CN112877315A - Szechwan chinaberry squalene oxide cyclase MtOSC1 and coding gene and application thereof - Google Patents

Abstract

The invention relates to a biosynthetic pathway of triterpenoids, in particular to toosendan oxidation squalene cyclase MtOSC1 and a coding gene and application thereof. The toosendan oxidation squalene cyclase MtOSC1 provided by the invention is a protein of a1 or a2 as follows: a1. a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table; a2. the protein related to the biosynthesis of toosendanin is formed by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table. The invention clones the cyclase in the toosendanin biosynthesis pathway for the first time, identifies the product of the cyclase through tobacco in vitro transient expression, GC-MS and nuclear magnetic resonance, and lays a foundation for deeply analyzing the toosendanin biosynthesis pathway.

Description

Szechwan chinaberry squalene oxide cyclase MtOSC1 and coding gene and application thereof

Technical Field

The invention relates to a biosynthetic pathway of triterpenoids, in particular to toosendan oxidation squalene cyclase MtOSC1 and a coding gene and application thereof.

Background

Toosendanin is present in Melia azedarachA characteristic compound of plants of the family Melia, meliane-type triterpene compound having furan ring, is also called tetranortriterpenoid (Tan and Luo, 2011; Shi et al, 2007). The CAS number is 58812-37-6, and the molecular formula is C₃₀H₃₈O₁₁The relative molecular mass was 537.4. Toosendanin is white solid powder, melting point 245 ℃, optical rotation of-13.3 ° (c is 1.75, acetone). It is easily soluble in acetone, methanol and pyridine, and slightly soluble in chloroform and benzene.

Experiments in modern medicine prove that toosendanin has the effects of sterilization, insect resistance, inflammation diminishing, cancer inhibition, tumor resistance, central nerve cell influence, respiratory central nervous system inhibition and the like (Zhang et al, 2019). In addition, azadirachtin has also been developed as a safe and friendly green pesticide of plant origin (Isman, 2006).

Toosendanin belongs to triterpenoids, so according to the synthesis route of triterpenoids, the biosynthesis route of toosendanin can be presumed to be mainly divided into three major parts: backbone formation, side chain cyclization, oxidative rearrangement (Tan and Luo, 2011; Yaohijin, 2003). The skeleton is formed by catalyzing 2, 3-oxidosqualene serving as a substrate by 2, 3-oxidosqualene cyclase (OSC) to form euphorbia kansui or euphorbia pekinensis; then under the action of P450 oxidase and reductase, forming side chain cyclization products of limonin compounds; and finally forming the toosendanin through multiple oxidation rearrangement under the catalytic action of oxidase, reductase and acetylase. At present, the biosynthesis pathway of toosendanin is still in a presumed stage, and no experimental verification is obtained yet.

Disclosure of Invention

In order to make up for the defects of the field, the invention provides a first-step cyclase MtOSC1 in the azadirachtin biosynthesis pathway, and the cyclase can generate precursor substances in the azadirachtin biosynthesis pathway and lay a foundation for the research of the azadirachtin biosynthesis pathway.

The toosendan oxidation squalene cyclase MtOSC1 provided by the invention is a protein of a1 or a2 as follows:

a1. a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

a2. the protein related to the biosynthesis of toosendanin is formed by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table.

The coding gene of the protein also belongs to the protection scope of the invention.

The coding gene is a DNA molecule of b1 or b2 as follows:

b1. the nucleotide sequence is a DNA molecule shown as a sequence 2 in a sequence table;

b2. a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in b1.

An expression cassette, a vector or a recombinant bacterium containing the coding gene also belongs to the protection scope of the invention.

The present invention also provides a method for preparing a transgenic plant, comprising the steps of: introducing the coding gene into a starting plant to obtain a transgenic plant; the content of the compound tirucalla-7, 24-dien-3. beta. -ol in the transgenic plants is altered compared with the starting plants.

The coding gene is introduced through a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into a starting vector pEAQ-HT-DEST 1; the starting plant is control tobacco; the transgenic plant is transgenic tobacco.

The transgenic tobacco produced the compound tirucalla-7,24-dien-3 β -ol as compared to control tobacco.

The application of the protein and the coding gene in the regulation of the azadirachtin biosynthesis pathway also belongs to the protection scope of the invention.

The invention clones the toosendan oxidosqualene cyclase gene MtOSC1 from toosendan by analyzing the toosendan transcriptome data, constructs the MtOSC1 tobacco expression vector by using Gateway system and carries out tobacco in vitro transient expression, compares the extracts of transgenic tobacco and control tobacco by GC-MS to find a differential compound, and identifies the differential compound as tirucalla-7,24-dien-3 beta-ol by nuclear magnetic resonance technology, wherein the compound is the product of the toosendan oxidosqualene cyclase MtOSC 1. The invention clones the cyclase gene in the toosendanin biosynthesis pathway for the first time and verifies the function of the cyclase gene, thereby laying a foundation for deeply analyzing the toosendanin biosynthesis pathway.

Drawings

FIG. 1 is an electrophoresis picture of the MtOSC1 gene recovered from agarose gel.

FIG. 2 GC-MS spectra of tobacco expression products: wherein, (a) TIC, total ion current detection; EIC 393.300, characteristic ion 393.300 extraction chromatogram; red arrows indicate the differential compounds. (b) Mass spectrum of different compounds. Vector represents a tobacco leaf sample into which pEAQ-HT-DEST1 empty Vector is transferred; MtOSC1 shows a tobacco leaf sample into which pEAQ-HT-DEST1-MtOSC1 expression vector was transferred; three replicates per sample.

FIG. 3 nuclear magnetic resonance results (hydrogen spectra) of tobacco expression products of MtOSC 1.

FIG. 4 nuclear magnetic resonance results (carbon spectra) of tobacco expression products of MtOSC 1.

FIG. 5 chemical structure diagram of MtOSC1 enzyme product.

Detailed Description

The present invention is described in detail below with reference to examples, it being understood that the following examples are only illustrative and illustrative of the present invention and do not limit the scope of the present invention in any way.

Biological material：

The plant material used in this experiment was from the tree of Chinaberry in the city of Chengjiang river, Shanchuan, Sichuan province, and was identified as Chinaberry (Melia Toosendanan) in the Meliaceae, by Rooibos, a institute of plants, Chinese academy of sciences, which was described in "Chinese plant journal" and Mirabilis pubescens, the identification of Chinaberry and Chinaberry, using the journal of internal medicine of traditional Chinese medicine, 2005, 5: 476.

The seeds of Nicotiana benthamiana (Nicotiana benthamiana) used in this experiment were stored in the laboratory, and the non-patent literature describing Nicotiana benthamiana is Ting H, et al. 8:454-466. Tobacco plants of 4-6 weeks old are used in the tobacco transient expression experiment.

The Escherichia coli DH5 alpha strain and the Agrobacterium EHA105 strain were stored in the laboratory, are commercially available strains, and are commercially available.

The biological material is also stored in the laboratory and can be issued to the public for verification experiments within twenty years from the filing date.

Experimental reagent：

The rapid universal plant RNA extraction kit comprises: purchased from biotechnology limited, waryo, beijing.

SuperScript^TMIII reverse transcription kit, BP Clonase II mix, LR Clonase II mix, Proteinase K: purchased from Invitrogen corporation.

2 × Q5 Mix: purchased from NEB (beijing) limited.

DMSO, X-gal, IPTG, Coprostanol (coproanol): purchased from Sigma.

pDONR207, pEAQ-HT-DEST 1: given away by the JIC centre in the uk.

Agarose gel DNA recovery kit, 2 × Rapid ligation Buffer, pGEM-T easy vector, T₄DNA ligase: buzaokang is a century Biotechnology Co., Ltd.

10 XEx Taq Buffer, Ex Taq, 2 XTaq Mix, GenStar Plasmid Miniprep Kit (StarPrep Plasmid Miniprep Kit): purchased from GenStar Compton Bio Inc.

NaAC, ethanol, KOH, ethyl acetate, CDCl₃: purchased from Beijing chemical plant and Shanghai Allantin Biotechnology Ltd.

TLC plate: merck KGaA, Silicagel 60F₂₅₄ TLC。

Silica gel column: biotage, 25g, 5g specification.

Inoue buffer (250 mL): 2.72g of manganese chloride tetrahydrate, 0.55g of calcium chloride dihydrate, 4.6625g of potassium chloride, and 5mL of PIPES (0.5M, pH 6.7).

MMA buffer (1L): 2g MES, 2g magnesium chloride hexahydrate, 1mL 0.1M acetosyringone solution.

LB culture medium: at 950ml ddH₂Dissolving 10g tryptone, 5g yeast extract, 10g sodium chloride in O, adjusting pH to 7.4 with NaOH, and adding ddH₂And O is metered to 1L. If a solid medium is prepared, 15g of agar per liter are added. Sterilizing with high pressure steam at 121 deg.C for 20 min.

YEB Medium formulation (1L): 5g tryptone, 1g yeast extract, 5g beef extract, 0.5g MgSO₄5g of sucrose, pH 7.0.

The experimental reagents which are not particularly described in the invention are all conventional reagents in the field, and can be prepared according to the conventional method in the field or obtained commercially; the experimental methods not specifically described are conventional in the art and may be referred to, for example, in the Molecular cloning handbook (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual, 2001), or the manufacturer's instructions.

Example 1 cloning of Toosendan Oxysqualene cyclase Gene (MtOSC1)

1. Extraction of total RNA from toosendan fruit

The method adopts a rapid general plant RNA extraction Kit (Quick RNA Isolation Kit) of the Huayuanyang, extracts the total RNA of the szechwan chinaberry fruit according to the method recorded in the Kit specification and comprises the following steps:

(1) grinding fructus Toosendan fruit in liquid nitrogen rapidly into powder, loading 5mg powder sample in a centrifuge tube, adding 1ml cell lysate A, vortex, adding 100 μ L beta-mercaptoethanol, and vortex shaking for 30s to crack completely.

(2) Then 300. mu.L of deproteinized liquid B and 200. mu.L of chloroform were added to the centrifuge tube, and the mixture was shaken for 30 seconds to mix well (the solution at the bottom of the tube should be swirled up) to be emulsion-like, and left at room temperature for two minutes. This step is very important.

(3) Centrifugation was carried out at 12,000rpm for 10min at room temperature, and cell debris was disrupted at a thickness of about 5mm between the two phases. The supernatant was transferred to another clean 1.5mL centrifuge tube to avoid touching or aspirating the middle and lower layers.

(4) Adding the same volume of the rinsing liquid C, fully reversing and uniformly mixing. Adding the obtained solution including precipitate into the same centrifugal adsorption column for three times, centrifuging at 12,000rpm for 1min after each addition, and removing waste liquid in the collecting tube.

(5) Add 500. mu.L of column wash D to the adsorption column, centrifuge at 12,000rpm for 1min, and discard the waste liquid from the collection tube. Then 500. mu.L of column washing solution D was added and the process was repeated twice. Centrifuge at 12,000rpm for 1min at room temperature to remove residual liquid.

(6) Membrane digestion of DNA: mixing 5 μ L of RNase-free DNase I and 45 μ L of DNase buffer uniformly to prepare DNA digestive juice, preheating the digestive juice at 37 ℃ for 1min, adding into a centrifugal adsorption column, and standing at room temperature for 7 min; directly adding 500 μ L of enzyme-removing solution E into the centrifugal adsorption column, covering, reversing and mixing for several times, centrifuging at room temperature of 12,000rpm for 1min, adding new enzyme-removing solution E, and repeating the steps once; centrifuging at room temperature for 2min, discarding the waste liquid in the collecting tube, and air drying the adsorption column with anhydrous ethanol at room temperature.

(7) RNA elution: transferring the centrifugal adsorption column into an RNase-free 1.5mL centrifuge tube, adding 30 μ L of RNA eluent F, standing at room temperature for 3min, centrifuging at 12,000rpm for 1min, loading the eluent on the column again, eluting at room temperature for 3min, and centrifuging.

(8) RNA quality detection: the RNA extraction quality and concentration were determined by 1% agarose gel and Nanodrop spectrophotometer, respectively.

Through the detection of a Nanodrop spectrophotometer, the total RNA solution of the toosendan fruit with the concentration of 120 ng/mu L is obtained.

2. Total RNA reverse transcription

SuperScript was used from Invitrogen corporation^TMIII reverse transcription kit, the method according to the kit description is to carry out reverse transcription on the total RNA obtained in the step 1, and the steps are as follows:

(1) the following reagents were added to the PCR tube in order, gently mixed and centrifuged briefly.

React at 65 ℃ for 5min and immediately ice-bathe for 3 min.

(2) Adding the following solutions in sequence on ice to prepare a reverse transcription system:

the reaction is carried out for 1h at 50 ℃, and the time can be properly prolonged.

(3) Inactivating at 70 deg.C for 15min, terminating reaction to obtain cDNA solution, collecting 1 μ L, detecting reverse transcription effect with 1% agarose gel, and storing the rest solution at-20 deg.C.

3. Cloning of genes

(1) Primer design

And (3) sending the total RNA of the toosendan fruit obtained in the step (1) to Beijing Nuo He-derived science and technology company Limited to perform transcriptome sequencing to obtain third-generation sequencing information. Based on the sequencing information, 13 OSC gene sequences (GenBank numbers are NM-001334261, NM-001334828, NM-001334856, NM-148667, NM-001334862, NM-001334865, NM-126681, NM-114382, NM-117622, NM-117625, NM-001344127, NM-123624 and NM-001085264 respectively) of Arabidopsis were aligned to find a complete OSC gene sequence, which was named MtOSC1, and the nucleotide sequence and the encoded amino acid sequence are shown in sequence 1. According to the Primer design principle, the Primer Premier 5.0 and DNMAN software are used for designing a cloning Primer of the MtOSC1 gene, and the cloning Primer is synthesized by committee of Biotechnology engineering (Shanghai) GmbH. The nucleotide sequence of the primer is as follows (5 '-3'):

MtOSC1-F:AGAGAAGATGTGGAAGCTGAAGATT；

MtOSC1-R:CTTTATTTTAATTAGGCAATGGAACTTT。

(2) cloning of genes

The target fragment was amplified using the cDNA obtained by the above reverse transcription as a template according to the following PCR reaction system and procedure.

And (3) PCR reaction system:

PCR reaction procedure:

wherein the temperature gradient is set as: 48-58 ℃. After the PCR reaction, 1. mu.L of the reaction product was subjected to 1% agarose gel electrophoresis to determine whether the size of the target band was correct.

(3) Recovery of cloned gene gel

The correct target band was recovered using the kang century agarose gel DNA recovery kit, the procedure was as follows:

(a) electrophoresis: DNA bands were distinguished by 2% agarose gel electrophoresis.

(b) Cutting the glue: after the strips had separated sufficiently, the strips were cut rapidly under a uv lamp and weighed.

(c) Sol: adding sol solution according to W/V of 1:100, and water bath at 50 deg.C for 15min while shaking until the gel is completely dissolved. If the gel block can not be completely dissolved, the sol solution can be properly added or the sol time can be prolonged.

(d) DNA column adsorption: and after the melted gel block is cooled to the room temperature, transferring the solution into a centrifugal adsorption column, standing for 2min, centrifuging at the room temperature of 12,000rpm for 1min, discarding the waste liquid, and reinserting the adsorption column into a recovery tube.

(e) Rinsing: adding 600 μ L of rinsing solution into centrifugal adsorption column, centrifuging at room temperature at 12,000rpm for 1min, and discarding waste solution. This was repeated once and the rinsing solution was thoroughly removed by centrifugation at 12,000rpm for 2min at room temperature.

(f) And (3) elution: the column was placed in a clean 1.5mL centrifuge tube, 40. mu.L of elution buffer was added to the center of the column, allowed to stand at room temperature for 5min, and centrifuged at 12,000rpm for 2 min.

(g) And (3) gel detection: DNA quality was checked by 1% agarose gel electrophoresis and gene concentration was estimated.

The electrophoresis detection result is shown in FIG. 1, a gene band of 2283bp in full length is obtained, and sequencing is carried out by Shanghai Meiji biological medicine science and technology Limited company, and the sequencing result is consistent with the MtOSC1 gene sequence.

Example 2 construction of tobacco transient expression vector in vitro with MtOSC1

1. T vector construction

(1) A addition reaction and ligation reaction

Adding A into a reaction system:

incubation at 37 ℃ for 30min gave product A, which was then placed on ice.

pGEM-T EASY vector connection system:

ligation was performed overnight at 4 ℃.

(2) Preparation of E.coli DH5 alpha competent cells

The E.coli strain preserved at-80 ℃ was streaked on LB solid medium without any antibiotic and cultured at 37 ℃ for 12 hours. Single colonies were picked in LB liquid medium without any antibiotics and cultured at 37 ℃ for 10h at 200 rpm. Inoculating 2mL of the bacterial liquid into 200mL of LB liquid medium, and shake-culturing at 18 ℃ and 200rpm to OD₆₀₀0.5-0.6, about 20 h. Standing the shaken bacterial solution on ice for 30min, subpackaging in 4 precooled 50mL centrifuge tubes, centrifuging at 4 ℃, 4,500rpm for 10min, and discarding the supernatant. 16mL of precooled Inoue buffer was added to each tube to wash the bacterial suspension, centrifuged at 4,500rpm for 10min at 4 ℃ and the supernatant discarded. Then 8mL of precooled Inoue buffer solution is added to gently suspend the thalli, the two tubes are combined, the thalli is centrifuged for 10min at 4 ℃ and 500rpm, and the thalli is collected by discarding the supernatant. Then 3.72mL of precooled Inoue buffer solution is added, thalli are suspended lightly, 280 mu L of precooled DMSO solution is slowly added into the bacterial liquid, the mixture is tapped and mixed evenly, the mixture is stood on ice for 30min, then the mixture is subpackaged into 1.5mL centrifuge tubes, each tube has 70 mu L, the mixture is quickly placed into liquid nitrogen to be frozen, and the frozen mixture is stored in a refrigerator at the temperature of minus 80 ℃.

(3) Transformation of

Coli competent cells stored at-80 ℃ were thawed on ice. Add 5. mu.L of the ligated T vector, mix gently, stand on ice for 30 min. The mixture was heat-shocked at 42 ℃ for 90s and kept on ice for 2 min. 450. mu.L of LB liquid medium without any antibiotics was added and activated at 37 ℃ and 180rpm for 1 h. In the presence of 100. mu.g/ml Amp⁺To the solid LB medium of (1), 40. mu. L X-gal and 8. mu.L IPTG were added, respectively, and the mixture was spread until absorption. The activated E.coli was centrifuged at 4,500rpm for 2min, 100. mu.L of the solution was applied to a plate and incubated overnight at 37 ℃.

(4) Positive colony identification

Single colonies were picked from the solid LB medium described above in 500. mu.L containing 100. mu.g/mlml Amp⁺The liquid LB medium of (1) was activated at 37 ℃ and 200rpm for 3 hours. Then, PCR was carried out on the bacterial solution according to the following system and method to identify positive clones. The PCR primers were as follows:

M13-F：CGCCAGGGTTTTCCAGTCAAGAC；

M13-R：CACACAGGAAACAGTATGAC。

and (3) PCR reaction system:

PCR reaction procedure:

after the PCR reaction, 5. mu.L of the reaction product solution was used to detect whether the size of the target gene band was correct with 1% agarose gel, and the bacterial solution of the positive colony was selected and submitted to the Meji Biomedicine science and technology Co., Ltd, Shanghai for sequencing.

(5) Extraction of plasmids

Selecting positive colonies with correct sequencing result, inoculating 200 μ L of bacterial liquid into 10mL of Amp containing 100 μ g/mL⁺The LB liquid medium of (5) was cultured overnight at 37 ℃ and 200 rpm. Mixing 600 μ L of the bacterial liquid with 600 μ L of 60% glycerol, and preserving bacteria. Extracting the plasmid from the residual bacterial liquid by adopting a GenStar plasmid miniextraction kit according to a method recorded in a kit use instruction, and specifically comprising the following steps of:

collecting bacteria: the bacterial solution was collected in 2mL centrifuge tubes, 4mL of each tube was centrifuged at 12,000rpm for 1min at room temperature, and the supernatant was discarded.

Resuspending: the residual bacteria liquid in the centrifuge tube is removed by suction, 250 mu L of cell suspension containing RNase is added, and the cell is fully suspended by fully mixing and spinning.

Cracking: 250 μ L of cell lysate was added and mixed by gently inverting the mixture upside down, at which time the solution was translucent.

Neutralizing: add 350. mu.L of neutralization buffer, mix well by gently inverting it upside down, and centrifuge at 12,000rpm for 15min at room temperature.

DNA binding: the supernatant was carefully transferred to a centrifugal adsorption column with a centrifuge tube, centrifuged at 12,000rpm for 1min at room temperature, the filtrate was discarded, and the centrifugal adsorption column was replaced in the centrifuge tube.

Rinsing: adding 500 μ L of rinsing solution into adsorption column, centrifuging at 12,000rpm for 1min at room temperature, removing filtrate, and placing the adsorption column into centrifuge tube. This was repeated once, and centrifuged at 12,000rpm for 2min to completely remove the residual liquid from the column.

And (3) elution: the centrifugal adsorption column was transferred to a 1.5mL centrifuge tube, 80. mu.L of elution buffer was added to the center of the column, and the column was left at room temperature for 2min and centrifuged at 12,000rpm for 2min to collect plasmids.

And (3) gel detection: the mass of the extracted plasmid was checked by 1% agarose gel electrophoresis and the concentration was estimated.

After detection, pGEM-T-MtOSC1 plasmid solution with the concentration of 150ng/mL is obtained, and the solution is diluted by 10 times for subsequent recombinant adaptor amplification.

2. Cloning of recombinant adaptor genes

(1) Recombinant linker primer design

Based on the gene sequence of MtOSC1, primers with recombination linkers were designed, and the sequences of the primers were as follows:

RR-MtOSC1-F：

GGGGACAAGTTTGTACAAAAAAGCAGGCTAGAGAAGATGTG；

RR-MtOSC1-R：

GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTATTTTAATT。

(2) cloning of recombinant adaptor genes

And (3) PCR reaction system:

PCR reaction procedure:

wherein the temperature gradient is set to 48-58 ℃. After the PCR reaction, 1. mu.L of the reaction product solution was detected on 1% agarose gel.

(3) PCR product recovery-ethanol recovery method

If the band of the clone product is single, the clone product can be recovered by an ethanol precipitation recovery method, and the specific steps are as follows:

A. 1/10 volumes of a 1M NaAC solution (pH 5.2) were added to the reaction product, and 3 volumes of absolute ethanol were added thereto, followed by quick freezing with liquid nitrogen for 30 seconds.

B. The mixture was centrifuged at 12,000rpm for 30min at 4 ℃ and the supernatant was discarded.

C. The precipitate was washed by adding 1mL of 75% ethanol solution, centrifuged at 12,000rpm for 30min at 4 ℃ and the supernatant was discarded. And repeating the steps once.

D. Carefully sucking the residual liquid at the bottom of the tube with a gun head, and airing the tube at a ventilated place.

E. With 20. mu.L ddH₂O dissolves the DNA precipitate to obtain RR-MtOSC1 solution, and 1 μ L of the solution is taken for electrophoresis detection and concentration estimation.

3. BP reaction and conversion

(1) BP reaction

Incubate at 25 ℃ for 10 h.

Proteinase K 1μL

Incubation at 37 ℃ for 10min gave the recombinant product pDONR207_ MtOSC1, which was placed on ice.

(2) Transformation of

Coli competent cells stored at-80 ℃ were thawed on ice. mu.L of the recombinant product pDONR207_ MtOSC1 was added, mixed gently, and left on ice for 30 min. The mixture was heat-shocked at 42 ℃ for 90s and kept on ice for 2 min. 450. mu.L of LB liquid medium without any antibiotics was added and activated at 37 ℃ and 180rpm for 1 h. Activated E.coli was centrifuged at 3,000rpm for 1min, 400. mu.L of supernatant was removed, the bacterial suspension was resuspended and applied to Gen containing 50. mu.g/ml⁺LB solid plates (gentamicin sulfate) were incubated overnight at 37 ℃.

(3) Positive colony identification

Single colonies were picked from the above LB solid plates in 500. mu.L of 50. mu.g/ml Gen⁺The liquid LB medium of (1) was activated at 37 ℃ and 200rpm for 3 hours. Then, PCR was carried out on the bacterial solution according to the following system and method to identify positive clones. The PCR primers were as follows:

pDONR-F：TCGCGTTAACGCTAGCATGGATCTC；

pDONR-R：GTAACATCAGAGATTTTGAGACAC。

and (3) PCR reaction system:

PCR reaction procedure:

after the PCR reaction is finished, 5 mu L of reaction product solution is taken and used for detecting whether the size of a target gene band is correct by using 1% agarose gel, and positive bacterial colony liquid is selected to delegate the sequencing to Shanghai Meiji biological medicine science and technology limited company.

(4) Plasmid extraction

Selecting bacterial liquid with correct sequencing, taking 200 mu L of small shaking bacterial liquid in 10mL containing 50 mu g/mL Gen⁺The culture was carried out overnight at 200rpm in LB liquid medium (9). Mixing 600 μ L of the bacterial liquid with 600 μ L of 60% glycerol, and preserving bacteria. The plasmid was extracted from the remaining bacterial solution by using GenStar plasmid Mini kit according to the method described in the kit instructions, see step 1(5) of this example for details.

4. LR reaction and transformation

(1) LR reaction system:

incubate at 25 ℃ for 10 h.

Proteinase K 1μL

Incubation was carried out at 37 ℃ for 10min to obtain the recombinant product pEAQ-HT-DEST1-MtOSC1, which was placed on ice.

(2) Transformation of

Coli competent cells stored at-80 ℃ were thawed on ice. Add 5. mu.L of the recombinant product pEAQ-HT-DEST1-MtOSC1, mix gently, stand on ice for 30 min. The mixture was heat-shocked at 42 ℃ for 90s and kept on ice for 2 min. 450. mu.L of LB liquid medium without any antibiotics was added and activated at 37 ℃ and 180rpm for 1 h. The activated E.coli was centrifuged at 3,000rpm for 1min, 400. mu.L of supernatant was removed, the bacterial suspension was resuspended and applied in a medium containing 100. mu.g/ml Kan⁺The solid LB plate of (1) was cultured overnight at 37 ℃.

(3) Positive colony identification

Single colonies were picked from the solid LB plates described above in 500. mu.L Kan⁺(100. mu.g/ml) in liquid LB medium, activated at 37 ℃ and 200rpm for 3 h. Then, PCR was carried out on the bacterial solution according to the following system and method to identify positive clones. The PCR primers were as follows:

DEST1-M13-F：CTTGCTGAAGGGACGACCTGCTAAA；

DEST1-M13-R：TAGTGCGGCGCCATTAAATAACGTG。

and (3) PCR reaction system:

PCR reaction procedure:

after the PCR reaction, 5. mu.L of the reaction product solution was taken, and 1% agarose gel was used to detect whether the size of the target gene band was correct, and the bacterial solution of the positive colony was selected and subjected to sequencing by Shanghai Meiji Biomedicine science and technology Co.

(4) Plasmid extraction

Selecting bacterial liquid with correct sequencing, taking 200 mu L of small shaking bacterial liquid in 10mL of medium containing 100 mu g/mL Kan⁺The culture was carried out overnight at 200rpm in LB liquid medium (9). Mixing 600 μ L of the bacterial liquid with 600 μ L of 60% glycerol, and preserving bacteria. GenStar for residual bacterial liquidPlasmid was extracted using the plasmid extraction kit according to the method described in the kit instructions, see step 1(5) of this example for details.

Example 3 tobacco transient expression in vitro

1. Agrobacterium EHA105 competent cell preparation

(1) Agrobacterium strain EHA105, stored at-80 ℃ was streaked in a medium containing 50. mu.g/ml Rif⁺And culturing the mixture on YEB solid medium of antibiotics at 28 ℃ for 2 days.

(2) Single colonies were picked to contain 50. mu.g/ml Rif⁺YEB liquid medium of antibiotics was cultured at 28 ℃ and 200rpm for 1 d.

(3) Inoculating 2mL of the bacterial suspension into 200mL of a suspension containing 50. mu.g/mL of Rif⁺YEB liquid culture Medium for antibiotics, cultured at 28 ℃ and 200rpm to OD₆₀₀Is 0.6-0.8.

(4) The shaken bacterial solution was distributed to 4 precooled 50mL centrifuge tubes, centrifuged at 4,500rpm for 10min at 4 ℃ and the supernatant was discarded.

(5) Precooling sterile ddH with the same volume as the original bacteria liquid is added into each tube₂O washing the bacterial liquid, centrifuging at 4,500rpm for 10min at 4 ℃, and discarding the supernatant.

(6) Then 1/2 original bacteria liquid with equal volume precooling sterile ddH is respectively added₂O washing the bacterial liquid, centrifuging at 4, 4 rpm and 500rpm for 10min, discarding the supernatant and collecting the thallus. And repeating the steps once.

(7) Adding 1/100 original bacteria liquid with equal volume, precooling, sterilizing and 10% glycerol, suspending the thalli slightly, subpackaging in 1.5mL centrifuge tubes with each tube being 70 mu L, and quickly freezing in liquid nitrogen at-80 ℃ for storage in a refrigerator.

2. Tobacco in vitro transient expression vector transformation

A control group and an experimental group are arranged, wherein the control group adopts pEAQ-HT-DEST1 empty vector to transform agrobacterium, and the experimental group adopts pEAQ-HT-DEST1-MtOSC1 expression vector to transform agrobacterium.

The agrobacterium transformation method is as follows:

(1) the Agrobacterium EHA105 competent cells were removed from the-80 ℃ freezer and placed on ice, and 1-2. mu.L of the expression vector was added just after the competent cells had thawed, mixed well and placed on ice.

(2) Taking out the electric shock cup from 75% alcohol, rinsing with anhydrous alcohol for 1-2 times, air drying in a clean bench, and pre-cooling in ice bath for later use.

(3) And adding the mixed competent cell carrier solution between the two electric shock plates along the edge of the electric shock cup by using a liquid transfer device, and lightly tapping to ensure that the competent cell carrier solution is settled to the bottom and ensure that no air bubble exists between the two electric shock plates.

(4) The electric shock cup is placed in a conversion instrument, and a constant voltage electric shock of 1,800V is set.

(5) After the electric shock is finished, 1mL of YEB culture medium without any antibiotics is added by a pipette, the bacterial liquid is suspended lightly and transferred into a 1.5mL sterile tube, and the culture is carried out at 28 ℃ and 150rpm for 3-4h with low speed shaking.

(6) The conversion product was plated in a solution containing 50. mu.g/ml of Rif⁺、100μg/ml Kan⁺Culturing on YEB solid culture medium of antibiotics at 28 deg.C for 2-3 days to allow bacterial colony to grow out.

3. Positive identification of colonies

Single colonies were picked from the above YEB solid medium to a medium containing 50. mu.g/ml of Rif⁺、100μg/ml Kan⁺YEB liquid medium of antibiotics was cultured at 28 ℃ and 250rpm for 1 d. Bacterial liquid PCR was performed according to the following system and procedure to identify whether the colonies were positive.

And (3) PCR reaction system:

PCR reaction procedure:

after the PCR reaction, 5. mu.L of the reaction product solution was used to detect whether the size of the target gene band was correct with 1% agarose gel, and the bacterial solution of the positive colony was selected and submitted to the Meji Biomedicine science and technology Co., Ltd, Shanghai for sequencing.

4. Bacterial liquid expanding culture and transformation

(1) Streaking and culturing the bacterial liquid of positive bacterial colony with correct sequencing, and picking out the single bacterial colonyColonies were grown in a medium containing 50. mu.g/ml of Rif⁺、100μg/ml Kan⁺YEB liquid medium of antibiotics, 28 ℃,200 rpm shake culture to logarithmic phase.

(2) Sucking 0.5mL of the bacterial liquid cultured in the step (1), transferring the bacterial liquid into 50mL of liquid culture medium containing the same antibiotics, and continuing shaking culture until OD is reached₆₀₀About 0.6.

(3) The bacterial solution was transferred to a 50mL centrifuge tube, centrifuged at 4,000rpm for 10min, and the bacterial solution was collected.

(4) The supernatant was removed, the cell suspension was resuspended in MMA buffer and OD adjusted₆₀₀Sucking 1mL of bacterial liquid by a disposable syringe, pricking 2-3 small holes on tobacco leaves by a needle head, pressing the syringe on the pinhole, pressing the lower part of the leaves by fingers, pressing the bacterial liquid in the syringe under pressure and penetrating the bacterial liquid into leaf tissues with slight force, and marking the injection part by a marking pen. The injected tobacco plants were cultured at 25 ℃ for seven days under 14h light and 10h dark photoperiod, and then transgenic tobacco leaves were cut for compound determination. Injecting tobacco leaves with pEAQ-HT-DEST1 empty vector-EHA 105 bacterial liquid, and culturing to obtain control tobacco; the tobacco leaves are injected with pEAQ-HT-DEST1-MtOSC1-EHA105 bacterial liquid, and the MtOSC1 transgenic tobacco is obtained through culture.

Example 4 tobacco expression product analysis by MtOSC1

1. Extraction of tobacco expression products

The compounds in the control tobacco and MtOSC1 transgenic tobacco leaves obtained in example 3 were extracted separately as follows:

(1) preparing a saponification reagent ethanol: water: KOH (solid) ═ 9 ml: 1 ml: 1g, adding Coprotanol as an internal standard, and the final concentration is 10 ng/mL.

(2) The tobacco leaf was freeze dried and ground into a powder, 5mg of the powder was sampled in a centrifuge tube and 500. mu.L of saponification reagent was added.

(3) Reacting at 75 ℃ for 1h, continuously shaking during the reaction, opening a cover to pay attention to liquid splashing, and completely volatilizing residual liquid, particularly ethanol.

(4) Add 500. mu.L of ethyl acetate to the sample and vortex extract.

(5) An additional 500. mu.L of water was added and vortexed again.

(6) Centrifuging at 8,000rpm for 1min, transferring supernatant into a sample bottle, and evaporating to dryness to obtain extract.

2. Analysis of tobacco expression products

(1) The extract of step 1 was dissolved in 500. mu.L of ethyl acetate, 100. mu.L was taken out from a sample flask with a liner, dried with nitrogen, and then 30. mu.L of 1- (Trimethylsil) imidazole-Pyridine mixture (pure reagent, purchased from Sigma) was added and reacted at 70 ℃ for 30 min.

(2) Analyzing the derivatization sample by using a GC-QQQ-MS platform, wherein the GC-QQQ-MS platform is Agilent GC 7890B and Agilent MS 5977A; EI source ionization mode; the column was DB-5HT (30 m.times.0.32 mm, 0.1 μm film thickness, Agilent). The carrier gas was helium and the flow rate was 3.0 mL/min. The injection port temperature was 250 ℃. The temperature raising program is to keep the temperature at 170 ℃ for 2min, raise the temperature at 6 ℃/min to 290 ℃ for 4min, and raise the temperature at 10 ℃/min to 340 ℃ for 0 min. The sample size was 1 μ L, without splitting. The MS detector scans at a speed of 3.9 times/s under the standard electron impact condition of 70eV, and the scanning interval is 60-800.

(3) GC-MS (Gas chromatography-mass spectrometry) results Qualitative and quantitative Analysis of compounds was performed using the Agilent Analysis software, quantitative Analysis B.0600.

From the GC-MS measurements, it can be seen that MtOSC1 transgenic tobacco produced a different compound with a peak time of 22.08min and characteristic ions of 393.300, 483.400 (fig. 2) compared to control tobacco.

3. Isolation and identification of tobacco expression product of MtOSC1

(1) Isolation of Compounds

A large number of harvested MtOSC1 transgenic tobacco leaves were ground and compound extraction was performed by adding appropriate amount of ethyl acetate, and repeated three times for 3 hours each. The extracts were combined, spun dry, dissolved in dichloromethane, and then added to about 0.5g of 300 mesh silica gel, and allowed to air dry in a fume hood. The extract is separated by using medium and low pressure, the specification of a silica gel column is 25g, the mobile phase is ethyl acetate/n-hexane (gradient elution is 4-10 percent), and the flow rate of the mobile phase is 100 mL/min. The fractions were checked by TLC plate and the fractions of the desired compound were confirmed. Similar fractions were combined according to assay results, spun dry, dissolved in dichloromethane, and passed through a silica gel column again. The specification of the silica gel column is 5g, the mobile phase is ethyl acetate/n-hexane (isocratic elution is 2 percent), and the flow rate of the mobile phase is 25 mL/min. Obtaining single components, detecting the purity of the target compound by GC-MS, and combining spin drying samples to perform Nuclear Magnetic Resonance analysis (NMR) if the purity of the target compound is more than 95%.

(2) Compound identification

Subjecting the sample to CDCl₃The purified compounds were analyzed by Bruker 800MHz nmr spectroscopy at the university of capital medical university central laboratory, after dissolution, with the addition of a nuclear magnetic tube, and the corresponding hydrogen (fig. 3) and carbon spectra (fig. 4) were obtained.

The hydrogen and carbon spectra data are as follows:

the structure of the target compound was analyzed based on the hydrogen and carbon spectra information to obtain the product structure of MtOSC1 enzyme (FIG. 5) with the chemical name tirucalla-7, 24-dien-3. beta. -ol (kansui-7, 24-dienol).

Sequence listing

<110> institute of plant of Chinese academy of sciences

<120> Szechwan Chinaberry oxidosqualene cyclase MtOSC1, and coding gene and application thereof

<130> P190902-ZWY

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 760

<212> PRT

<213> Melia toosendan (Melia tosendan)

<400> 1

Met Trp Lys Leu Lys Ile Ala Glu Gly Asp Lys Asn Ser Pro Tyr Ile

1 5 10 15

Phe Thr Thr Asn Asn Phe Val Gly Arg Gln Ile Trp Glu Phe Asp Pro

20 25 30

Asn Ala Gly Thr Ala Glu Glu Leu Ala Glu Val Glu Glu Ala Arg Gln

35 40 45

Asn Phe Tyr Lys Asn Arg His Gln Val Lys Pro Ala Ser Asp Leu Ile

50 55 60

Phe Arg Leu Gln Phe Leu Arg Glu Lys Asn Phe Lys Gln Thr Ile Pro

65 70 75 80

Gln Val Lys Val Glu Asp Gly Glu Glu Ile Thr Tyr Asp Thr Ala Thr

85 90 95

Ala Ala Met Lys Arg Ala Ala His Tyr Phe Ser Ala Ile Gln Ala Gly

100 105 110

Asp Gly His Trp Pro Ala Glu Asn Ser Gly Pro Met Tyr Phe Leu Pro

115 120 125

Pro Phe Ile Phe Ser Leu Tyr Ile Thr Gly His Leu Asp Thr Val Phe

130 135 140

Thr Ala Ala His Arg Arg Glu Val Leu Arg Tyr Leu Tyr Asn His Gln

145 150 155 160

His Glu Asp Gly Gly Trp Gly Ile His Ile Glu Gly Pro Ser Ser Met

165 170 175

Phe Gly Thr Val Tyr Ser Tyr Leu Thr Met Arg Leu Leu Gly Leu Gly

180 185 190

Pro Asn Asp Gly Glu Asn Asn Ala Cys Ala Arg Ala Arg Lys Trp Ile

195 200 205

Arg Asp Asn Gly Gly Val Thr Tyr Ile Pro Ser Trp Gly Lys Asn Trp

210 215 220

Leu Ser Ile Leu Gly Leu Phe Glu Trp Ala Gly Thr His Pro Met Pro

225 230 235 240

Pro Glu Phe Trp Met Leu Pro Ser Tyr Phe Pro Leu His Pro Ala Gln

245 250 255

Met Trp Cys Phe Cys Arg Leu Val Tyr Met Pro Leu Ser Tyr Leu Tyr

260 265 270

Gly Lys Arg Phe Val Gly Pro Ile Thr Pro Leu Ile Lys Gln Leu Arg

275 280 285

Glu Glu Leu His Thr Glu Pro Tyr Asp Gln Ile Asn Trp Arg Lys Val

290 295 300

Arg His Leu Cys Ala Lys Pro Asp Leu Tyr Tyr Pro His Pro Phe Val

305 310 315 320

Gln Asp Val Leu Trp Asp Thr Leu Tyr Leu Ala Thr Glu Pro Leu Leu

325 330 335

Thr Arg Trp Pro Leu Asn Lys Tyr Leu Arg Glu Lys Ala Leu Lys Gln

340 345 350

Thr Met Lys Ile Ile His Tyr Glu Asp Gln Ser Ser Arg Tyr Ile Thr

355 360 365

Ile Gly Cys Val Glu Lys Pro Leu Cys Met Leu Ala Cys Trp Val Glu

370 375 380

Asp Pro Glu Gly Val Ala Phe Lys Lys His Leu Glu Arg Ile Ala Asp

385 390 395 400

Phe Ile Trp Ile Gly Glu Asp Gly Met Lys Val Gln Thr Phe Gly Ser

405 410 415

Gln Thr Trp Asp Thr Ala Leu Gly Leu Gln Ala Leu Leu Ala Cys Asn

420 425 430

Ile Val Asp Glu Ile Gly Pro Ala Leu Ala Lys Gly His Asp Tyr Leu

435 440 445

Lys Lys Ala Gln Val Arg Asp Asn Pro Val Gly Asp Tyr Thr Ser Asn

450 455 460

Phe Arg His Phe Ser Lys Gly Ala Trp Thr Phe Ser Asp Gln Asp His

465 470 475 480

Gly Trp Gln Val Ser Asp Cys Thr Ala Glu Ser Leu Lys Cys Cys Leu

485 490 495

His Phe Ser Met Leu Pro Arg Glu Ile Val Gly Glu Lys His Asp Pro

500 505 510

Glu Arg Leu Tyr Glu Gly Val Asn Phe Ile Leu Ser Leu Gln Asp Lys

515 520 525

Asn Gly Gly Leu Ala Val Trp Glu Lys Ala Gly Ala Ser Leu Leu Leu

530 535 540

Glu Trp Leu Asn Pro Val Glu Phe Leu Glu Asp Leu Ile Val Glu His

545 550 555 560

Thr Tyr Val Glu Cys Thr Ala Ser Ala Ile Glu Ala Phe Val Met Phe

565 570 575

Lys Lys Leu Tyr Pro His His Arg Lys Lys Glu Ile Glu Asn Phe Leu

580 585 590

Val Lys Ala Val Gln Tyr Ile Glu Asn Glu Gln Thr Ala Asp Gly Ser

595 600 605

Trp Tyr Gly Asn Trp Gly Val Cys Phe Leu Tyr Gly Thr Cys Phe Ala

610 615 620

Leu Gly Gly Leu His Ala Ala Gly Lys Thr Tyr Asn Asn Cys Leu Ala

625 630 635 640

Ile Arg Arg Ala Val Glu Phe Leu Leu Gln Ala Gln Ser Asp Asp Gly

645 650 655

Gly Trp Gly Glu Ser Tyr Lys Ser Cys Pro Ser Lys Ile Tyr Val Pro

660 665 670

Leu Asp Gly Lys Arg Ser Ser Val Val His Thr Ala Leu Ala Val Leu

675 680 685

Gly Leu Ile His Ala Gly Gln Ala Glu Arg Asp Pro Thr Pro Ile His

690 695 700

Arg Gly Val Lys Leu Leu Ile Asn Ser Gln Leu Glu Asn Gly Asp Phe

705 710 715 720

Pro Gln Gln Glu Ile Met Gly Val Phe Met Arg Asn Ser Met Leu His

725 730 735

Tyr Ala Gln Tyr Arg Asn Ile Phe Pro Leu Trp Ala Leu Ala Glu Tyr

740 745 750

Arg Arg Lys Val Pro Leu Pro Asn

755 760

<210> 2

<211> 2283

<212> DNA

<213> Melia toosendan (Melia tosendan)

<400> 2

atgtggaagc tgaagattgc agagggagac aaaaatagcc catatatttt tacaacaaac 60

aatttcgttg gaaggcaaat atgggaattt gatccgaatg ctggaactgc tgaagagctt 120

gctgaagttg aagaagctcg tcagaatttc tacaagaatc gccatcaagt caagcctgct 180

agtgacctta tttttcgtct tcagtttctt agagagaaaa acttcaagca aacgattcct 240

caagtgaagg ttgaagatgg ggaggaaatc acatatgaca ctgctacagc agcaatgaag 300

agggctgctc actacttctc agcgattcag gctggcgatg gccattggcc tgctgaaaat 360

tctggcccta tgtatttcct tcctccattt atattcagct tgtacattac aggacatctt 420

gatactgtat ttacagctgc tcatcgcaga gaagtccttc gttacttata caatcatcag 480

catgaagatg gagggtgggg aatacacata gaaggaccaa gcagtatgtt tggtacagtt 540

tacagttatc ttacaatgcg tttgctgggg ttaggaccca acgatggtga aaacaatgcc 600

tgtgctagag ctagaaagtg gattcgtgat aatggtggtg tcacttacat tccctcttgg 660

ggaaagaatt ggctttcgat tcttggattg tttgaatggg ctggaacaca cccaatgccc 720

ccagagttct ggatgcttcc ttcttatttt ccacttcatc cagcccaaat gtggtgcttc 780

tgccggctgg tttacatgcc cttgtcttat ttatacggca aaagatttgt tggtccaatc 840

actccactta tcaaacaact cagagaagaa cttcacacag agccttacga tcaaatcaac 900

tggaggaaag ttcgtcatct atgtgcgaag cctgatctct actacccaca tccattcgta 960

caagacgttc tatgggatac tctatacttg gctacagagc ctctgcttac tcgttggcca 1020

ttgaacaagt atctcagaga gaaggctttg aaacaaacga tgaagatcat tcattatgaa 1080

gaccaaagca gtcgatacat tactattggc tgcgtcgaga agccgttgtg tatgcttgct 1140

tgttgggtgg aggatcctga gggggttgct ttcaagaagc atcttgagag aattgctgat 1200

tttatttgga ttggagaaga tggaatgaaa gttcagacat ttggtagtca aacatgggat 1260

actgctcttg gtcttcaagc tttgcttgct tgcaatatcg ttgatgaaat tggaccagca 1320

ctcgctaaag gacacgacta cttgaagaaa gctcaggtga gggataatcc agtgggtgat 1380

tatacaagca atttccgtca cttttctaaa ggagcatgga ctttctctga tcaagatcat 1440

ggttggcaag tttcagattg tactgcagaa agtttgaagt gctgcttgca tttctcaatg 1500

ctgcctcgag aaattgttgg agagaaacat gatcctgaga gattatatga aggtgtcaat 1560

ttcatactct ctcttcagga taaaaatggt ggattagcag tttgggagaa agctggtgcc 1620

tctttgttgt tagagtggct caatcctgta gagtttctgg aggaccttat tgttgagcat 1680

acttatgtgg agtgcactgc ttcagcaatc gaggcatttg ttatgttcaa gaaattatac 1740

ccacatcatc gcaagaagga gattgaaaat ttcctcgtaa aagctgtaca gtacattgaa 1800

aatgagcaaa ctgctgatgg ctcatggtat ggaaactggg gagtttgctt cttatatgga 1860

acatgttttg cacttggagg attacatgct gctggaaaga cttacaacaa ttgtcttgcc 1920

attcgtagag cagttgaatt tctgctccaa gcacagagtg atgatggtgg ttggggagag 1980

agctacaaat cttgccctag taagatatat gtacctcttg atggaaaaag atcaagtgtg 2040

gtacacactg cattggctgt tcttggttta attcatgctg ggcaggctga aagagaccca 2100

acacctattc atcgtggtgt aaaattgctg atcaactctc aattggagaa tggagacttc 2160

cctcaacagg aaattatggg agtttttatg agaaactcta tgttacacta tgctcaatac 2220

aggaatattt ttcctttgtg ggctttagcc gaatatagaa gaaaagttcc attgcctaat 2280

taa 2283

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agagaagatg tggaagctga agatt 25

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctttatttta attaggcaat ggaacttt 28

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgccagggtt ttccagtcaa gac 23

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cacacaggaa acagtatgac 20

<210> 7

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggggacaagt ttgtacaaaa aagcaggcta gagaagatgt g 41

<210> 8

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggggaccact ttgtacaaga aagctgggtc tttattttaa tt 42

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcgcgttaac gctagcatgg atctc 25

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtaacatcag agattttgag acac 24

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cttgctgaag ggacgacctg ctaaa 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tagtgcggcg ccattaaata acgtg 25

Claims (10)

1. A protein which is a protein of a1 or a2 as follows:

a1. a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

a2. the protein related to the biosynthesis of toosendanin is formed by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table.

2. A gene encoding the protein of claim 1.

3. The encoding gene of claim 2, wherein: the coding gene is a DNA molecule of b1 or b2 as follows:

b1. the nucleotide sequence is a DNA molecule shown as a sequence 2 in a sequence table;

b2. a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in b1.

4. An expression cassette comprising the coding gene of claim 2 or 3.

5. A vector comprising the gene encoding the gene of claim 2 or 3.

6. A recombinant bacterium comprising the coding gene of claim 2 or 3.

7. A method of making a transgenic plant comprising the steps of: introducing the coding gene of claim 2 or 3 into a starting plant to obtain a transgenic plant; the content of the compound tirucalla-7, 24-dien-3. beta. -ol in the transgenic plants is altered compared with the starting plants.

8. The method of claim 7, wherein: the coding gene is introduced through a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into a starting vector pEAQ-HT-DEST 1; the starting plant is control tobacco; the transgenic plant is transgenic tobacco.

9. The method of claim 8, wherein: the transgenic tobacco produced the compound tirucalla-7,24-dien-3 β -ol as compared to control tobacco.

10. Use of the protein of claim 1, the gene encoding the protein of claim 2 or 3, for modulating the azadirachtin biosynthetic pathway.

Images