of the amount of ajmaline in tobacco lamina for combination NT01 and NT 02. The content of the oxymorphone generated in tobacco infected by the fusion gene combination NT02 is higher than that generated by the separation gene combination NT 01.

The experimental results show that TDC, SLS, STR, NPF2.9, SGD and HYS are used as biological elements, 2A peptide is used as a fusion protein joint linker to construct a fusion gene, and a tobacco system is used as a biosynthesis system, so that high-content oxymorphone can be generated.

It should also be noted that the listing or discussion of a prior-published document in this specification should not be taken as an admission that the document is prior art or common general knowledge.

Reference to the literature

1.Farhi,M.,Marhevka,E.,Ben-Ari,J.,Algamas-Dimantov,A.,Liang,Z.,Zeevi,V.,Edelbaum,O.,Spitzer-Rimon,B.,Abeliovich,H.,and Schwartz,B.(2011).Generation of the potent anti-malarial drug artemisinin in tobacco.Nat Biotechnol 29,1072.

2.Fuentes,P.,Zhou,F.,Erban,A.,Karcher,D.,Kopka,J.,and Bock,R.(2016).A new synthetic biology approach allows transfer of an entire metabolic pathway from a medicinal plant to a biomass crop.eLife 5,e13664.

3.Li,J.,Mutanda,I.,Wang,K.,Yang,L.,Wang,J.,and Wang,Y.(2019).Chloroplastic metabolic engineering coupled with isoprenoid pool enhancement for committed taxanes biosynthesis in nicotiana benthamiana.Nat Commun 10,4850.

4.Malhotra,K.,Subramaniyan,M.,Rawat,K.,Kalamuddin,M.,Qureshi,M.I.,Malhotra,P.,Mohmmed,A.,Cornish,K.,Daniell,H.,and Kumar,S.(2016).Compartmentalized metabolic engineering for artemisinin biosynthesis and effective malaria treatment by oral delivery of plant cells.Mol Plant 9,1464-1477.

5.Miettinen,K.,Dong,L.,Navrot,N.,Schneider,T.,Burlat,V.,Pollier,J.,Woittiez,L.,Der Krol,S.V.,Lugan,R.,and Ilc,T.(2014).The seco-iridoid pathway from catharanthus roseus.Nat Commun 5,3606-3606.

6.Paddon,C.J.,Westfall,P.J.,Pitera,D.J.,Benjamin,K.,Fisher,K.,McPhee,D.,Leavell,M.,Tai,A.,Main,A.,and Eng,D.(2013).High-level semi-synthetic production of the potent antimalarial artemisinin.Nature 496,528.

7.Reed,J.,Stephenson,M.J.,Miettinen,K.,Brouwer,B.,Leveau,A.,Brett,P.,Goss,R.J.,Goossens,A.,O’Connell,M.A.,and Osbourn,A.(2017).A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules.Metab Eng 42,185-193.

8.Stavrinides,A.,Tatsis,E.C.,Caputi,L.,Foureau,E.,Stevenson,C.E.M.,Lawson,D.M.,Courdavault,V.,and O'Connor,S.E.(2016).Structural investigation of heteroyohimbine alkaloid synthesis reveals active site elements that control stereoselectivity.Nat Commun 7.

9.Stavrinides,A.,Tatsis,E.C.,Foureau,E.,Caputi,L.,Kellner,F.,Courdavault,V.,and O'Connor,S.E.(2015).Unlocking the diversity of alkaloids in catharanthus roseus:Nuclear localization suggests metabolic channeling in secondary metabolism.Chem Biol 22,336-341.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> tobacco system for producing ajmaline

<130> SHPI2010065

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 500

<212> PRT

<213> Catharanthus roseus

<400> 1

Met Gly Ser Ile Asp Ser Thr Asn Val Ala Met Ser Asn Ser Pro Val

1 5 10 15

Gly Glu Phe Lys Pro Leu Glu Ala Glu Glu Phe Arg Lys Gln Ala His

20 25 30

Arg Met Val Asp Phe Ile Ala Asp Tyr Tyr Lys Asn Val Glu Thr Tyr

35 40 45

Pro Val Leu Ser Glu Val Glu Pro Gly Tyr Leu Arg Lys Arg Ile Pro

50 55 60

Glu Thr Ala Pro Tyr Leu Pro Glu Ser Leu Asp Asp Ile Met Lys Asp

65 70 75 80

Ile Gln Lys Asp Ile Ile Pro Gly Met Thr Asn Trp Met Ser Pro Asn

85 90 95

Phe Tyr Ala Phe Phe Pro Ala Thr Val Ser Ser Ala Ala Phe Leu Gly

100 105 110

Glu Met Leu Ser Thr Ala Leu Asn Ser Val Gly Phe Thr Trp Val Ser

115 120 125

Ser Pro Ala Ala Thr Glu Leu Glu Met Ile Val Met Asp Trp Leu Ala

130 135 140

Gln Ile Leu Lys Leu Pro Lys Ser Phe Met Phe Ser Gly Thr Gly Gly

145 150 155 160

Gly Val Ile Gln Asn Thr Thr Ser Glu Ser Ile Leu Cys Thr Ile Ile

165 170 175

Ala Ala Arg Glu Arg Ala Leu Glu Lys Leu Gly Pro Asp Ser Ile Gly

180 185 190

Lys Leu Val Cys Tyr Gly Ser Asp Gln Thr His Thr Met Phe Pro Lys

195 200 205

Thr Cys Lys Leu Ala Gly Ile Phe Pro Asn Asn Ile Arg Leu Ile Pro

210 215 220

Thr Thr Val Glu Thr Asp Phe Gly Ile Ser Pro Gln Val Leu Arg Lys

225 230 235 240

Met Val Glu Asp Asp Val Ala Ala Gly Tyr Val Pro Leu Phe Leu Cys

245 250 255

Ala Thr Leu Gly Thr Thr Ser Thr Thr Ala Thr Asp Pro Val Asp Ser

260 265 270

Leu Ser Glu Ile Ala Asn Glu Phe Gly Ile Trp Ile His Val Asp Ala

275 280 285

Ala Tyr Ala Gly Ser Ala Cys Ile Cys Pro Glu Phe Arg His Tyr Leu

290 295 300

Asp Gly Ile Glu Arg Val Asp Ser Leu Ser Leu Ser Pro His Lys Trp

305 310 315 320

Leu Leu Ala Tyr Leu Asp Cys Thr Cys Leu Trp Val Lys Gln Pro His

325 330 335

Leu Leu Leu Arg Ala Leu Thr Thr Asn Pro Glu Tyr Leu Lys Asn Lys

340 345 350

Gln Ser Asp Leu Asp Lys Val Val Asp Phe Lys Asn Trp Gln Ile Ala

355 360 365

Thr Gly Arg Lys Phe Arg Ser Leu Lys Leu Trp Leu Ile Leu Arg Ser

370 375 380

Tyr Gly Val Val Asn Leu Gln Ser His Ile Arg Ser Asp Val Ala Met

385 390 395 400

Ala Lys Met Phe Glu Glu Trp Val Arg Ser Asp Ser Arg Phe Glu Ile

405 410 415

Val Val Pro Arg Asn Phe Ser Leu Val Cys Phe Arg Leu Lys Pro Asp

420 425 430

Val Ser Ser Leu Asp Val Glu Glu Val Asn Lys Lys Leu Leu Asp Met

435 440 445

Leu Asn Ser Thr Gly Arg Val Tyr Met Thr His Thr Ile Val Gly Gly

450 455 460

Ile Tyr Met Leu Arg Leu Ala Val Gly Ser Ser Leu Thr Glu Glu His

465 470 475 480

His Val Arg Arg Val Trp Asp Leu Ile Gln Lys Leu Thr Asp Asp Leu

485 490 495

Leu Lys Glu Ala

500

<210> 2

<211> 1503

<212> DNA

<213> Catharanthus roseus

<400> 2

atgggcagca ttgattcaac aaatgtagcc atgtccaatt ctccagttgg agaatttaag 60

ccacttgaag ctgaggaatt ccgaaaacaa gcccatcgta tggtagattt catagccgat 120

tattacaaaa atgtggaaac atatccggtc cttagcgaag tcgaacctgg atatctccga 180

aaacgtatcc ccgaaaccgc tccttacctc cccgaatcac tcgacgacat catgaaagat 240

attcagaagg atattatccc aggaatgaca aattggatga gccctaattt ttatgcattt 300

tttcctgcca ctgttagttc agctgccttt ttaggagaaa tgttgtctac tgccctaaat 360

tcagtaggct ttacttgggt ttcttcacca gccgccaccg aattagaaat gattgttatg 420

gattggttgg ctcagatcct taaactcccc aaatctttca tgttttcagg tacgggtggc 480

ggcgtcatcc aaaacaccac tagtgagtcc attctttgta caatcattgc cgcccgggaa 540

agggccctgg agaagctcgg tcccgatagt attggaaaac ttgtctgtta cggatcagat 600

caaacccata ccatgttccc aaaaacttgc aaattggcgg gaattttccc gaataatatt 660

aggttaatac ctacaaccgt cgaaacggat ttcggcatct cacctcaagt tctacgaaaa 720

atggtcgagg atgacgtggc ggccggatat gtaccgctgt tcttatgcgc taccctgggt 780

accacctcga ccacggctac cgatcctgtg gactcacttt ctgaaatcgc taacgagttt 840

ggtatttgga tccacgtgga tgcggcttat gcgggcagcg cctgtatatg tcccgagttc 900

agacattact tggatggaat cgagcgagtt gactcactga gtctgagtcc acacaaatgg 960

ctactcgctt acttagattg cacttgcttg tgggtcaagc aaccacattt gttactaagg 1020

gcactcacta cgaatcctga gtatttaaaa aataaacaga gtgatttaga caaagttgtg 1080

gacttcaaaa attggcaaat cgcaacggga cgaaaatttc ggtcgcttaa actttggctc 1140

attttacgta gctatggagt tgttaattta cagagtcata ttcgttctga cgtcgcaatg 1200

gcgaaaatgt tcgaagaatg ggttagatca gactccagat tcgaaattgt ggtaccaaga 1260

aacttttctc ttgtttgttt tagattaaag cctgacgttt cgagtttaga tgtagaagaa 1320

gtgaataaga aacttttgga tatgcttaac tcgacgggac gagtttatat gactcatact 1380

attgtgggag gcatatacat gctaagactg gctgttggct catcgctaac tgaagaacat 1440

catgtacgcc gtgtttggga tttgattcaa aaattaaccg atgatttgct caaagaagct 1500

tga 1503

<210> 3

<211> 524

<212> PRT

<213> Catharanthus roseus

<400> 3

Met Glu Met Asp Met Asp Thr Ile Arg Lys Ala Ile Ala Ala Thr Ile

1 5 10 15

Phe Ala Leu Val Met Ala Trp Ala Trp Arg Val Leu Asp Trp Ala Trp

20 25 30

Phe Thr Pro Lys Arg Ile Glu Lys Arg Leu Arg Gln Gln Gly Phe Arg

35 40 45

Gly Asn Pro Tyr Arg Phe Leu Val Gly Asp Val Lys Glu Ser Gly Lys

50 55 60

Met His Gln Glu Ala Leu Ser Lys Pro Met Glu Phe Asn Asn Asp Ile

65 70 75 80

Val Pro Arg Leu Met Pro His Ile Asn His Thr Ile Asn Thr Tyr Gly

85 90 95

Arg Asn Ser Phe Thr Trp Met Gly Arg Ile Pro Arg Ile His Val Met

100 105 110

Glu Pro Glu Leu Ile Lys Glu Val Leu Thr His Ser Ser Lys Tyr Gln

115 120 125

Lys Asn Phe Asp Val His Asn Pro Leu Val Lys Phe Leu Leu Thr Gly

130 135 140

Val Gly Ser Phe Glu Gly Ala Lys Trp Ser Lys His Arg Arg Ile Ile

145 150 155 160

Ser Pro Ala Phe Thr Leu Glu Lys Leu Lys Ser Met Leu Pro Ala Phe

165 170 175

Ala Ile Cys Tyr His Asp Met Leu Thr Lys Trp Glu Lys Ile Ala Glu

180 185 190

Lys Gln Gly Ser His Glu Val Asp Ile Phe Pro Thr Phe Asp Val Leu

195 200 205

Thr Ser Asp Val Ile Ser Lys Val Ala Phe Gly Ser Thr Tyr Glu Glu

210 215 220

Gly Gly Lys Ile Phe Arg Leu Leu Lys Glu Leu Met Asp Leu Thr Ile

225 230 235 240

Asp Cys Met Arg Asp Val Tyr Ile Pro Gly Trp Ser Tyr Leu Pro Thr

245 250 255

Lys Arg Asn Lys Arg Met Lys Glu Ile Asn Lys Glu Ile Thr Asp Met

260 265 270

Leu Arg Phe Ile Ile Asn Lys Arg Met Lys Ala Leu Lys Ala Gly Glu

275 280 285

Pro Gly Glu Asp Asp Leu Leu Gly Val Leu Leu Glu Ser Asn Ile Gln

290 295 300

Glu Ile Gln Lys Gln Gly Asn Lys Lys Asp Gly Gly Met Ser Ile Asn

305 310 315 320

Asp Val Ile Glu Glu Cys Lys Leu Phe Tyr Phe Ala Gly Gln Glu Thr

325 330 335

Thr Gly Val Leu Leu Thr Trp Thr Thr Ile Leu Leu Ser Lys His Pro

340 345 350

Glu Trp Gln Glu Arg Ala Arg Glu Glu Val Leu Gln Ala Phe Gly Lys

355 360 365

Asn Lys Pro Glu Phe Glu Arg Leu Asn His Leu Lys Tyr Val Ser Met

370 375 380

Ile Leu Tyr Glu Val Leu Arg Leu Tyr Pro Pro Val Ile Asp Leu Thr

385 390 395 400

Lys Ile Val His Glu Asp Thr Lys Leu Gly Pro Tyr Thr Ile Pro Ala

405 410 415

Gly Thr Gln Val Met Leu Pro Thr Val Met Leu His Arg Glu Lys Ser

420 425 430

Ile Trp Gly Glu Asp Ala Thr Glu Phe Asn Pro Met Arg Phe Ala Asp

435 440 445

Gly Val Ala Asn Ala Thr Lys Asn Asn Val Thr Tyr Leu Pro Phe Ser

450 455 460

Trp Gly Pro Arg Val Cys Leu Gly Gln Asn Phe Ala Leu Leu Gln Ala

465 470 475 480

Lys Leu Gly Leu Ala Met Ile Leu Gln Arg Phe Thr Phe Asp Val Ala

485 490 495

Pro Ser Tyr Val His Ala Pro Phe Thr Ile Leu Thr Val Gln Pro Gln

500 505 510

Phe Gly Ser His Val Ile Tyr Lys Lys Leu Glu Ser

515 520

<210> 4

<211> 1575

<212> DNA

<213> Catharanthus roseus

<400> 4

atggagatgg atatggatac cattagaaag gcaattgctg ccactatttt tgcattggta 60

atggcttggg catggagagt gttggattgg gcatggttta ctcctaagag gatcgagaaa 120

cgtctaaggc agcaaggttt tagaggaaat ccttatagat tcttggttgg agatgttaag 180

gagagtggaa aaatgcatca agaagccttg tctaaaccca tggagttcaa caatgatatt 240

gttcctcgcc tcatgccaca tattaaccac actatcaata cttacggtag gaattccttt 300

acatggatgg gaaggattcc aagaattcat gttatggaac ctgaacttat taaggaagta 360

ttgacccact caagcaaata ccaaaagaac tttgatgttc acaatcccct tgttaagttc 420

cttctcaccg gagttggaag ctttgagggt gcaaaatggt caaaacacag aagaattatt 480

tcccctgcct tcactcttga gaaactaaag tcaatgctgc cagcttttgc catatgctac 540

catgacatgt tgaccaaatg ggagaaaata gctgaaaaac aaggatccca tgaagttgat 600

atctttccca cgtttgatgt tttaacaagt gatgtgattt caaaggttgc atttggtagc 660

acatatgaag aaggaggcaa aatcttcaga ctattgaaag aactcatgga tctcacaatt 720

gactgcatga gagatgtcta cattccagga tggagctact tgccaaccaa gaggaacaag 780

aggatgaaag aaattaacaa agagatcaca gatatgctaa ggttcatcat caacaagaga 840

atgaaggctt tgaaggctgg agagccaggt gaggatgact tgctgggagt attgttggaa 900

tcaaacattc aagaaattca aaagcaagga aacaagaagg atggtggaat gtcaatcaat 960

gatgtaattg aggagtgcaa attgttctac tttgctggtc aagaaactac tggagtttta 1020

ctgacatgga ccaccatctt attgagcaag caccctgagt ggcaagagcg agctagagaa 1080

gaagttctcc aagcctttgg caagaataaa cctgaatttg aacgcttaaa tcacctcaaa 1140

tatgtgtcta tgatcttgta cgaggttcta aggttgtacc caccagtgat tgatctaacc 1200

aagattgtcc acgaggacac aaagttaggt ccgtacacaa ttcctgcagg aacacaagtg 1260

atgttgccaa cagtaatgct tcacagagag aagagcattt ggggagaaga tgcaacagaa 1320

ttcaacccaa tgagatttgc tgatggagtt gccaatgcaa ccaagaacaa tgtcacatat 1380

ttgccattca gttggggacc tagggtttgt cttggccaaa actttgcact tctgcaagca 1440

aaattaggat tggcaatgat tttacaacgc ttcacgtttg atgttgctcc atcctatgtt 1500

catgctcctt ttaccattct cacagttcaa ccccagtttg gttctcatgt catctacaag 1560

aagcttgaga gctag 1575

<210> 5

<211> 555

<212> PRT

<213> Catharanthus roseus

<400> 5

Met Gly Ser Lys Asp Asp Gln Ser Leu Val Val Ala Ile Ser Pro Ala

1 5 10 15

Ala Glu Pro Asn Gly Asn His Ser Val Pro Ile Pro Phe Ala Tyr Pro

20 25 30

Ser Ile Pro Ile Gln Pro Arg Lys His Asn Lys Pro Ile Val His Arg

35 40 45

Arg Asp Phe Pro Ser Asp Phe Ile Leu Gly Ala Gly Gly Ser Ala Tyr

50 55 60

Gln Cys Glu Gly Ala Tyr Asn Glu Gly Asn Arg Gly Pro Ser Ile Trp

65 70 75 80

Asp Thr Phe Thr Asn Arg Tyr Pro Ala Lys Ile Ala Asp Gly Ser Asn

85 90 95

Gly Asn Gln Ala Ile Asn Ser Tyr Asn Leu Tyr Lys Glu Asp Ile Lys

100 105 110

Ile Met Lys Gln Thr Gly Leu Glu Ser Tyr Arg Phe Ser Ile Ser Trp

115 120 125

Ser Arg Val Leu Pro Gly Gly Asn Leu Ser Gly Gly Val Asn Lys Asp

130 135 140

Gly Val Lys Phe Tyr His Asp Phe Ile Asp Glu Leu Leu Ala Asn Gly

145 150 155 160

Ile Lys Pro Phe Ala Thr Leu Phe His Trp Asp Leu Pro Gln Ala Leu

165 170 175

Glu Asp Glu Tyr Gly Gly Phe Leu Ser Asp Arg Ile Val Glu Asp Phe

180 185 190

Thr Glu Tyr Ala Glu Phe Cys Phe Trp Glu Phe Gly Asp Lys Val Lys

195 200 205

Phe Trp Thr Thr Phe Asn Glu Pro His Thr Tyr Val Ala Ser Gly Tyr

210 215 220

Ala Thr Gly Glu Phe Ala Pro Gly Arg Gly Gly Ala Asp Gly Lys Gly

225 230 235 240

Asn Pro Gly Lys Glu Pro Tyr Ile Ala Thr His Asn Leu Leu Leu Ser

245 250 255

His Lys Ala Ala Val Glu Val Tyr Arg Lys Asn Phe Gln Lys Cys Gln

260 265 270

Gly Gly Glu Ile Gly Ile Val Leu Asn Ser Met Trp Met Glu Pro Leu

275 280 285

Asn Glu Thr Lys Glu Asp Ile Asp Ala Arg Glu Arg Gly Leu Asp Phe

290 295 300

Met Leu Gly Trp Phe Ile Glu Pro Leu Thr Thr Gly Glu Tyr Pro Lys

305 310 315 320

Ser Met Arg Ala Leu Val Gly Ser Arg Leu Pro Glu Phe Ser Thr Glu

325 330 335

Asp Ser Glu Lys Leu Thr Gly Cys Tyr Asp Phe Ile Gly Met Asn Tyr

340 345 350

Tyr Thr Thr Thr Tyr Val Ser Asn Ala Asp Lys Ile Pro Asp Thr Pro

355 360 365

Gly Tyr Glu Thr Asp Ala Arg Ile Asn Lys Asn Ile Phe Val Lys Lys

370 375 380

Val Asp Gly Lys Glu Val Arg Ile Gly Glu Pro Cys Tyr Gly Gly Trp

385 390 395 400

Gln His Val Val Pro Ser Gly Leu Tyr Asn Leu Leu Val Tyr Thr Lys

405 410 415

Glu Lys Tyr His Val Pro Val Ile Tyr Val Ser Glu Cys Gly Val Val

420 425 430

Glu Glu Asn Arg Thr Asn Ile Leu Leu Thr Glu Gly Lys Thr Asn Ile

435 440 445

Leu Leu Thr Glu Ala Arg His Asp Lys Leu Arg Val Asp Phe Leu Gln

450 455 460

Ser His Leu Ala Ser Val Arg Asp Ala Ile Asp Asp Gly Val Asn Val

465 470 475 480

Lys Gly Phe Phe Val Trp Ser Phe Phe Asp Asn Phe Glu Trp Asn Leu

485 490 495

Gly Tyr Ile Cys Arg Tyr Gly Ile Ile His Val Asp Tyr Lys Thr Phe

500 505 510

Gln Arg Tyr Pro Lys Asp Ser Ala Ile Trp Tyr Lys Asn Phe Ile Ser

515 520 525

Glu Gly Phe Val Thr Asn Thr Ala Lys Lys Arg Phe Arg Glu Glu Asp

530 535 540

Lys Leu Val Glu Leu Val Lys Lys Gln Lys Tyr

545 550 555

<210> 6

<211> 1668

<212> DNA

<213> Catharanthus roseus

<400> 6

atgggatcta aagatgatca gtcccttgtt gttgccattt ctccagctgc tgaaccaaat 60

ggaaatcatt ctgtccccat cccattcgcc taccccagta tccccattca acctagaaag 120

cacaacaagc ccatcgttca tcgtcgagat ttcccctcag atttcatctt gggtgccgga 180

ggatctgctt atcagtgtga gggtgcatat aatgaaggca accgcggtcc cagtatatgg 240

gatactttca caaaccgata tccagccaaa atagctgatg gatctaatgg caatcaagcc 300

atcaattctt acaatttgta caaggaagat atcaagatta tgaagcaaac aggcttggaa 360

tcatataggt tttcaatttc atggtcaaga gtattgccag gtggaaatct atccggtgga 420

gtgaataaag atggtgtcaa gttctatcat gactttatag atgagcttct agccaatggc 480

atcaaaccct ttgcaactct cttccactgg gatcttcccc aagctcttga agacgagtat 540

ggaggcttct tgagtgatcg aattgtggaa gattttacgg agtatgcaga attttgcttt 600

tgggaattcg gtgacaaagt aaaattttgg acgactttca atgaaccaca tacttatgtt 660

gcaagtggat atgccactgg tgaatttgca ccaggaagag gtggtgcaga tggcaagggg 720

aaccctggca aagaacccta tatagcgaca cataatttac ttctttctca caaagctgct 780

gtggaagtat ataggaaaaa ttttcagaaa tgtcaaggag gtgaaattgg aattgtactt 840

aattcaatgt ggatggagcc tctcaatgaa accaaagaag atattgatgc tcgggaaagg 900

ggtcttgatt tcatgctcgg atggttcata gagccattaa caacgggtga atacccaaaa 960

tccatgagag ctcttgtagg aagccgtctt ccagaatttt caacagaaga ttccgaaaaa 1020

ttaacaggat gctatgattt tatcggaatg aattattata caactactta tgtttctaat 1080

gcagacaaaa ttcccgatac tccgggttac gaaacagatg ctcgaattaa taagaatatt 1140

tttgtcaaaa aagttgatgg gaaggaagtg cgcattggtg aaccgtgcta tgggggatgg 1200

cagcatgttg ttccatctgg actctacaat ctcttggttt acactaagga gaaataccat 1260

gttccagtga tttatgtctc agaatgtggt gtggttgagg aaaatagaac caacatatta 1320

cttacagaag gtaaaaccaa catattactt acagaagctc gtcacgataa actcagggtt 1380

gattttctac aaagtcatct cgctagcgtg cgagatgcta ttgatgatgg tgtgaatgta 1440

aaaggattct ttgtttggtc attcttcgac aacttcgaat ggaatttggg atatatatgc 1500

cgttatggaa ttatccatgt tgattataaa acttttcaaa gatatccaaa ggattctgcc 1560

atatggtaca agaatttcat tagtgaagga tttgttacga atacagctaa aaagagattc 1620

cgagaagaag ataaactagt tgagttagtc aagaagcaaa aatactaa 1668

Claims (5)

1. A vector, which is characterized by comprising a gene SEQ ID NO. 2 encoding tryptophan decarboxylase TDC, a gene SEQ ID NO. 4 encoding seco-strychnine synthase SLS, a gene GenBank accession number X61932 encoding isochrub-glycoside synthase STR, a gene SEQ ID NO. 5 encoding isochrub-glycoside beta-D type glucosidase SGD, a gene GenBank accession number KX372303 encoding nitrate transporter NPF2.9, and a gene GenBank accession number KU865325 encoding isochrub alkaloid synthase HYS.

2. The vector of claim 1, wherein the genes encoding TDC, SLS, STR, SGD, NPF2.9 and HYS are fused via self-cleaving polypeptide 2A.

3. The vector of claim 1, which is an agrobacterium expression vector.

4. An Agrobacterium transformed with the vector of any one of claims 1-3.

5. Use of an Agrobacterium according to claim 4 for the production of ajmaline, wherein the Agrobacterium is used to infect tobacco, as defined in claim 4, and the tobacco is used as a biosynthetic system for the production of ajmaline.

Images