CN107400663B - Scale-purple back enteromorpha-xanthone six-position hydroxyl oxygen methyltransferase as well as coding gene and application thereof - Google Patents

Abstract

The invention discloses a rust-removing purple back enteromorpha xanthone six-position hydroxyl oxygen methyltransferase and a coding gene and application thereof. The amino acid sequence of the platymus anachorifolius flavone six-position hydroxyl oxygen methyltransferase is one of the following: (1) an amino acid sequence shown as SEQ ID No. 1; or (2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.1 and has the same function. The invention clones 1 oxygen methyltransferases capable of efficiently catalyzing six-hydroxyl methylation of flavone from the blunt-scale purple back moss for the first time, and the in vitro enzyme activity function identification proves that PaF6OMT optimal substrates are baicalein and scutellarein. Experiments on the influence of reaction time and protein amount on substrate conversion rate prove that baicalein and scutellarein can be completely catalyzed to generate oroxylin A and hispidulin respectively in proper protein amount and certain reaction time.

Description

Scale-purple back enteromorpha-xanthone six-position hydroxyl oxygen methyltransferase as well as coding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, and particularly relates to a rust-removing and back-coating xanthone six-position hydroxyoxymethyltransferase as well as a coding gene and application thereof.

Background

Oroxylin A and hispidulin are 6-OH methylated products of baicalein and scutellarein, and have a wide range of biological activities, such as antioxidant, antifungal, anti-inflammatory, anti-tumor, etc. The oroxylin A is reported in the literature to be the main effective active ingredient in the anti-labor medicine Angongning clinically used at present. The hispidulin is an active metabolite of scutellarin in a traditional medicine in vivo, has stronger biological activity, is easy to absorb by oral administration, has the bioavailability more than 3 times higher than that of the scutellarin, and has stronger effects of resisting tumors, viruses, hepatic fibrosis, senile dementia, ischemic cerebrovascular disease and the like. Oroxylin A and hispidulin are expected to become lead compounds of new drugs, and the synthesis of the oroxylin A and the hispidulin A is also concerned more and more widely.

However, oroxylin A and homoplantaginin are not high in plant content, the process flow of extraction from plants is complex, and separation and purification are difficult. The study is that oroxylin A and hispidulin are chemically synthesized by baicalein and scutellarein, and in order to protect the rest hydroxyl groups on a benzene ring from being methylated in the synthesis process, the synthesis steps are complex, the synthesis time is long, and a plurality of auxiliary compounds are required to participate.

The platyphylla (platyphylla) is a moss plant, has simple structure, no stem and leaf differentiation, only flat thallus and no real root and vascular bundle. At present, relatively few researches on the blunt-scaled purple back moss exist, and no report is found for separating and identifying the oxymethyltransferase capable of specifically catalyzing the six-hydroxyl methylation of flavone from the blunt-scaled purple back moss.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide the scale-purple back moss flavone six-position hydroxyl oxygen methyltransferase and a coding gene and application thereof. The oxygen methyltransferase is from a lichen plant, namely, a blunt-scaled purple-back lichen, belongs to I-type Oxygen Methyltransferases (OMTs), has magnesium ion dependence, is the first oxygen methyltransferases capable of efficiently catalyzing the methylation of flavone six-position hydroxyl, can be used for synthesizing oroxylin A and hispidulin by an enzyme method, and has the advantages of simple and mild enzyme activity reaction conditions, short time, single product and high conversion rate.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a six-position hydroxyl oxygen methyltransferase (PaF6OMT) of bryosein, which has an amino acid sequence of one of the following:

(1) an amino acid sequence shown as SEQ ID No. 1; or

(2) And (b) the proteins with the same functions, which are obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 1.

The coding gene of the creosone hexa-hydroxyoxymethyltransferase also belongs to the protection scope of the invention.

In the above coding gene (PaF6OMT), the nucleotide sequence is one of the following:

(1) a nucleotide sequence shown as SEQ ID No. 2; or

(2) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID No.2 and codes the same functional protein.

Furthermore, the invention also provides an expression vector containing the coding gene.

The expression vector is a recombinant prokaryotic expression vector.

In one embodiment of the present invention, the recombinant prokaryotic expression vector is: the coding gene was inserted into expression vector pET32 a.

The invention also provides a recombinant cell and a transformant containing the expression vector.

Preferably, the recombinant cell is cell BL21(DE3) containing the above expression vector.

The invention also provides a primer pair for amplifying the coding gene, and the nucleotide sequences of the primer pair are respectively shown as SEQ ID No.3 and SEQ ID No. 4.

The application of the creosone hexa-hydroxyoxymethyltransferase in synthesizing oroxylin A and/or hispidulin also belongs to the protection scope of the invention.

The application of the creosone hexa-hydroxyoxymethyltransferase in catalyzing baicalein to synthesize oroxylin A also belongs to the protection scope of the invention.

The application of the creosote hexa-hydroxyoxymethyltransferase in catalyzing scutellarein to synthesize hispidulin also belongs to the protection scope of the invention.

The invention has the beneficial effects that:

the invention screens out an oxygen methyltransferase from a transcriptome database of the blunt-scale purple back moss for the first time, and successfully amplifies a full-length sequence by utilizing PCR. The target protein is obtained by constructing pET32a protein expression vector and transforming Escherichia coli BL21(DE 3). The in vitro enzyme activity functional identification proves that PaF6OMT optimal substrates are baicalein and scutellarein. Experiments on the influence of reaction time and protein amount on substrate conversion rate prove that in proper protein amount and certain reaction time, the protein can completely catalyze baicalein and scutellarein to generate oroxylin A and hispidulin respectively. The protein PaF6OMT can be applied to enzymatic synthesis of oroxylin A and hispidulin, and has high application value and wide application prospect.

Drawings

FIG. 1: PaF6 electrophoresis picture of full-length cDNA amplified product of OMT gene.

FIG. 2: PaF6 SDS-PAGE electrophoresis of OMT protein;

wherein: m protein molecular mass standard

Lane 1: empty vector pET32a protein supernatant;

lane 2: purifying an empty vector pET32a protein;

lane 3: PaF6OMT protein supernatant;

lane 4: PaF6OMT protein purification.

FIG. 3: identifying reaction products by HPLC, wherein reaction substrates are baicalein and scutellarein;

wherein: A. d is empty vector control;

B. e is PaF6OMT protease activity reaction result;

C. f is a product standard.

FIG. 4: influence of temperature on the rate of enzymatic activity.

FIG. 5A: the effect of protein amount on substrate conversion;

FIG. 5B: influence of reaction time on substrate conversion.

FIG. 6: PaF6 subcellular localization map of OMT;

wherein: a: green fluorescence signal under excitation light; b: fluorescence signal of chloroplast under excitation light

C: tobacco epidermal cells under natural light; d: A. b, C, respectively.

Detailed Description

The present invention will be further described with reference to examples, but the following description is only for the purpose of explaining the present invention and does not limit the contents thereof.

In the following examples, the experimental methods used, which are not specifically described, are conventional methods, and reference is made, for example, to the molecular cloning laboratory Manual (Sambrook and Russell, 2001).

In the following examples, materials, reagents and the like used in the examples are commercially available unless otherwise specified.

Example 1 cloning of the expression Gene PaF6OMT

1.1 CTAB-PVP method for extracting total RNA of pangolin scales and purple back fur

(1) Taking a fresh plant material of the blunt-scale purple-backed moss, cleaning, sucking excess water by using filter paper, putting the plant material in a mortar, adding liquid nitrogen, and grinding the plant material until the material is powdered.

(2) Taking a proper amount of powder into a pre-cooled centrifuge tube, adding 800 mu l of CTAB-PVP extracting solution preheated at 65 ℃, and turning upside down and mixing evenly.

The preparation method of the CTAB-PVP extraction buffer solution is as follows:

100mM Tris & HCl (pH 8.0), 2% CTAB (w/v), 2% PVP (w/v), 25mM EDTA, 2M NaCl, mercaptoethanol added to 0.2% after autoclaving; solution preparation of DEPC treated ddH₂And O, autoclaving for standby.

(3) Bathing at 65 deg.C for 30min, and mixing by reversing every 6-10 min.

(4) Cooling, adding 600 μ l chloroform, and mixing; centrifuge at 13,000rpm for 10min at 4 ℃.

(5) The supernatant was transferred to a new centrifuge tube, 600. mu.l chloroform was added, and after shaking and mixing, centrifugation was carried out at 13,000rpm at 4 ℃ for 10 min.

(6) Repeat the above steps (i.e. three extractions with chloroform).

(7) Carefully pipette the supernatant into a new 1.5ml centrifuge tube, add 1/3 volumes of 8M LiCl, and allow to stand at-20 ℃ for more than 3h (or at 4 ℃ overnight).

(8) Centrifuge at 13,000rpm for 10min at 4 ℃ and discard the supernatant.

(9) The precipitate was washed 2-3 times with 800. mu.l of 75% ethanol. Centrifuging, removing supernatant, and volatilizing residual ethanol.

(10) 40. mu.l of the sterilized water treated with protease K was added to dissolve RNA, thereby obtaining total RNA. The concentration and mass of the extracted RNA were determined using a BioPhotometer plus nucleic acid protein analyzer.

1.2 PaF6 full-Length amplification of OMT Gene

1.2.1 primer design

The sequence analysis program of the software Bioxm 2.0 was used to find PaF6 the open reading frame (Openreading frame) of the OMT. The non-coding Region (UTR) flanking the ORF was amplified using the software primer 5.0 to design the full length primer PaF6 OMT-F/R;

full-length primer:

PaF6OMT-F:GCATTGGAAGGATTGTTTGG；(SEQ ID No.3)

PaF6OMT-R:AATTCGCTTGGCATCG；(SEQ ID No.4)

1.2.2 cDNA Synthesis

And (3) taking the extracted total RNA of the blunt-scale purple back moss as a template, and obtaining a cDNA template strand by a PCR (polymerase chain reaction) technology by using a PrimeScript RT Master Mix reverse transcription system.

The reverse transcription system and reverse transcription procedure were as follows:

reverse transcription procedure: 15min at 37 ℃; denaturation at 85 ℃ for 15s, and heat preservation at 4 ℃.

The reverse transcription product was stored at-20 ℃ and diluted 10-fold before use.

1.2.3 amplification of target Gene

And performing amplification by using the reverse transcribed cDNA of the panus squamosa as a template and PaF6OMT-F/R as a primer.

The amplification system and the amplification procedure were as follows:

PCR amplification procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 50 ℃ for 15s, extension at 72 ℃ for 30s, and 33 cycles; extension at 72 ℃ for 10 min.

The PCR results were checked by agarose gel electrophoresis (see FIG. 1 for results), and the bands of the desired size were cut and recovered as follows.

The PCR product was subjected to agarose gel electrophoresis (1.5%, W/V, g/100ml), and the desired fragment was recovered using an OMEGA gel recovery kit. The method comprises the following steps:

(1) the PCR product was subjected to agarose gel electrophoresis (1.5%, W/V, g/100mL), stained with Ethidium Bromide (EB) for 5min, and the gel containing the band of the desired size was rapidly excised under an ultraviolet lamp and placed in a 1.5mL centrifuge tube.

(2) 400 μ L Binding Buffer (XP2) was added and the gel mass was dissolved in a water bath at 55 ℃. The tube was shaken by inverting every 2-3min during this period.

(3) The above-mentioned sol solution was transferred to a Hibind DNA column, which was placed in a 2mL collection tube and centrifuged at 12,000rpm for 1 min.

(4) The collection tube was discarded and 300. mu.L Binding Buffer (XP2) was added to the Hibind DNA column. Centrifuge at 12,000rpm for 1min and discard the filtrate.

(5) Add 700. mu.L of SPW Wash Buffer and centrifuge at 12,000rpm for 1 min.

(6) Repeating the previous step once.

(7) The filtrate was discarded and the empty HiBind DNA column was centrifuged at 12,000rpm for 2min at room temperature to evaporate the remaining ethanol.

(8) The HiBind DNA column was placed in a new 1.5mL centrifuge tube, uncapped and placed until the ethanol was evaporated. Add 30. mu.L ddH to the center of the column₂O, standing at room temperature for 2min, and centrifuging at 12,000rpm for 1 min.

(9) The concentration and quality of the gel recovered product were determined using a Biophotometer plus nucleic acid protein analyzer, and the recovered fragments were used immediately or stored at-20 ℃.

1.3T-A cloning of the fragment of interest

1.3.1 addition of A to T

And (3) carrying out A addition reaction on the recovered product fragments of the glue, wherein the system and conditions are as follows:

the components are mixed evenly and placed in a PCR instrument for reaction for 40min at 72 ℃, and then the A-added product is connected with a T carrier (purchased from Takara company) in the following reaction system:

the contents were mixed by gentle pipetting, centrifuged briefly and ligated for 3h at 16 ℃.

1.3.2 transformation

The 10 mu L of the ligation product is transformed into escherichia coli DH5 α competent cells, the transformation method comprises the steps of taking out escherichia coli DH5 α competent cells (50 mu L) stored at the temperature of-80 ℃, unfreezing the cells on ice, adding 10 mu L of the ligation product, gently blowing and uniformly mixing, standing on ice for 30min, quickly placing the cells on ice for 2min after being thermally shocked in water bath at the temperature of 42 ℃ for 90s, adding 600 mu L of LB culture medium, carrying out shake culture in an incubator at the temperature of 37 ℃ for 1h, taking 200 mu L of transformation liquid, smearing the transformation liquid on an LB solid culture medium (containing 100 mu g/mL Amp), and carrying out standing culture at the temperature of 37 ℃ for 12 h.

LB medium composition (1L): 5g of yeast extract, 10g of tryptone and 10g of NaCl, adding water to dissolve the yeast extract, adjusting the pH value to 7.0, and fixing the volume. After agar (12g/L) was added to the solid medium, the medium was autoclaved.

1.3.3 recombinant Positive clone identification

After culturing at 37 ℃ for 12 hours, 12 single clones were randomly selected in 200. mu.L of LB medium and cultured with shaking at 37 ℃ for 4 hours. Colony PCR was performed using M13F/R as a primer and bacterial solution as a template. The system is as follows:

and (3) amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 60s, for 32 cycles; extending for 10min at 72 ℃;

the colony PCR is followed by agarose gel electrophoresis, and positive clones of appropriate size are sequenced by Boshang Biotechnology Limited. And (3) positive cloning and bacterium storage: mu.L of the bacterial liquid 930 is added with 70 mu.L of DMSO, and the mixture is uniformly mixed and stored at-80 ℃.

Example 2 Gene protein expression and enzyme Activity function analysis

2.1 construction of prokaryotic expression vector of target Gene

According to sequence information of target genes PaF6OMT and pET32a vectors, a proper restriction enzyme cutting site is selected to design primers PaF6OMT-pET32a-F and PaF6OMT-pET32a-R of a prokaryotic expression vector:

PaF6OMT-pET32a-F:CGGGATCCATGGCCCCAGAGGTTTTGTC；(SEQ ID No.5)

PaF6OMT-pET32a-R:CCCTCGAGCTACTTAAGAGTTGAAATGA；(SEQ ID No.6)

the pMD19T-PaF6OMT plasmid is used as a template, the ORF of the plasmid is amplified by using the primers, a PCR product is electrophoresed and gel is recovered, the vector pET32a and gel recovery fragments are subjected to enzyme digestion by using BamH I and Xho I, and the enzyme digestion system is as follows:

the digestion was carried out in a 37 ℃ water bath for 3 h. The enzyme digestion product is added with 10 Xloading buffer to terminate the reaction, then agarose gel electrophoresis is carried out, and a proper band is selected for gel recovery, wherein the gel recovery method is the same as the above.

2.1.1 connection

The cleaved target fragment was ligated with the cleaved vector pET32a (available from Novagen) using T4 DNA Ligase (available from Takara) in the following manner:

the above components were mixed well and ligated overnight at 16 ℃.

2.1.2 transformation

The ligation product was transformed into E.coli DH5 α competent in the same manner as above.

2.1.3 recombinant Positive clone identification

The colony was verified to be positive by PCR using PaF6OMT-pET32a-F/R as primer, and the verification method was as above.

And selecting positive clones with the target size, sending the positive clones to a Boshang biotechnology limited company for sequencing, simultaneously carrying out amplification culture and plasmid extraction, and carrying out enzyme digestion verification. If a band of the same size as the target fragment can be excised, the clone is confirmed to be positive. At this point, the vector construction is complete.

After the construction is finished, PaF6OMT-pET32a plasmid is extracted by shaking bacteria for standby.

2.1.4 transformation

The constructed prokaryotic expression vector plasmid heat shock method is used for transforming escherichia coli BL21(DE3) competent cells, and the transformation, screening and identification methods are the same as the above.

2.2 prokaryotic expression of recombinant protein

2.2.1 Induction purification of recombinant proteins

(1) PaF6OMT-pET32a-BL21 positive clones were picked and inoculated in 4mL of medium (containing Amp resistance) and shake-cultured overnight at 37 ℃.

(2) Inoculating the bacterial liquid into 100mL culture medium (containing Amp resistance) according to the ratio of 1:100, and performing shake culture at 37 ℃ until OD is reached₆₀₀0.4-0.6. Protein expression was induced by adding 100. mu.L of 1M IPTG and culturing at 18 ℃ for 18h on a 110rpm shaker.

(3) The bacterial liquid is collected by a 50mL centrifuge tube, centrifuged at 5000rpm for 5min, and the supernatant is discarded.

(4) Binding buffer resuspends the bacteria, centrifuges at 5000rpm for 5min, and then discards the supernatant. After washing twice, 20mLBinding buffer was added to resuspend the cells.

(5) The cells were sonicated, centrifuged at 12,000rpm at 4 ℃ for 20min, and the supernatant was collected and purified by column chromatography.

(6) Eluting the hybrid protein by adding 10mL Binding buffer, then adding 4mL 1:1 mixed solution of the Binding buffer and the Elutionbuffer for elution, and collecting the eluent. And (4) placing the eluent in an ultrafiltration tube for liquid change and concentration.

(7) The concentrate was pipetted into a10 mL collection tube, the protein concentration was determined, and the sample was electrophoresed.

(8) Adding 20% glycerol into protein, and storing in refrigerator at-80 deg.C.

Binding buffer, 2.42g Tris-HCl, 29.22g NaCl and 0.34g imidazole were weighed respectively, dissolved in water to obtain 1000mL solution, sterilized, added with 70. mu.L β -mercaptoethanol, and stored at 4 ℃.

Elution buffer weighing 2.42g Tris-HCl, 29.22g NaCl, 34g imidazole, dissolving in water, diluting to 1000mL volume, sterilizing, adding 70 μ L β -mercaptoethanol, and storing at 4 deg.C.

2.2.2 protein SDS-PAGE electrophoresis

The expression, separation and purification of the target protein were detected by denaturing Polyacrylamide Gel Electrophoresis (SDS-PAGE).

(1) And assembling the electrophoresis device, and fixing the glass plate on the rubber frame.

(2) Preparing 12% separation gel, adding into an electrophoresis apparatus, adding water, sealing, and standing until the separation gel is solidified.

(3) 5% concentrated glue is prepared, and the upper water layer is poured off. The prepared 5% concentrated glue is poured into the glass plate immediately after being mixed evenly, the hole comb is inserted between the glass plates (the generation of air bubbles is avoided), and the comb is pulled out after the gel is solidified.

(4) Adding appropriate amount of loading buffer into the protein supernatant and the purified protein, boiling in boiling water for 5min, centrifuging at 13,000rpm for 10min, collecting 20 μ L of supernatant, and simultaneously absorbing 3 μ L of protein Marker for sample application.

(5) And adding a proper amount of electrophoresis buffer solution into the electrophoresis tank, carrying out electrophoresis at a constant voltage of 90V, changing the electrophoresis to 160V constant voltage electrophoresis when the sample is electrophoresed to the separation gel, and stopping electrophoresis until the bromophenol blue reaches the lower edge of the gel.

(6) Taking off the protein gel, soaking and dyeing in Coomassie brilliant blue R-250 dyeing solution, and dyeing for 2h at room temperature with gentle shaking.

(7) And (3) washing off the dyeing liquid on the surface of the protein adhesive by using distilled water, washing for 2-3 times, then placing in a decoloring liquid for decoloring for 2 hours, and replacing the decoloring liquid for several times in the decoloring process until the background of the protein adhesive is washed clean.

(8) The results were observed, stored photographically and analyzed, and the results of protein electrophoresis are shown in FIG. 2.

2.3 in vitro enzyme Activity function identification of proteins

2.3.1 optimal substrate screening of proteins

PaF6OMT is used for in vitro enzyme activity function identification and protein optimum substrate screening. The substrate includes scutellarein, baicalein, quercetin, luteolin, eriodictyol, aesculetin, caffeoyl-CoA, cafestol, caffeic aldehyde, caffeic acid, 5-OH ferulic acid, 5-OH coniferyl alcohol, and catechol. The enzyme activity reaction system is as follows:

water bath at 37 ℃, enzyme activity reaction for 30min, and adding equal volume of acetonitrile to stop the reaction. The enzyme activity reaction analysis was performed by HPLC using the enzyme activity reaction of empty carrier protein pET32a as a control.

2.3.2 analysis of enzyme Activity products

To verify the in vitro enzymatic activity of PaF6OMT, HPLC was used to detect the products of the enzymatic activity reactions described above. The assay used an Eclipse XD-C18, 5 μm, 4.6X 150mm (Agilent) column with detection wavelengths of 254nm,280nm,320nm and 346nm at a flow rate of 1.0 mL/min. The liquid phase analysis conditions were as follows:

liquid phase analysis Condition 1

Liquid phase analysis Condition 2

Liquid phase analysis Condition 3

The liquid phase analysis condition 1 is used for detecting scutellarein and baicalein, and the identification result is shown in figure 3; the liquid phase analysis condition 2 is used for detecting quercetin, luteolin and eriodictyol; the liquid phase analysis condition 3 is used for detecting aesculetin, caffeoyl coenzyme A, cafestol, cafaldehyde, caffeic acid, 5-OH ferulic acid, 5-OH coniferyl alcohol and catechol. The results of the enzyme activity reaction analysis are shown in Table 1.

Table 1:

^aActivities presented are nmol·(mg·min)-1±STDEV.

^bno product detected.

2.3.3 optimum temperature measurement

Baicalein is selected as a substrate, and the influence of temperature on the in vitro enzyme activity of PaF6OMT protein is measured. The optimum temperature was measured in Tris-HCl buffer (pH7.5), with a reaction time of 30min, and a temperature gradient of 25 deg.C, 30 deg.C, 35 deg.C, 37 deg.C, 40 deg.C, 45 deg.C, and 50 deg.C. The measurement results are shown in FIG. 4.

2.3.4 determination of kinetic parameters of the enzyme

The enzymatic kinetic analysis of PaF6OMT was carried out in Tris-HCl (pH 7.5) buffer at 37 ℃ with substrate concentrations of 10, 20, 40, 50, 80, 100, 150 and 200. mu.M, respectively. The reaction was started at the time of enzyme addition, reacted for 5min, and stopped by adding an equal volume of acetonitrile, and experiments were performed in parallel for 3 times. The results are shown in Table 2.

Table 2:

example 3, PaF6 enzymatic Synthesis of hispidulin and oroxylin AA by OMT

In an in vitro enzyme activity function identification experiment, the PaF6OMT protein has high methylation selectivity on 6-OH of baicalein and scutellarein, single reaction product and high substrate conversion rate, and can be used for synthesizing oroxylin AA and hispidulin by an enzyme method.

3.1 Effect of protein amount on substrate conversion

To investigate the effect of protein amount on substrate conversion, we set a protein amount gradient of 1-14. mu.g in Tris-HCl (pH 7.5) buffer at 37 ℃ for 1 h. The enzyme activity system is the same as above, wherein SAM and MgCI₂The amount of (c) added increases in proportion to the increase in the amount of protein. The results of the effect of protein amount on substrate conversion are shown in FIG. 5A.

3.2 Effect of reaction time on substrate conversion

In Tris-HCl (pH 7.5) buffer, the amount of immobilized protein was 6. mu.g at 37 ℃ and different time gradients were set for 5min, 10min, 20min, 30min, 45min, 60min, 90min, 2h, 2.5h, 3h and 4h for reaction to examine the effect of reaction time on substrate conversion, and the results are shown in FIG. 5B.

Example 4 Gene subcellular localization

4.1 construction of GFP targeting vector

Primers PaF6OMT-GFPF and PaF6OMT-GFPR were designed based on the target gene PaF6 OMT:

PaF6OMT-GFPF:CGGGATCCATGGCCCCAGAGGTTTTGTC；(SEQ ID No.7)

PaF6OMT-GFPR:GGGGTACC CTTAAGAGTTGAAATGACAA；(SEQ ID No.8)

using PaF6OMT-pET32a plasmid as a template, amplifying ORF (removing terminator), carrying out electrophoresis on PCR products and recovering, carrying out enzyme digestion on the vector p35S-1301-GFP and the recovered fragment by using BamH I and Kpn I, wherein the enzyme digestion system is as follows:

the digestion was carried out in a 37 ℃ water bath for 3 h. The enzyme-digested product was subjected to agarose gel electrophoresis and a suitable band was selected for gel recovery, the gel recovery method being as above.

4.1.1 ligation of the cleavage products, methods described above

4.1.2 ligation transformation and identification of Positive clones, the procedure is as above

After the construction is finished, shake bacteria to extract the plasmid PaF6OMT-p35S-1301-GFP, and transform agrobacterium for later use.

4.2 Freeze-thawing method for transformation of Agrobacterium

(1) Taking out the agrobacterium tumefaciens competent cell EHA105, thawing on ice, respectively adding 2 mu L of plasmid PaF6OMT-p35S-1301-GFP and empty vector p35S-1301-GFP, gently blowing and uniformly mixing by using a pipette, and placing on ice for 25 min;

(2) quickly freezing for 60s with liquid nitrogen, and placing in water bath at 37 deg.C for 3 min;

(3) adding 400 mu L of non-resistance YEP liquid culture medium, and performing shake culture at 30 ℃ for 4 h;

(4) 200 μ L of the bacterial suspension was applied to YEP solid medium (containing 50mg/mL Kan, 100mg/mL Rif). Standing and culturing for 36h at 30 ℃;

(5) and selecting a single clone to carry out small-amount shaking culture, identifying the positive of the single clone by colony PCR, and taking the positive clone to store the bacteria for later use.

YEP medium composition (1L): 10g of yeast extract, 10g of tryptone and 5g of NaCl, adding water for dissolving and fixing the volume. After agar (12g/L) was added to the solid medium, the medium was autoclaved.

4.3 Agrobacterium transient transformation method for transforming tobacco epidermal cells

(1) PaF6OMT-p35S-1301-GFP-EHA105, p35S-1301-GF-EHA105P and the suppressor protein silent p19 were scratched, cultured at 30 ℃ for 36 hours, and then the single colony was inoculated into 2mL YEP liquid culture medium (containing 50mg/mL Kan, 100mg/mL Rif) and cultured with shaking at 30 ℃ for 12 hours.

(2) And (3) mixing the bacterial liquid according to the proportion of 1:100 was inoculated into 10mL YEP liquid medium (containing 50mg/mL Kan, 100mg/mL Rif) and shaken to OD₆₀₀In the range of 0.4-0.6.

(3) Collecting bacteria, centrifuging at 4000rpm for 20min, and discarding the supernatant; the tobacco transformation solution was washed 1 time, centrifuged, and the supernatant was discarded.

(4) The cells were resuspended in a small volume of transformation medium and OD 600. apprxeq.1.0 was adjusted.

(5) PaF6OMT-p35S-1301-GFP-EHA105, p35S-1301-GFP-EHA105 and p19 were mixed at a ratio of 1:1, and then the mixture was activated at 25 ℃ and 110rpm for 2 hours.

(6) Agrobacterium was infiltrated into the hypodermal cells of tobacco leaves using a 1mL syringe.

(7) After 36h, the leaves infiltrated by Agrobacterium were examined for fluorescence signals of the lower epidermal cells on a confocal laser microscope (argon excitation at 488nm was set, the emission wavelength of GFP signal was 495-570nm, and the emission wavelength of chloroplast was 650-760nm), and the results are shown in FIG. 6.

Tobacco transformation liquid: MES-KOH (pH 5.6), Na₃PO₄2mM, glucose 0.5% (v/v), acetosyringone 100 μ L.

Although the embodiments of the present invention have been described with reference to the accompanying drawings, it is not intended to limit the scope of the present invention, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive efforts by those skilled in the art based on the technical solution of the present invention.

Claims (10)

1. The amino acid sequence of the creosote hexa-position hydroxyl-oxygen methyltransferase is shown as SEQ ID No. 1.

2. The gene encoding the six-position hydroxyoxymethy transferase of clathrin according to claim 1.

3. The encoding gene of claim 2, wherein the nucleotide sequence is the nucleotide sequence shown in SEQ ID No. 2.

4. An expression vector comprising the coding gene of claim 2 or 3.

5. The expression vector of claim 4, wherein the expression vector is a recombinant prokaryotic expression vector.

6. The expression vector of claim 5, wherein the recombinant prokaryotic expression vector is: the coding gene of claim 2 or 3 was inserted into expression vector pET32 a.

7. A recombinant cell or transformant comprising the expression vector of claim 4, 5 or 6.

8. Use of the bergenia dulcis-makino hexa-hydroxyoxymethyatransferase of claim 1 for synthesizing oroxylin a and/or hispidulin.

9. The use of the bergenia dulcis-makino hexa-hydroxyoxymethyltransferase of claim 1 for catalyzing baicalein to synthesize oroxylin a.

10. The use of the six-position hydroxyoxymethyltransferase of bergenin according to claim 1 for catalyzing scutellarein to synthesize hispidulin.

Images