CN114652741B

CN114652741B - Composition and preparation for inhibiting HPV and application of composition and preparation

Info

Publication number: CN114652741B
Application number: CN202210059538.4A
Authority: CN
Inventors: 张磊; 陆可望; 魏洁; 朱玲; 周磊
Original assignee: Kunming Yeshui Biotechnology Co ltd
Current assignee: Kunming Yeshui Biotechnology Co ltd
Priority date: 2022-01-19
Filing date: 2022-01-19
Publication date: 2023-08-25
Anticipated expiration: 2042-01-19
Also published as: CN114652741A

Abstract

The application discloses a composition for inhibiting HPV, a preparation and application thereof, wherein the active ingredient in the composition is a cationic polymer, and the cationic polymer is a quaternized polysaccharide or/and a quaternized acrylamide copolymer. The composition can effectively inhibit the activity of HPV, can continuously act on a lesion part, has almost no stimulation and toxic or side effect on the lesion part, has high activity utilization rate and obvious treatment effect, has a low preparation process and low material cost, can be matched with other conventional treatment strategies for use, can be used for treating HPV infection and preventing cervical or other tissue lesions caused by the HPV infection, and provides a new way for clinically treating the HPV infection and preventing the HPV infection.

Description

Composition and preparation for inhibiting HPV and application of composition and preparation

Technical Field

The application relates to the technical field of medicines, in particular to a composition and a preparation for inhibiting HPV and application thereof.

Background

Human papillomaviruses (human papillomavirus, HPV) are a group of small, non-enveloped DNA viruses belonging to the family papillomaviridae that infect human skin and mucosal epithelial tissue, inducing wart and even benign and malignant tumors. More than 100 HPV virus subtypes have been identified and separated, and HPV is divided into two major groups, namely a mesophilic group and a transmucosal group according to the infection sites. The mucosa-philic group is divided into (1) high-risk type HPV which induces malignant hyperplasia of epithelial tissue according to benign and malignant differences of lesions induced after infection, and the high-risk type HPV infection is closely related to cervical cancer and precancerous lesions; (2) low risk type inducing benign hyperplasia of epithelial tissue, wherein low risk type HPV infection is closely related to the occurrence of genital warts and cervical low grade squamous hyperplasia lesions of more than 90%.

Cervical cancer is the second most common malignancy in women, except breast cancer, the first malignancy in the genital tract, and in recent years, with popularization of propaganda, more and more people begin to know that cervical cancer is related to a virus called HPV (human papillomavirus). Persistent infection with HPV means a higher risk of cervical cancer. In 1974, harald Zur Hausen proposed the hypothesis that HPV is associated with cervical cancer onset; in 1977, laverty observed the presence of HPV particles in cervical cancer biopsied tissue in electron microscopy; keerti Shah in 1989 confirmed that cervical cancer has a direct relationship with HPV infection; in 1995, the international cancer research association considered persistent infection with high-risk HPV as the main causative agent of cervical cancer. Hausen shares the 2008 nobel physiology or medical prize with two other scientists due to the discovery that Human Papillomavirus (HPV) causes cervical cancer. Of the 100 HPV subtypes found at present, more than 35 types of genital organs can infect human beings, about 30 types of HPV subtypes are related to tumors, wherein low-risk types are not directly related to cervical cancer, and can cause verruca vulgaris, condyloma acuminatum, papilloma on mucous membranes and the like, such as type 6, type 11 and the like; the high risk type is directly related to cervical cancer occurrence, such as type 16, type 18, type 45, etc.

Today, the treatment of HPV is mainly achieved by HPV therapeutic vaccines, which are mostly rationally designed for the antigen E6/E7, aimed at activating cell-mediated immune responses. HPV therapeutic vaccines are used to treat or prevent exacerbation of disease by re-eliciting specific T-cell mediated immune responses in an organism transformed from the HPV virus infection. However, due to the problems of effectiveness and safety, the therapeutic vaccine needs to be further researched and verified, and meanwhile, the preparation process of the therapeutic vaccine is complex, the cost is high, and the therapeutic vaccine is difficult to be widely applied to the population in developing countries.

Disclosure of Invention

The application aims at: aiming at the problems, a composition, a preparation and application thereof for inhibiting HPV are provided, and the composition and the preparation are used for treating HPV infection and preventing cervical or other tissue lesions caused by HPV infection, thereby providing a new way for clinically treating HPV infection and preventing HPV infection.

The technical scheme adopted by the application is as follows: a composition for inhibiting HPV, wherein the active ingredient of the composition is a cationic polymer, the cationic polymer being a quaternized polysaccharide or/and a quaternized acrylamide copolymer.

In the present application, the inventors have found for the first time that the cationic polymer has an HPV inhibitory effect and can be used for treating or preventing HPV infection, and the cationic polymer can effectively inhibit the splitting function of viruses through its own charge activity, so that the viruses lose reproductive capacity. The inventor finds that the cationic polymer has lower charge activity compared with the cationic bactericide used as the disinfectant when verifying the drug effect of the cationic polymer, and the cationic polymer has lower activity, and can form gel state with stronger adhesiveness after being matched with the cationic polymer to absorb water, so that the cationic polymer can continuously act on a lesion site, the lower activity is beneficial to reducing the irritation and other side effects on the lesion site, the utilization rate can be effectively reduced due to the fact that the cationic polymer acts on other non-target objects (such as various bacteria) can be effectively avoided, and the aim of inhibiting HPV for a long time is fulfilled.

Compared with the strong cationic bactericide which inhibits the virus growth by the electric charge property, the strong cationic bactericide has no adhesiveness and is difficult to form a long-acting action area at the lesion because the lesion is positioned in the female genital tract, and if the administration form is adjusted to be gel state, the gel carrier is required to be matched, the adhesiveness of the gel carrier, the influence of the gel carrier on the activity of the strong cationic bactericide and the side effect of the gel carrier on the female genital tract are also considered, and the cationic polymer can directly form gel after absorbing water, has strong adhesiveness, has no irritation and toxic side effect on the female genital tract and shows obvious technical advantages in administration. Secondly, because the strong cationic bactericide has high activity, the inhibition effect on HPV is better than that of the application when the strong cationic bactericide acts on a lesion site, but the toxicity on normal cells is high; the cationic polymer has the advantages of short acting time and low drug effect utilization rate, simultaneously can inhibit the growth of bacteria while inhibiting HPV, and damages the microbial balance in female genital tracts, and has strong side effects.

Further, the quaternary aminated polysaccharide is chlorinated-2-hydroxy-3- (trimethylamino) propyl polyethylene oxide cellulose ether or/and cationic guar gum. Further, the quaternized acrylamide copolymer is an N, N-trimethyl-2- (2-methyl-1-oxo-2-propenyloxy) ethylammonium chloride-acrylamide copolymer. The conventional use of these substances is as a thickener with good thickening effect in liquids, whereas in the present application the application is used for inhibiting HPV and thus for the treatment and prevention of HPV infections.

Further, the mass ratio of the active ingredient in the composition is 0.01 to 100%, preferably 0.01 to 30%, more preferably 0.01 to 20%, still more preferably 0.1 to 2.0%.

Further, when purified water is contained in the composition, the mass ratio of the active ingredient in the composition is 0.01 to 30%.

The application also comprises a preparation for inhibiting HPV, which comprises an active ingredient and medical acceptable auxiliary materials, wherein the active ingredient is the composition, and the medical acceptable auxiliary materials generally refer to excipients and additives used in the process of producing medicines or preparing prescriptions, can be matched and selected according to auxiliary materials listed in Chinese pharmacopoeia, and belong to conventional technical means in the technical field and are not repeated. The composition is mixed with auxiliary materials and then prepared into paste, gel, suppository, powder or tablet, preferably into gel, and can be prepared into other preparations, and for the powder and tablet, the solid physical form of the composition is generally used, which is favorable for the storage and transportation process of medicines. Of course, the preparation of the application can be used together with other therapeutic factors, for example, a proper amount of cationic bactericides such as PHMG, PHMB and the like can be added into the preparation of the application to strengthen the curative effect of primary administration and improve the effect of primary treatment.

In the application, the composition has better charge performance under acidic or weak acid conditions, and has poorer activity performance if the pH value is higher, so that the effect of inhibiting HPV is difficult to achieve, and the pH value of the preparation is preferably not more than 6.5 through test conclusion.

Further, when the preparation contains purified water, the composition is mixed with the purified water to prepare a paste, gel or suppository.

The preparation of the application is mainly used in anti-HPV virus medicaments, and the using method is as follows: directly smeared or coated or covered on the tissue lesion caused by HPV infection.

In summary, due to the adoption of the technical scheme, the beneficial effects of the application are as follows:

1. the inventor discovers that the cationic polymer has the effect of inhibiting HPV for the first time, can be used for treating or preventing HPV infection, and can effectively inhibit the splitting function of viruses through the charge activity of the cationic polymer so as to lose reproductive capacity;

2. the cationic polymer is prepared into a preparation, and the preparation can form gel state with strong adhesiveness after being matched with water absorption, has moderate combination activity, can continuously act on a lesion site, has almost no stimulation and toxic or side effect on the lesion site, has high activity utilization rate, and can achieve the aim of inhibiting HPV for a long time;

3. the preparation provided by the application can be effectively adhered to a lesion site, has long acting time and obvious treatment effect, has the advantages of no complex preparation process and low material cost, can be matched with other conventional treatment strategies for use, for example, can be matched with therapeutic vaccines, chemotherapy, radiation, biological agents and other immune treatment methods for use, improves the treatment effect of HPV, and provides a new way for clinically treating HPV infection and preventing HPV infection.

Detailed Description

The present application will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present application more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the application.

Example 1

The liquid product is prepared from the following raw materials in percentage by weight: the chlorinated-2-hydroxy-3- (trimethylamino) propyl polyethylene oxide cellulose ether is 0.5%, and the purified water is the balance.

Preparation: (1) mixing the above materials according to the mass ratio;

(2) pre-dissolving chlorinated-2-hydroxy-3- (trimethylamino) propyl polyethylene oxide cellulose ether in purified water to obtain a homogeneous solution;

(3) packaging in a proper container with a filling machine to obtain the final product.

Example 2

The following table 1 lists the raw materials of 8 formulas and the mass ratios thereof, and the raw materials of each formula are respectively taken according to the mass ratios.

Table 1 raw materials of formulation 1-formulation 8 and mass percent (%) ratio

S1: chlorinated-2-hydroxy-3- (trimethylamino) propyl polyethylene oxide cellulose ether; s2: cationic guar gum; s3: n, N, N-trimethyl-2- (2-methyl-1-oxo-2-propenyloxy) ethyl ammonium chloride-acrylamide copolymer.

1. HPV Gene inhibition assay

1. Test material and instrument

1) Experimental group cells: siHa (HPV 16 positive cervical carcinoma cells)

Control cells: haCaT (human immortalized epidermal cells) was used as a control to test the ability of the formulation to kill cells.

2) Test sample: formulation 1-formulation 8

3) Cell culture fluid: DMEM culture solution containing 10% fetal calf serum

4) PBS phosphate buffer, pancreatin

5) 12-hole cell culture plate

2. Experimental instrument

1) Cell incubator

2) qPCR instrument (conventional real-time fluorescent quantitative PCR detection method (qRT-PCR) detection method)

3) Phase contrast microscope

4) RNA extraction reagent

5) Reverse transcription kit

6) Primer and sequence:

E6（F: CAGCAATACAACAAACCG，R：GCAACAAGACATACATCG）

E7（F: CAGAGGAGGAGGATGAAATAG，R：AGGTCTTCCAAAGTACGAATG），β-actin（F：CCATCGTCCACCGCAAAT, R：GCTGTCACCTTCACCGTTCC）

3. method of

1) Well-grown SiHa and HaCaT cells are plated, and the final volume of each hole is 1mL; 2 groups (1 blank group and 1 experiment group) were set for each cell, 3 duplicate wells were set for each group, and dosing treatment was performed when cell confluency reached 80%. Adding the formula 1 to the formula 8 and 10uL into the experimental group cells respectively, and culturing for 48 hours;

2) Observing the growth conditions of SiHa and HaCaT cells after the formula 1-formula 8 are added by a microscope; then SiHa cells are collected, total RNA is extracted, and cDNA is reversely transcribed;

3) qPCR detection of changes in HPV 16E 6/E7 mRNA expression in SiHa cells under the action of formulas 1-8.

4. Results

1) The effect of formulation 1-8 addition to SiHa and HaCaT cells on cell growth showed that: the results show that after the cells are added in the formula 1-formula 8, the cells grow well, and the cells of the blank control group and the test group have no obvious difference.

2) The effect on HPV 16E 6/E7 mRNA expression in SiHa cell lines is shown in Table 1 (2 ^–ΔΔCT Value):

TABLE 2 Gene expression Change

5. Conclusion(s)

The formulas 1-8 have downregulation effect on the mRNA expression of HPV 16E 6/E7 genes in SiHa cells, the concentrations of 3 cationic polymers are respectively 0.1% and 0.5%, the overall inhibition effect on the mRNA expression of the E6/E7 genes is approximate, and the inhibition effect of the formulas 6 and 8 is relatively good.

As can be seen from Table 2, the inhibition effect of the 3 cationic polymers on the mRNA expression of the E6/E7 gene was increased with the concentration, and the better the inhibition effect was.

2. Gel formulation adhesion test

1. Test materials

1) Chlorinated-2-hydroxy-3- (trimethylamino) propyl polyethylene oxide cellulose ether; (S1)

2) Cationic guar gum; (S2)

3) N, N, N-trimethyl-2- (2-methyl-1-oxo-2-propenyloxy) ethyl ammonium chloride-acrylamide copolymer; (S3)

4) Hydroxypropyl methylcellulose;

5) A standard slide;

6) Pig large intestine.

2. Method of

1) Preparing the polymers of the items 1 to 4 into 3 percent of hydrogel respectively;

2) The pig large intestine inner membrane is outwards stretched on a glass slide, and 4 pieces are prepared;

3) Respectively dripping 0.5 g of 4 different gels at the rightmost end of 4 glass slides stretched with pig large intestines;

4) The slide was tilted at 45 ° and the results were observed after 6 hours.

3. Results

Hydroxypropyl methylcellulose gel had slipped down to the bottom of the slide; the remaining S1, S2, S3 gels are also located approximately 1/3 of the way from the bottom of the slide. The adhesive force of the gel of S1, S2 and S3 on the mucous membrane is superior to that of hydroxypropyl methyl cellulose, and the adhesive effect is good.

The foregoing description of the preferred embodiments of the application is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the application.

Claims

1. Use of a composition for inhibiting HPV in the preparation of an anti-HPV medicament, characterized in that the active ingredient of the composition is a cationic polymer, the cationic polymer being a quaternary aminated polysaccharide, the quaternary aminated polysaccharide being a chlorinated-2-hydroxy-3- (trimethylamino) propylpolyethylene oxide cellulose ether or/and cationic guar gum, the quaternary aminated acrylamide copolymer being an N, N-trimethyl-2- (2-methyl-1-oxo-2-propenyloxy) ethylammonium chloride-acrylamide copolymer.

2. The use according to claim 1, wherein the mass fraction of active ingredient in the composition is 0.01-100%.

3. The use according to claim 1, wherein the mass fraction of active ingredient in the composition is 0.01-30% when purified water is contained in said composition.

4. Use of a formulation for inhibiting HPV in the manufacture of an anti-HPV medicament, characterized in that the formulation comprises an active principle and a pharmaceutically acceptable adjuvant, the active principle being a composition according to any one of the preceding claims 1-3, the composition being formulated as a paste, gel, suppository, powder or tablet after mixing with the adjuvant.

5. The use according to claim 4, wherein the pH of the formulation is not greater than 6.5.

6. The use according to claim 4, wherein when the formulation contains purified water, the composition is mixed with purified water to prepare a paste, gel or suppository.

7. The use according to claim 4, wherein the formulation is for painting or coating or covering a tissue lesion caused by HPV infection.