CN113430148A

CN113430148A - Fermentation medium of animal bifidobacterium and application thereof

Info

Publication number: CN113430148A
Application number: CN202110874589.8A
Authority: CN
Inventors: 刘金钊; 张天萌; 朱倩倩; 张由恒; 余济源; 李红红; 郭学平
Original assignee: Bloomage Biotech Co Ltd; Shandong Bloomage Hyinc Biopharm Co Ltd
Current assignee: Bloomage Biotech Co Ltd; Shandong Bloomage Hyinc Biopharm Co Ltd
Priority date: 2021-07-30
Filing date: 2021-07-30
Publication date: 2021-09-24
Also published as: CN113789286A

Abstract

The invention discloses a fermentation medium of animal bifidobacterium and application thereof. The fermentation medium comprises malt extract and calcium chloride. The fermentation filtrate obtained by fermenting the fermentation medium has obvious barrier repair effect, compared with a blank control without the product, the moisture content of the horny layer of the skin is improved by 9-10%, the transdermal water dispersion loss is reduced by 5%, and the obtained fermentation filtrate has good stability, can be applied to the field of cosmetics and is used for research and development of skin barrier repair products.

Description

Fermentation medium of animal bifidobacterium and application thereof

Technical Field

The invention relates to the technical field of biological fermentation, in particular to a fermentation medium for bifidobacterium animalis and application thereof.

Background

Probiotics generally refer to microorganisms that have beneficial effects on humans and animals. The study of probiotic function of probiotics has been extended to various aspects of health outside the intestine and is the focus of current basic research. The application of the skin care cream in life is visible everywhere, and comprises the fields of food industry, medicine and skin care.

About one billion microorganisms are colonized on human skin per square centimeter, and the microorganisms prevent the skin colonization of a patient by secreting antibacterial peptide or free fatty acid, thereby protecting the health of the skin.

At present, functional characteristics of probiotics are researched more mature at home and abroad, the known exact efficacy and potential efficacy are more than ten, and the barrier repair efficacy of the probiotics is also researched in a related way. Gueniche et al investigated the effect of probiotics (Bifidobacterium longum) on sensitive skin. In vitro experiments show that the calcitonin gene-related peptide which is released by neurons and induced by capsaicin is remarkably inhibited by co-incubation of nerve cells and lysate of bifidobacterium longum. In clinical application, the bifidobacterium longum extract (10%) is applied 2 times a day for 2 months, and the skin sensitivity is obviously reduced. Researchers speculate that bifidobacterium longum may reduce skin sensitivity by reducing neuronal reactivity. Another study by this research team found that oral supplementation with probiotics (lactobacillus paracasei) reduced skin sensitivity in sensitive skin patients and promoted the repair of skin barrier function. At present, the barrier repair effect of probiotics is widely applied to the fields of food, medicine and cosmetics.

Patent CN106520603B discloses a method for screening probiotics with function of enhancing intestinal tract cell tight junction at cell level, which comprises the steps of firstly treating cells with digested gliadin, adding a certain amount of probiotics after washing off residual digested gliadin, incubating for a certain time, and then washing off to determine the ability of probiotics to improve cell tight junction damaged by digested gliadin. The in vitro experimental model reflects the actual repair effect of probiotics on the intestinal epithelial injury caused by gliadin, and the obtained result accords with the repair capacity of probiotics on the damage of intestinal barriers formed in the intestinal tract, so that a more convenient and accurate detection method is provided for determining whether the probiotics and other microorganisms enhance the tight connection of intestinal cells at the cell level.

Patent application CN105163747A discloses a composition comprising probiotic bacteria capable of restoring the barrier effect of the stomach lost during medication of gastric hyperacidity and minimizing the side effects due to said medication.

The patent application CN111265468A discloses a skin double-barrier repair composition and an application thereof, the skin double-barrier repair composition simulates prebiotics, probiotics and microbial metabolites in skin microbial components through mutual matching of a yeast fermentation product filtrate, an oat fermentation filtrate and a skin-like lipid complex, and effectively stabilizes and balances skin microbial barriers; the skin lipid complex and the oat kernel oil mainly repair a brick wall structure of the skin and improve the composition of stratum corneum lipid so as to achieve the aim of repairing a physical barrier of the skin, and the skin microbial barrier and the physical barrier (stratum corneum) of the skin are repaired simultaneously through the mutual matching of the two barrier repairing components, so that the skin is helped to reestablish the complete stratum corneum of the structure and establish a healthy and good microbial colony ecosphere, and the skin with the damaged barrier is promoted to recover the healthy and active state.

Patent application CN108403502A discloses a composition for improving skin stress and promoting probiotic balance and a forming method thereof, which comprises Artemisia annua leaf extract, lactobacillus and eriodictyon officinalis fermentation product extract, alpha-glucose oligosaccharide, carnosine and 1, 2-pentanediol; wherein the concentration of the artemisia annua leaf extract is 5% -80%; the concentration of the lactobacillus and the eriodictyon officinalis fermentation product extract is between 5 and 80 percent; the concentration of the carnosine is 5-80%.

In summary, the barrier repair probiotic products in the current market mainly have the following disadvantages:

1. the stability of the fermentation filtrate obtained by fermentation is poor;

2. the barrier repair probiotics are mainly applied to the fields of food and medicine, and the field of cosmetics is less;

3. probiotics applied to the cosmetic field lack effective efficacy data, and the efficacy before and after use is not compared;

disclosure of Invention

In order to solve the problems, the invention provides a fermentation culture medium of animal bifidobacterium and application thereof, and a fermentation filtrate obtained by fermenting the fermentation culture medium has obvious barrier repair effect, can be widely applied to the field of cosmetics and is used for research and development of skin barrier repair products.

The specific technical scheme of the invention is as follows:

1. a fermentation medium of Bifidobacterium animalis, wherein the fermentation medium comprises the following components: malt extract and calcium chloride.

2. The fermentation medium according to item 1, wherein the concentration of the malt extract is 0.1 to 0.9g/L, preferably 0.2 to 0.8g/L, and more preferably 0.5 g/L; the concentration of the calcium chloride is 0.02-0.50g/L, preferably 0.05-0.35g/L, and more preferably 0.2 g/L.

3. The fermentation medium of any one of claims 1-2, wherein the fermentation medium further comprises the following concentrations of the respective components: the carbon source is 1.00-11.00g/L, preferably 2.00-9.00 g/L; the nitrogen source is 2.5-14.5g/L, preferably 3.5-12.5 g/L; 2.0-16.3g/L of inorganic salt, preferably 3.2-14.3 g/L; 0.20-2.10ml/L of surfactant, preferably 0.30-1.75ml/L and 0.10-1.50g/L of antioxidant, preferably 0.20-1.20 g/L;

preferably, the carbon source is glucose;

the nitrogen source is 1.50-8.00g/L tryptone and 1.00-6.50g/L yeast powder, preferably 2.00-7.00g/L tryptone and 1.50-5.50g/L yeast powder;

the inorganic salt is 0.60-4.50g/L of anhydrous sodium acetate, 0.60-4.50g/L of diammonium hydrogen citrate, 0.05-2.15g/L of magnesium sulfate heptahydrate, 0.05-1.15g/L of manganese sulfate monohydrate and 0.70-4.00g/L of dipotassium hydrogen phosphate trihydrate, preferably 1.00-4.00g/L of anhydrous sodium acetate, 1.00-4.00g/L of diammonium hydrogen citrate, 0.10-1.80g/L of magnesium sulfate heptahydrate, 0.10-0.75g/L of manganese sulfate monohydrate and 1.00-3.75g/L of dipotassium hydrogen phosphate trihydrate;

the surfactant is Tween 80, and

the antioxidant is L-cysteine hydrochloride.

4. Use of the fermentation medium of any one of items 1-3 in the fermentation of bifidobacterium animalis.

5. The use according to item 4, wherein the Bifidobacterium animalis is Bifidobacterium animalis (CCFM 1160) with deposit number GDMCC No. 61500.

6. Use according to any one of claims 4 to 5, the fermentation process comprising the steps of:

inoculating animal bifidobacterium into a seed culture medium for culture to obtain a seed solution;

inoculating the seed liquid into the fermentation culture medium for fermentation to obtain fermentation liquid;

and centrifuging and filtering the fermentation liquor to obtain the bifidobacterium animalis fermentation filtrate.

7. The use according to item 6, wherein the seed liquid is inoculated in an amount of 1.0 to 5.0% (v/v).

8. Use according to claim 6 or 7, wherein the fermentation temperature is between 30 and 40 ℃, preferably between 33 and 38 ℃; preferably, the fermentation time is 15-45h, preferably 22-40 h.

9. Use according to any one of claims 6 to 8, wherein the fermentation pressure is between 0.01 and 0.05 MPa.

10. Use according to any one of claims 6 to 9, wherein the OD in the fermentation broth₆₀₀From 2.0 to 5.0, preferably from 2.5 to 4.5; preferably, the pH of the fermentation broth is 4 to 6, preferably 4.3 to 4.9; preferably, the concentration of residual sugar in the fermentation liquor is 0-1.0 g/L.

11. Use according to any one of claims 6 to 10, wherein the OD of the seed liquid₆₀₀Is 2.5 or more, preferably 2.5 to 4.5.

12. The use according to any one of items 6 to 11, wherein, in the step of obtaining the seed solution, the method comprises inoculating the bifidobacterium animalis into a seed culture medium to culture for 10 to 28 hours to obtain a primary seed solution, and then inoculating the primary seed solution into the seed culture medium to culture to obtain the seed solution.

13. The use of claim 12, wherein the primary seed fluid is inoculated in an amount of 1.0-5.0% (v/v).

14. The use according to any one of claims 6-13, wherein the seed medium is modified MRS medium.

ADVANTAGEOUS EFFECTS OF INVENTION

The fermentation filtrate obtained by fermenting the animal bifidobacterium fermentation medium has obvious barrier repair effect, compared with a blank control without the product, the moisture content of the horny layer of the skin is improved by 9-10%, the transdermal water dispersion loss is reduced by 5%, and the obtained fermentation filtrate has good stability, can be applied to the field of cosmetics and is used for researching and developing skin barrier repair products.

Drawings

FIG. 1 is a schematic diagram of the patch test in Experimental example 3.

FIG. 2-1 is a graph showing the effect of using the fermentation filtrate described in example 2-1 on the water content of the stratum corneum of skin in Experimental example 4.

FIG. 2-2 is a graph showing the effect of using the fermentation filtrate described in example 2-1 on the amount of percutaneous water loss in Experimental example 4.

FIGS. 2-3 are graphs showing the effect of using the fermentation filtrate described in example 2-1 on skin erythema a values in Experimental example 4.

FIG. 3 is a graph showing the stability studies of the fermentation filtrates according to example 2-1 and comparative example 2 in Experimental example 5, wherein a is a graph showing the fermentation filtrate obtained in comparative example 2, b is a graph showing the fermentation filtrate obtained in comparative example 2 being left at 40 ℃ for 4 months, c is a graph showing the fermentation filtrate obtained in example 2-1, and d is a graph showing the fermentation filtrate obtained in example 2-1 being left at 40 ℃ for 4 months.

Information on the preservation of the strains

The strain Bifidobacterium animalis (CCFM 1160) used by the invention is preserved in Guangdong province microorganism culture collection (GDMCC) at 2 month and 4 days 2021, the preservation number is GDMCC NO:61500, the preservation address is as follows: guangzhou city, first furious Zhonglu No. 100 large yard No. 59 building No. 5, zip code: 510070, telephone: 020-8713763337656629.

Detailed Description

The present invention is described in detail in the following description of embodiments with reference to the figures, in which like numbers represent like features throughout the figures. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention may be embodied in various forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. As one skilled in the art will appreciate, various names may be used to refer to a component. This specification and claims do not intend to distinguish between components that differ in name but not function. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, however, the description is given for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.

The invention provides a fermentation medium of animal bifidobacterium, which comprises the following components: malt extract and calcium chloride.

The malt extract is a natural food completely derived from grains, contains rich maltose, fructose, glucose, protein, micromolecular peptide, amino acid and various vitamins and mineral substances which are necessary for human bodies, and also contains beta-glucan and tocopherol which have the health care function, the malt extract is prepared by taking selected high-quality barley (barley) as a raw material, crushing and performing enzymolysis to prepare wort, filtering and vacuum concentrating to prepare a liquid malt extract, and the liquid malt extract is subjected to belt type vacuum drying and crushing to obtain a solid malt extract.

In one embodiment, the concentration of the malt extract is 0.1 to 0.9g/L, preferably 0.2 to 0.8g/L, and more preferably 0.5 g/L; the concentration of the calcium chloride is 0.02-0.50g/L, preferably 0.05-0.35g/L, and more preferably 0.2 g/L.

For example, the malt extract may be at a concentration of 0.1g/L, 0.2g/L, 0.3g/L, 0.4g/L, 0.5g/L, 0.6g/L, 0.7g/L, 0.8g/L, 0.9g/L, etc.;

the concentration of calcium chloride may be 0.02g/L, 0.05g/L, 0.1g/L, 0.15g/L, 0.2g/L, 0.25g/L, 0.3g/L, 0.35g/L, 0.5g/L, and the like.

In one embodiment, the fermentation medium further comprises the following concentrations of the components: the fermentation medium also comprises the following components in concentration: 1.00-11.00g/L carbon source, preferably 2.00-9.00g/L nitrogen source, 2.5-14.5g/L nitrogen source, preferably 3.5-12.5g/L inorganic salt, 2.0-16.3g/L inorganic salt, preferably 3.2-14.3g/L surfactant, 0.20-2.10ml/L surfactant, preferably 0.30-1.75ml/L antioxidant, and 0.10-1.50g/L antioxidant, preferably 0.20-1.20 g/L;

preferably, the carbon source is glucose,

the nitrogen source is 1.50-8.00g/L tryptone and 1.00-6.50g/L yeast powder, preferably 2.00-7.00g/L tryptone and 1.50-5.50g/L yeast powder,

the inorganic salt is 0.60-4.50g/L of anhydrous sodium acetate, 0.60-4.50g/L of diammonium hydrogen citrate, 0.05-2.15g/L of magnesium sulfate heptahydrate, 0.05-1.15g/L of manganese sulfate monohydrate and 0.70-4.00g/L of dipotassium hydrogen phosphate trihydrate, preferably 1.00-4.00g/L of anhydrous sodium acetate, 1.00-4.00g/L of diammonium hydrogen citrate, 0.10-1.80g/L of magnesium sulfate heptahydrate, 0.10-0.75g/L of manganese sulfate monohydrate and 1.00-3.75g/L of dipotassium hydrogen phosphate trihydrate,

tween 80 as surfactant and L-cysteine hydrochloride as antioxidant

The fermentation medium is used, so that the obtained fermentation liquor is relatively stable, and the fermentation medium can be applied to the field of cosmetics.

The invention provides an application of the fermentation medium in bifidobacterium animalis fermentation.

In one embodiment, the Bifidobacterium animalis is Bifidobacterium animalis (Bifidobacterium animalis) CCFM1160 deposited with GDMCC No. 61500.

In one embodiment, the fermentation process comprises the steps of:

The seed culture medium refers to mycelium for spore germination, growth and mass propagation, and the mycelium grows stout to become a 'seed' with strong activity.

In one embodiment, the seed liquid is inoculated in an amount of 1.0 to 5.0% (v/v).

The inoculation amount refers to the ratio of the volume of the seed solution transferred to the volume of the culture solution after inoculation. For example, the amount of the seed solution to be inoculated may be 1.0% (v/v), 1.5% (v/v), 2.0% (v/v), 2.5% (v/v), 3.0% (v/v), 3.5% (v/v), 4.0% (v/v), 4.5% (v/v), 5.0% (v/v), or the like.

In one embodiment, the fermentation temperature is 30-40 ℃, preferably 33-38 ℃, and the fermentation time is 15-45 hours, preferably 22-40 hours.

For example, the fermentation temperature may be 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃, 35 ℃, 36 ℃, 37 ℃, 38 ℃, 39 ℃, 40 ℃ or the like;

the fermentation time can be 15h, 22h, 25h, 30h, 35h, 40h, 45h and the like.

In one embodiment, the fermentation pressure is from 0.01 to 0.05 MPa.

The fermentation pressure in the context of the present invention refers to the pressure in the fermentation vessel, for example in a fermenter when the fermentation is carried out using the fermenter.

The fermentation pressure may be, for example, 0.01MPa, 0.02MPa, 0.03MPa, 0.04MPa, 0.05MPa or the like.

In one embodiment, OD in the fermentation broth₆₀₀From 2.0 to 5.0, preferably from 2.5 to 4.5; preferably, the pH of the fermentation broth is 4.0-6.0, preferably 4.3-4.9; preferably, the residual sugar concentration of the fermentation broth is 0-1.0 g/L. At the moment, the animal bifidobacterium is fully fermented, the nutrient substances in the culture medium are basically exhausted, and the obtained product has more remarkable efficacy.

For example, OD in fermentation broth₆₀₀Can be 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, etc.;

the pH of the fermentation broth can be 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, etc.;

the residual sugar concentration of the fermentation liquor can be 0.1g/L, 0.2g/L, 0.5g/L, 0.8g/L, 1.0g/L and the like.

In one embodiment, the OD of the seed liquid₆₀₀Is 2.5 or more, preferably 2.5 to 4.5.

At the moment, the seed liquid is in the late logarithmic phase, the activity is vigorous, and the subsequent inoculation amount can be ensured.

In one embodiment, in the step of obtaining the seed solution, it comprises inoculating the bifidobacterium animalis into a seed culture medium to culture for 10-28h to obtain a primary seed solution, and then inoculating the primary seed solution into the seed culture medium to culture to obtain the seed solution.

Specifically, the method comprises the steps of inoculating a single strain of bifidobacterium animalis into a seed culture medium for culture, preferably culturing at 33-38 ℃ for 10-28h to obtain a primary seed solution, then inoculating the obtained primary seed solution into a fresh seed culture medium for culture, preferably culturing at 33-38 ℃ for 10-28h to obtain the seed solution.

In one embodiment, the primary seed fluid is inoculated in an amount of 1.0 to 5.0% (v/v).

For example, the amount of the first-stage seed solution to be inoculated may be 1.0% (v/v), 1.5% (v/v), 2.0% (v/v), 2.5% (v/v), 3.0% (v/v), 3.5% (v/v), 4.0% (v/v), 4.5% (v/v), 5.0% (v/v), or the like.

In one embodiment, the seed medium is a modified MRS medium, preferably the modified MRS medium is an MRS culture containing L-cysteine hydrochloride, e.g. an MRS medium containing L-cysteine hydrochloride comprising the following concentrations of components: 20.00g/L glucose, 10.00g/L tryptone, 5.00g/L yeast powder, 2.00g/L anhydrous sodium acetate, 2.00g/L diammonium hydrogen citrate, 0.58g/L magnesium sulfate heptahydrate, 0.25g/L manganese sulfate monohydrate, 801.00 ml/L Tween, 2.60g/L dipotassium hydrogen phosphate trihydrate and 0.50 g/L-cysteine hydrochloride

In one embodiment, the bifidobacterium animalis fermentation filtrate comprises: protein, sugar, amino acid, acetic acid, lactic acid, vitamin B6, vitamin PP and folic acid.

In one embodiment, the protein concentration is 69.00-150.00mg/L, the sugar concentration is 1.40-2.50g/L, the amino acid concentration is 1.30-2.10g/L, the acetic acid concentration is 2.50-3.70g/L, the lactic acid concentration is 0.10-0.24g/L, the vitamin B6 concentration is 0.70-1.30mg/L, the vitamin PP concentration is 2.80-3.85mg/L and the folic acid concentration is 19.50-36.50. mu.g/L.

The animal bifidobacterium fermentation filtrate obtained by fermentation of the fermentation medium has obvious barrier repair effect, and compared with a blank control group without the product, the moisture content of the horny layer of the skin is improved by 9-10%, and the transdermal water dispersion loss is reduced by 5%. Can be applied to the field of cosmetics and is used for researching and developing skin barrier repair products.

The method for sterilizing the seed culture medium is well known to those skilled in the art, and for example, various components (peptone, yeast powder, magnesium sulfate heptahydrate, manganese sulfate monohydrate, tween 80, diammonium hydrogen citrate, dipotassium hydrogen phosphate trihydrate and the like) of the seed culture medium are added into water to be dissolved and adjusted to have a pH of 6.2 to 6.4, subpackaged, prepared into mother liquor according to a certain concentration by glucose, independently subpackaged, sterilized at 115 to 121 ℃ for 15 to 25min, cooled and added into the culture medium according to a corresponding proportion.

In one embodiment, the fermentation medium is sterilized before inoculating the seed solution to the fermentation medium, and the sterilization method is well known to those skilled in the art, for example, various components of the fermentation medium (glucose is weighed separately, sterilized in a sterilizer at 115-121 ℃ for 15-25 min, and added to the fermentation tank before inoculation) are added to the fermentation tank, the temperature is raised to 30-40 ℃, and stirring is started to fully dissolve the medium. Then introducing steam for sterilization, wherein the sterilization condition of the culture medium is about 115 ℃, and sterilizing for 20 min.

In one embodiment, the resulting fermentation broth is subjected to centrifugation, filtration, and the centrifugation and filtration processes are known to those skilled in the art and can be selected as desired.

In one embodiment, when performing subsequent experiments, such as barrier repair efficacy experiments, the obtained bifidobacterium animalis fermentation filtrate may be added with a preservative for performing the experiments.

The preservative may be, for example, a combination of butylene glycol, pentylene glycol and ethylhexylglycerin, preferably, butylene glycol is 2.00 to 7.00%, pentylene glycol is 2.00 to 6.50%, and ethylhexylglycerin is 0.05 to 0.25% in mass percentage in the finally obtained product.

The fermentation culture medium can ensure that the obtained fermentation filtrate is relatively stable and can be used in the field of cosmetics, and in addition, the obtained fermentation filtrate has a good repairing effect on barrier damage.

The invention provides application of the bifidobacterium animalis fermentation filtrate prepared by the method in the field of cosmetics.

The invention provides a cosmetic composition which comprises the bifidobacterium animalis fermentation filtrate prepared by the method.

In one embodiment, the composition further comprises an adjuvant.

The adjuvant is well known to those skilled in the art for use in the cosmetic field, and for example, the adjuvant may be 1, 3-butylene glycol, pentylene glycol, ethylhexylglycerin, potassium sorbate, sodium benzoate, etc.

The invention provides an animal bifidobacterium fermentation filtrate which comprises protein, sugar, amino acid, acetic acid, lactic acid, vitamin B6, vitamin PP and folic acid.

In one embodiment, the fermentation filtrate is prepared by the method described above.

Examples

The invention is described generally and/or specifically for the materials used in the tests and the test methods, in the following examples,% means wt%, i.e. percent by weight, unless otherwise specified. The reagents or instruments used are not indicated by manufacturers, and are all conventional reagent products which can be obtained commercially.

EXAMPLE 1-1 preparation of fermentation Medium

The carbon source is glucose 4.20g/L,

0.5g/L of malt extract, 0.2g/L of calcium chloride,

the nitrogen source is tryptone and yeast powder, the tryptone is 3.50g/L, the yeast powder is 2.90g/L,

the inorganic salt is anhydrous sodium acetate, diammonium hydrogen citrate, magnesium sulfate heptahydrate, manganese sulfate monohydrate and dipotassium hydrogen phosphate trihydrate, wherein the anhydrous sodium acetate is 2.00g/L, the diammonium hydrogen citrate is 1.80g/L, the magnesium sulfate heptahydrate is 0.55g/L, the manganese sulfate monohydrate is 0.25g/L, and the dipotassium hydrogen phosphate trihydrate is 2.50g/L,

the surfactant is Tween 800.90 ml/L,

the antioxidant is L-cysteine hydrochloride 0.60g/L,

weighing culture medium according to the above formula (glucose is weighed separately, and is placed into a sterilizing pot for sterilization at 118 deg.C for 15min, and is added into a fermentation tank before inoculation), adding into the fermentation tank, adjusting pH to 6.8 with phosphoric acid/sodium hydroxide solution, heating to 30 deg.C, and stirring to dissolve culture medium completely. Then introducing steam for sterilization, wherein the sterilization condition of the culture medium is about 115 ℃, and sterilizing for 20 min.

EXAMPLE 1-2 preparation of fermentation Medium

The carbon source is glucose 2.00g/L,

0.5g/L of malt extract, 0.2g/L of calcium chloride,

the nitrogen source is tryptone and yeast powder, the tryptone is 2.00g/L, the yeast powder is 1.50g/L,

the inorganic salt is anhydrous sodium acetate, diammonium hydrogen citrate, magnesium sulfate heptahydrate, manganese sulfate monohydrate and dipotassium hydrogen phosphate trihydrate, wherein the anhydrous sodium acetate is 1.00g/L, the diammonium hydrogen citrate is 1.00g/L, the magnesium sulfate heptahydrate is 0.10g/L, the manganese sulfate monohydrate is 0.10g/L, the dipotassium hydrogen phosphate trihydrate is 1.00g/L,

the surfactant is Tween 800.30 ml/L,

the antioxidant was L-cysteine hydrochloride of 0.20g/L, and the sterilization method was the same as in example 1-1.

Examples 1-3 preparation of fermentation Medium

The carbon source is glucose 9.00g/L,

0.5g/L of malt extract, 0.2g/L of calcium chloride,

the nitrogen source is tryptone and yeast powder, the tryptone is 7.00g/L, the yeast powder is 5.50g/L,

the inorganic salt is anhydrous sodium acetate, diammonium hydrogen citrate, magnesium sulfate heptahydrate, manganese sulfate monohydrate and dipotassium hydrogen phosphate trihydrate, wherein the anhydrous sodium acetate is 4.00g/L, the diammonium hydrogen citrate is 4.00g/L, the magnesium sulfate heptahydrate is 1.80g/L, the manganese sulfate monohydrate is 0.75g/L, and the dipotassium hydrogen phosphate trihydrate is 3.75g/L,

the surfactant is Tween 801.75 ml/L,

the antioxidant was L-cysteine hydrochloride 1.20g/L, and the sterilization method was the same as in example 1-1.

Examples 1-4 preparation of fermentation Medium

The carbon source is glucose 4.20g/L,

0.2g/L of malt extract, 0.2g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

the antioxidant was L-cysteine hydrochloride of 0.60g/L, and the sterilization method was the same as in example 1-1.

Examples 1 to 5

The carbon source is glucose 4.20g/L,

0.8g/L of malt extract, 0.2g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

Examples 1-6 preparation of fermentation Medium

The carbon source is glucose 4.20g/L,

0.5g/L of malt extract, 0.05g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

Examples 1-7 preparation of fermentation Medium

The carbon source is glucose 4.20g/L,

0.5g/L of malt extract, 0.35g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

Examples 1-8 preparation of fermentation Medium

The carbon source is glucose 12.00g/L,

0.5g/L of malt extract, 0.2g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

Examples 1-9 preparation of fermentation Medium

The carbon source is 1g/L of glucose,

0.5g/L of malt extract, 0.2g/L of calcium chloride,

the surfactant is Tween 800.90 ml/L,

Comparative example 1 preparation of fermentation Medium

The carbon source is glucose 4.20g/L,

the surfactant is Tween 800.90 ml/L,

TABLE 1 proportion table of the components of the fermentation media in examples 1-1 to 1-9 and comparative example 1

	Glucose g/L	Tryptone g/L	Yeast extract powder g/L	Malt extract g/L	Calcium chloride g/L
						Examples 1 to 1	4.20	3.5	2.9	0.5	0.2
Examples 1 to 2	2.00	2	1.5	0.5	0.2
						Examples 1 to 3	9.00	7	5.5	0.5	0.2
Examples 1 to 4	4.20	3.5	2.9	0.2	0.2
						Examples 1 to 5	4.20	3.5	2.9	0.8	0.2
Examples 1 to 6	4.20	3.5	2.9	0.5	0.05
						Examples 1 to 7	4.20	3.5	2.9	0.5	0.35
Examples 1 to 8	12	3.5	2.9	0.5	0.2
						Examples 1 to 9	1	3.5	2.9	0.5	0.2
Comparative example 1	4.20	3.5	2.9	/	/

Example 2-1 preparation of bifidobacterium animalis fermentation filtrate:

1. seed liquid culture:

(1) the seed liquid culture medium comprises the following formula: 20.00g/L glucose, 10.00g/L tryptone, 5.00g/L yeast powder, 2.00g/L anhydrous sodium acetate, 2.00g/L diammonium hydrogen citrate, 0.58g/L magnesium sulfate heptahydrate, 0.25g/L manganese sulfate monohydrate, 801.00 ml/L Tween, 2.60g/L dipotassium hydrogen phosphate trihydrate and 0.50 g/L-cysteine hydrochloride.

(2) And (3) sterilization: adding peptone, yeast powder, magnesium sulfate heptahydrate, manganese sulfate monohydrate, tween 80, diammonium hydrogen citrate, dipotassium hydrogen phosphate trihydrate and the like into purified water according to a seed liquid culture medium formula to adjust the pH value to be 6.2, subpackaging, preparing a mother solution by glucose according to a certain concentration, independently subpackaging, sterilizing at 115 ℃ for 20min, cooling, and adding the glucose into a culture medium according to a corresponding proportion.

(3) Culturing: inoculating Bifidobacterium animalis strain CCFM1160 in seed culture medium in a super clean bench, standing at 37 deg.C in anaerobic culture box for 28 hr to obtain first-stage seed, inoculating the first-stage seed in 2.0% inoculum size in fresh seed culture medium, standing at 37 deg.C in anaerobic culture box for 28 hr, and culturing OD₆₀₀And reaching 3.8 to obtain seed liquid.

2. Fermentation culture:

(1) inoculation: collecting cultured Bifidobacterium animalis seed solution (OD)₆₀₀3.80) and inoculating into the fermentation medium of the embodiment 1-1, wherein the inoculation is carried out by inoculating sterilized glucose solution, inoculating the seed solution into the fermentation tank with the inoculation amount of 1.5% (v/v), closing the door and window, and keeping the air from flowing。

(2) Fermentation culture: after inoculation, setting the culture temperature at 36 ℃, the rotation speed of a fermentation tank at about 60rpm, introducing sterile nitrogen to keep the internal pressure of the tank at about 0.03MPa, setting a certain ventilation quantity to fully displace the air in the tank, and closing air inlet and exhaust. Culturing for 30h, until OD600 reaches 3.68, reducing pH to 3.86, reducing residual sugar to 0.24g/L, and ending fermentation to obtain fermentation liquid.

3. Centrifuging and filtering the fermentation liquor

(1) Preparing equipment and pipelines: adding alkaline water in advance to corresponding equipment, pipelines and the like such as a transfer skip car, a centrifuge, a transfer tank 1#, a transfer tank 2#, a buffer tank and the like for sterilization and cleaning.

(2) Centrifuging: after fermentation, opening a corresponding valve to pump fermentation liquor into a tubular centrifuge for centrifugation at a feed speed of 200L/h, respectively collecting supernatant and thalli, pumping the supernatant into a transfer tank 1# for filtration, and discarding the thalli after inactivation treatment.

(3) Leakage testing and plate paving: installing a filtering paper board with the aperture of 0.8 mu m on a plate-and-frame filter, testing leakage of purified water, normally maintaining the pressure at 0.13MPa, and paving the filter by uniformly mixing perlite with pure water after normal leakage testing.

(4) And (3) filtering: and opening an air inlet valve, increasing the pressure of the transfer tank 1# to about 0.05MPa, opening a corresponding valve, and filtering the fermentation liquor in the transfer tank 1# into the transfer tank 2# through a filter. The pressure of the transfer tank No. 1 is gradually increased according to the filtering speed. After the filtration is finished, directly adding diatomite into the transfer tank No. 2, starting stirring and uniformly mixing, and cleaning the transfer tank No. 1 with pure water. And (3) introducing air into the transfer tank 2# to increase the pressure, opening a corresponding valve, and filtering the fermentation liquor in the transfer tank 2# into the transfer tank 1# again. After the filtration, the pressure of the transit tank 1# was raised, and the clear fermentation liquid (in this case, pale yellow clear liquid) was filtered into a buffer tank through a filter.

4. Ingredients

Adding the preservative into the filtered liquid according to the following formula, and fully and uniformly stirring.

TABLE 2 antiseptic formulations table

Composition (I)	Butanediol	Pentanediol	Ethyl hexyl glycerol
				Amount (mass ratio w/w)	6.00％	4.50％	0.08％

The pH of the fermentation filtrate was adjusted with 6M sodium hydroxide solution to a final pH of about 4.90.

5. Sterilizing and filling

Cleaning the filled fermentation filtrate with a white barrel and a barrel cover, and placing in a disinfection room for ozone sterilization. The 0.22 μm filter cartridge was mounted on the filter and connected to the surge tank. And (3) boosting the pressure of the buffer tank to about 0.05MPa, opening a filling valve, filtering and sterilizing the fermentation filtrate by using a 0.22 mu m filter element, filling the fermentation filtrate into PP plastic barrels, and filling 20L of fermentation filtrate into each barrel. The filling process is carried out under a laminar flow hood of a D-level clean area to obtain the bifidobacterium animalis fermentation filtrate added with the preservative, wherein the protein content is measured by adopting a Coomassie brilliant blue method,

the content of the saccharides is measured by adopting a phenol-sulfuric acid method,

the amino acid content is determined by a Hitachi LA8080 ultra-high-speed full-automatic amino acid analyzer, the acetic acid content is determined by a high performance liquid chromatograph (Von eastern. high performance liquid chromatography is used for determining the content of lactic acid and acetic acid in white spirit [ J ]. brewing science, 2009(005):115-116.),

the content of lactic acid is measured by the method in GB 5009.157-2016,

the content of vitamin B6 is measured by a first Method of GB 5009.154-20161 st Method,

the determination of the content of the vitamin PP adopts a second Method of GB 5009.89-20162 nd Method,

the determination of the folic acid content adopts GB 5009.211-2014, and the protein content is 101.93mg/L, the carbohydrate content is 1.95g/L, the amino acid content is 1.97g/L, the acetic acid content is 3.60g/L, the lactic acid content is 0.20g/L, the vitamin B6 content is 1.21mg/L, the vitamin PP content is 3.77mg/L and the folic acid content is 35.80 mug/L.

Example 2-2 preparation of Bifidobacterium animalis fermentation filtrate

1. Seed liquid culture

The seed liquid medium formulation, sterilization and cultivation were the same as in example 1.

2. Fermentation culture:

(1) inoculation: collecting cultured Bifidobacterium animalis seed solution (OD)₆₀₀2.5) inoculating to the fermentation medium of the embodiment 1-2, inoculating the sterilized glucose solution, inoculating the seed solution into the fermentation tank with an inoculation amount of 1% (v/v), closing the door and window, and keeping the air from flowing.

(2) Fermentation culture: after inoculation, setting the culture temperature at 38 ℃, the rotation speed of the fermentation tank at about 60rpm, introducing sterile air to keep the internal pressure of the tank at about 0.01MPa, and closing air inlet and exhaust. Cultured for 20h, OD₆₀₀When the pH value reaches 2.54, the pH value is reduced to 4.8, the residual sugar is reduced to 0g/L, and fermentation is finished to obtain fermentation liquor.

3. The fermentation liquor centrifugation, filtration, blending and sterilization filling are the same as the example 1, and the obtained fermentation liquor is measured according to the method of the example 1, so that the protein content of 70.04mg/L, the carbohydrate content of 1.52g/L, the amino acid content of 1.41g/L, the acetic acid content of 2.59g/L, the lactic acid content of 0.11g/L, the vitamin B6 content of 0.74mg/L, the vitamin PP content of 2.87mg/L and the folic acid content of 20.09 mu g/L are obtained.

Example 2-3 preparation of Bifidobacterium animalis fermentation filtrate

1. Seed liquid culture

2. Fermentation culture:

(1) inoculation: collecting cultured Bifidobacterium animalis seed solution (OD)₆₀₀4.5) inoculating to the fermentation medium of the embodiment 1-3, inoculating the sterilized glucose solution, inoculating the seed solution to the fermentation tank with an inoculation amount of 5.0% (v/v), closing the door and window, and keeping the air from flowing.

(2) Fermentation culture: after inoculation, the culture temperature is set to be 33 ℃, the rotating speed of the fermentation tank is about 60rpm, sterile air is introduced to keep the internal pressure of the tank to be about 0.05MPa, and air inlet and exhaust are closed. Culturing for 40h, OD₆₀₀When the pH value reaches 4.02, the pH value is reduced to 4.42, the residual sugar is reduced to 0.96g/L, and fermentation is finished to obtain fermentation liquor.

3. The fermentation liquor centrifugation, filtration, batching and sterilization filling are the same as the example 1, and the obtained fermentation liquor is measured according to the method of the example 1, so that the protein content of 147.89mg/L, the carbohydrate content of 2.33g/L, the amino acid content of 1.84g/L, the acetic acid content of 3.12g/L, the lactic acid content of 0.16g/L, the vitamin B6 content of 0.98mg/L, the vitamin PP content of 3.05mg/L and the folic acid content of 21.70 mu g/L are obtained.

Example 2-4 preparation of Bifidobacterium animalis fermentation filtrate

Fermentation using the fermentation medium described in examples 1-4, the fermentation method and measurement of the resulting fermentation broth were carried out in accordance with the method of example 1, yielding a protein content of 83.76mg/L, a carbohydrate content of 1.87g/L, an amino acid content of 1.69g/L, an acetic acid content of 3.50g/L, a lactic acid content of 0.14g/L, a vitamin B6 content of 1.04mg/L, a vitamin PP content of 3.54mg/L and a folic acid content of 30.96. mu.g/L.

Example 2-5 preparation of Bifidobacterium animalis fermentation filtrate

The fermentation using the fermentation medium described in examples 1 to 5, the fermentation method and the measurement of the resulting fermentation broth were carried out in accordance with the method of example 1, and the protein content, the carbohydrate content, the amino acid content, the acetic acid content, the lactic acid content, the vitamin B6 content, the vitamin PP content, and the folic acid content were obtained at 88.06mg/L, 1.79g/L, 1.83g/L, 3.31g/L, 0.21g/L, 1.17mg/L, 3.65mg/L, and 32.77. mu.g/L, respectively.

Examples 2-6 preparation of Bifidobacterium animalis fermentation filtrates

Fermentation using the fermentation media described in examples 1-6, the fermentation method and measurement of the resulting fermentation broth were carried out in accordance with the method of example 1, yielding a protein content of 91.03mg/L, a carbohydrate content of 1.94g/L, an amino acid content of 1.72g/L, an acetic acid content of 3.26g/L, a lactic acid content of 0.19g/L, a vitamin B6 content of 1.09mg/L, a vitamin PP content of 3.21mg/L and a folic acid content of 33.16. mu.g/L.

Examples 2-7 preparation of Bifidobacterium animalis fermentation filtrates

Fermentation using the fermentation media described in examples 1-7, the fermentation method and measurement of the resulting fermentation broth were carried out in accordance with the method of example 1, yielding a protein content of 100.22mg/L, a carbohydrate content of 1.81g/L, an amino acid content of 1.98g/L, an acetic acid content of 3.42g/L, a lactic acid content of 0.20g/L, a vitamin B6 content of 1.12mg/L, a vitamin PP content of 3.63mg/L and a folic acid content of 34.05. mu.g/L.

Examples 2-8 preparation of Bifidobacterium animalis fermentation filtrates

The fermentation using the fermentation medium described in examples 1 to 8, the fermentation method and the measurement of the resulting fermentation broth were carried out in accordance with the method of example 1, and 95.02mg/L of protein, 2.30g/L of saccharide, 1.78g/L of amino acid, 3.01g/L of acetic acid, 0.13g/L of lactic acid, 0.75mg/L of vitamin B6, 2.89mg/L of vitamin PP and 20.53. mu.g/L of folic acid were obtained.

Examples 2-9 preparation of Bifidobacterium animalis fermentation filtrates

Fermentation using the fermentation media described in examples 1-9, the fermentation method and measurement of the resulting fermentation broth were carried out as described in example 1, yielding a bifidobacterium animalis fermentation filtrate, wherein the protein content was 68.39mg/L, the carbohydrate content was 0.65g/L, the amino acid content was 1.16g/L, the acetic acid content was 1.03g/L, the lactic acid content was 0.04g/L, the vitamin B6 content was < 0.60mg/L (minimum detection limit), the vitamin PP content was < 2.20mg/L (minimum detection limit) and the folic acid content was 2.10 μ g/L.

Comparative example 2 preparation of Bifidobacterium animalis fermentation filtrate

Fermentation Using the fermentation Medium described in comparative example 1, fermentation culture to OD₆₀₀3.68 is reached, the pH is reduced to 3.86, the residual sugar is reduced to 0.24g/L, the fermentation is finished, the fermentation liquor is centrifuged, filtered, mixed and sterilized, and the fermentation filtrate containing the preservative is obtained, and the obtained fermentation liquor is measured according to the method of the example 2-1 to obtain the protein content of 92.04mg/L, the carbohydrate content of 1.82g/L, the amino acid content of 1.59g/L, the acetic acid content of 2.76g/L, the lactic acid content of 0.15g/L, the vitamin B6 content of 0.85mg/L, the vitamin PP content of 3.56mg/L and the folic acid content of 26.08 mu g/L.

Experimental example 1MTT method to verify barrier repair efficacy (damage induced by SDS):

detecting the cell viability by an MTT method: after cell treatment, removing the culture medium, adding MTT working solution prepared by serum-free culture medium, incubating for 2-4 h at 37 ℃, removing the MTT working solution, adding 150 mu L DMSO into each hole, oscillating for 5min, detecting absorbance (OD value) at 570nm by using an enzyme labeling instrument, and calculating the cell survival rate according to a formula. The calculation formula is as follows:

cell viability ═ experimental-blank)/(negative or normal control-blank)

SDS model: after the HaCaT cells (chinese type culture collection) were inoculated in a 96-well plate and cultured for 24 hours, the cells were treated with a complete medium containing 50 μ M SDS for 24 hours, and the cells were cultured with a complete medium containing the preservative-added bifidobacterium animalis fermentation filtrate obtained in example 2-1 for 24 hours, and the cell survival rate was measured by the MTT method, and the results are shown in table 3.

TABLE 3 cell viability by MTT assay

Wherein, the blank control is pure culture medium.

From the above, it can be seen that, after the cells were continuously cultured in the complete medium of the fermentation filtrate of bifidobacterium animalis to which the preservative was added, the barrier damage caused by the SDS-treated cells was repaired.

Experimental example 2 detection of FLG, LOR, IVL, AQP3 related protein Gene expression

HaCaT cells were plated at 4.5X 10 per well⁶The individual cells were inoculated into 6-cm cell culture dishes and cultured for 24 hours, the cells were treated with the complete medium containing 50. mu.M SDS for 24 hours, and the complete medium containing the fermentation filtrate of Bifidobacterium animalis obtained in example 2-1 was replaced to continue the culture for 24 hours. After cell treatment, collecting cells, extracting total RNA, measuring RNA concentration, and storing in a refrigerator at-20 ℃ for later use after reverse transcription. And detecting the expression levels of FLG, LOR, IVL and AQP3 genes by using a Q-PCR method.

Wherein, the primer sequences of AQP3 are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2,

the nucleotide sequence of SEQ ID NO. 1 is:

AQP-3-F AGGTGGACCCAGAAGTGAGT

the nucleotide sequence of SEQ ID NO. 2 is:

AQP-3-R CCCCAGTCAAGGGTCATAGC

the primer sequences of LOR are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4,

the nucleotide sequence of SEQ ID NO. 3 is:

LOR-F TCTCAGCAGACCAGTCAGACCTC

the nucleotide sequence of SEQ ID NO. 4 is:

LOR-R CCTCCACAGCTACCACCTCCTC

the primer sequences of IVL are respectively shown as SEQ ID NO. 5 and SEQ ID NO.6,

the nucleotide sequence of SEQ ID NO. 5 is:

IVL-F CATAAGCCAGAACTGTACCTGA

the nucleotide sequence of SEQ ID NO.6 is:

IVL-R GATGCTGCTTCTCTTCCAATTG

the primer sequences of FLG are respectively shown as SEQ ID NO. 7 and SEQ ID NO. 8,

the nucleotide sequence of SEQ ID NO. 7 is:

FLG-F ATGTCCGCTCTCCTGGAAAG

the nucleotide sequence of SEQ ID NO. 8 is:

FLG-R TGGATTCTTCAAGACTGCCTGTA

the sequences of the reference genes are respectively shown as SEQ ID NO. 9 and SEQ ID NO. 10,

the nucleotide sequence of SEQ ID NO. 9 is:

Actin-F GTGACGTTGACATCCGTAAAGA

the nucleotide sequence of SEQ ID NO. 10 is:

Actin-R GCCGGACTCATCGTACTCC

RNA extraction step:

required reagents: trizol, chloroform (trichloromethane), isopropanol, 70% -75% ethanol (aqueous preparation without RNase), aqueous water without RNase (DEPC water), and the like.

And (3) experimental operation:

1) after cell treatment, the culture medium was discarded, cells were washed with PBS, 1mL of Trizol was added to each well, cells were repeatedly aspirated to cause cell detachment and lysis (or cells were scraped off with a cell scraper), cells were collected in an enzyme-free EP tube, labeled, and left at room temperature for 5 min.

2) 0.2mL of chloroform was added to each tube, the cap was closed, the tube was shaken vigorously for 15s, and then allowed to stand at room temperature for 5 min.

3) Centrifuging at 12000r at 4 deg.C for 10min, and separating the solution into three layers, including a red chloroform layer as the lower layer, a white DNA layer as the middle layer, and a colorless water phase as the upper layer, wherein the RNA is located in the colorless water phase.

4) The colorless aqueous phase was transferred to a new centrifuge tube, which was evacuated as far as possible without aspirating the lower layer of liquid.

5) Repeating the steps 2-4 once.

6) 0.5mL of isopropanol was added to the tube, mixed by gentle inversion, and allowed to stand at room temperature for 10 min.

7) The refrigerated centrifuge was centrifuged at 12000r at 4 ℃ for 10min, at which time white RNA precipitate appeared at the bottom of the tube.

8) The supernatant was removed, gently shaken by adding 1mL of 70% ethanol, and then centrifuged at 12000r at 4 ℃ for 5min in a refrigerated centrifuge, and the supernatant was discarded as much as possible.

9) And opening the cover of the centrifugal tube, inverting the centrifugal tube, opening a super clean bench fan, and airing for 20-30 min until the RNA becomes colorless and transparent.

10) Adding 20-40 mu L of RNase-free water, and blowing, sucking and dissolving.

11) The RNA concentration is measured by the Nanodrop, and the ratio of OD260/OD280 of the pure RNA is 1.85-1.98.

12) Reverse transcription or short-term storage at-20 deg.C, and long-term storage at-80 deg.C.

Reverse transcription of RNA: the detailed procedures were as described in the Novozam reverse transcription kit (model R323-01).

Q-PCR: the detailed procedures were performed in accordance with the Novozam fluorescent quantitative PCR kit (model q711-02), and the results are shown in Table 4.

Table 4 effect of fermentation filtrates as described in example 2-1 on FLG, LOR, IVL, AQP3 mRNA expression in HaCaT cells (± s, n ═ 3)

Group of	FLG	LOR	IVL	AQP3
					Normal control group	1.01±0.01	1.03±0.02	1.005±0.02	1.004±0.01
Positive control group	1.78±0.05^▲▲	2.07±0.06^▲▲	1.944±0.04^▲▲	1.84±0.01^▲▲
					5% of example 2-1	1.64±0.05^▲▲	1.8±1.83^▲▲	1.64±0.03^▲▲	2.26±0.05^▲▲
2.5% of example 2-1	1.72±0.04^▲▲	1.75±0.04^▲▲	1.71±0.02^▲▲	2.42±0.02^▲▲
					0.5% of example 2-1	1.41±0.06^▲▲	1.41±0.01^▲▲	1.26±0.02^▲▲	1.865±0.03^▲▲

Wherein, compared with a normal control group,^▲：P<0.05，^▲▲：P<0.01, normal control group: pure medium, positive control group: 1% of ceramide

As can be seen from the above table, in comparison with the normal control group, the relative expression amount of the HaCaT cells FLG, LOR, IVL and AQP3 mRNA cultured by adding the culture medium of the bifidobacterium animalis fermentation broth in example 2-1 is significantly increased under the same culture time, and the expression of four related moisturizing factors AQP3, LOR, IVL and FLG in the skin lesion tissue is one of the possible mechanisms for improving the skin lesion, which indicates that the fermentation filtrate described in example 2-1 can promote the expression of the HaCaT cell moisturizing related genes AQP3, LOR, IVL and FLG in the skin, and enhance the skin moisturizing ability and barrier function.

Experimental example 3 Patch experiment for human body

Patch test volunteers: the number of people is 54, the age is 20-41 years, and 50 females are 4 males;

the test substance: the fermentation filtrate obtained in example 2-1 was diluted to 10% with deionized water

Negative control: deionized water

Spot-pasting test process:

(1) the test site is normal skin on the flexed side of the forearm.

(2) The protective paper of the plaque tester (8mm Finn Chamber) was removed, and the prepared fermented supernatant of Bifidobacterium animalis was placed in an aluminum plaque tester. The amount of the spot test substance added was 0.02 ml.

(3) The spot tester with the spot test article is applied to the forearm of the subject, gently pressed with the palm to be uniformly applied to the skin, and the spot-applied portion is marked with a marking pen.

(4) Patch test time: for 48 hours.

(5) Observation time: 48 hours after application, the patch tester was removed first, and in order to avoid possible reactions caused by the patch tester pressing against the skin, the results were observed at least 30 minutes after the patch tester was removed, and the results are shown in FIG. 1.

As can be seen from FIG. 1, there was no adverse reaction on the skin, indicating that 10% of the Bifidobacterium animalis fermented filtrate described in example 2-1 was not harmful to human skin when applied externally.

Experimental example 4 human skin efficacy test

By adopting a half-face control method, essence (experimental group, the addition amount is 2.5%) added with the fermentation filtrate described in example 2-1 and blank essence (control group, the same content of distilled water is added) are respectively used for the left half face and the right half face, wherein the blank essence comprises butanediol, pentanediol, ethylhexyl glycerol, betaine, carbome 21, xanthan gum and water. The water content of stratum corneum, the amount of percutaneous water loss and the change of skin a value in the apple muscle area of the face of the subject were measured before and after use.

Healthy subjects 15, 30-55 years old, sensitive skin were recruited. The subjects measured the initial values of the moisture content of the horny layer, the amount of percutaneous moisture loss, and the skin a value in the left and right apple muscle areas 15 minutes after cleansing with a skin moisture tester CM 825(Courage + Khazaka, germany), a multi-probe skin test system MPA580(Courage + Khazaka, germany), and a visiac facial image analysis system (Canfield, usa), added the essence of the barrier repair product and the blank essence in equal amounts, once in the morning and at the evening, and measured all the indicators again 1 week, 2 weeks, and 3 weeks after the initial use, with the results shown in fig. 2-1 to fig. 2-3.

As can be seen from fig. 2-1, the initial moisture content value of the front stratum is set to 100% using. Compared with the control group, the moisture content of the stratum corneum of the skin is obviously improved (9-10% higher than that of the control group) after 2 weeks of using the essence containing the fermentation filtrate described in example 2-1.

As can be seen from FIGS. 2-2, the initial value of the transdermal water dispersion loss before use was set to 100%. Compared with the blank essence group, the essence containing the fermentation filtrate of the embodiment 2-1 is used, and the amount of percutaneous water dispersion is reduced by about 5% within 3 weeks, which shows that the fermentation filtrate can improve the skin barrier function.

The reddening of the skin in the erythema map of the facial photograph was analyzed by the value a in Lab, the higher the value a, the more red the skin, and as can be seen from FIGS. 2-3, the initial value of the value a before use was set to 100%, and the results showed that the serum containing the fermentation filtrate described in example 2-1 had no significant effect on the value a for a long period of time.

Experimental example 5 study of stability

The stability studies were carried out on the fermentation filtrates obtained in examples 2-1 to 2-9 and the fermentation filtrate obtained in comparative example 2, and the stability data are shown in Table 5, wherein the stability results of example 2-1 and comparative example 2 are shown in FIG. 3, wherein a is a schematic representation of the fermentation filtrate obtained in comparative example 2, b is a schematic representation of the fermentation filtrate obtained in comparative example 2 being left at 40 ℃ for 4 months, c is a schematic representation of the fermentation filtrate obtained in example 2-1, and d is a schematic representation of the fermentation filtrate obtained in example 2-1 being left at 40 ℃ for 4 months.

TABLE 5 comparison of the stability (absorbance at 470 nm) of the samples at 40 ℃ under the respective culture conditions

As can be seen from the above table, the absorbance of the fermentation filtrate of comparative example 2 was high at 470nm, and the increase in absorbance (OD) was significant after standing at 40 ℃ for 4 months₄₇₀Increased by 0.472); whereas the fermentation filtrates of examples 2-1 to 2-9 showed a lower absorbance at 470nm and showed only slight change in absorbance (OD) after standing at 40 ℃ for 4 months₄₇₀0.049 increase at the highest), still at a lower level. The color difference before and after optimization is also evident from the figure. Therefore, the fermentation filtrate of example 2-1 has better stability than the fermentation filtrate obtained in comparative example 2, thereby demonstrating that the fermentation filtrate of the present invention can be used in the cosmetic field.

In conclusion, the fermentation filtrate has good stability, can be used in the field of cosmetics, has a remarkable barrier repair effect, and has the advantages that the moisture content of the stratum corneum of the skin is improved by 9-10% and the transdermal water loss is reduced by 5% compared with a blank control group without the product. Can be applied to the field of cosmetics and is used for researching and developing skin barrier repair products.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> Huaxi Biotechnology Ltd

SHANDONG HUAXI HAIYU BIOLOGICAL MEDICINE Co.,Ltd.

<120> fermentation medium of animal bifidobacterium and application thereof

<130> TPE01642

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 1

aggtggaccc agaagtgagt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 2

ccccagtcaa gggtcatagc 20

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 3

tctcagcaga ccagtcagac ctc 23

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 4

cctccacagc taccacctcc tc 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 5

cataagccag aactgtacct ga 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 6

gatgctgctt ctcttccaat tg 22

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 7

atgtccgctc tcctggaaag 20

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 8

tggattcttc aagactgcct gta 23

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 9

gtgacgttga catccgtaaa ga 22

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> artificially synthesized

<400> 10

gccggactca tcgtactcc 19

Claims

2. The fermentation medium according to claim 1, wherein the concentration of the malt extract is 0.1-0.9g/L, preferably 0.2-0.8g/L, more preferably 0.5 g/L; the concentration of the calcium chloride is 0.02-0.50g/L, preferably 0.05-0.35g/L, and more preferably 0.2 g/L.

preferably, the carbon source is glucose;

the surfactant is Tween 80, and

the antioxidant is L-cysteine hydrochloride.

4. Use of a fermentation medium according to any one of claims 1 to 3 in the fermentation of Bifidobacterium animalis.

5. The use according to claim 4, wherein the Bifidobacterium animalis is Bifidobacterium animalis (CCFM 1160) with deposit number GDMCC No. 61500.

7. The use of claim 6, wherein the seed liquid is inoculated in an amount of 1.0-5.0% (v/v).

8. Use according to claim 6 or 7, wherein the fermentation temperature is 30-40 ℃, preferably 33-38 ℃; preferably, the fermentation time is 15-45h, preferably 22-40 h.

9. Use according to any one of claims 6 to 8, wherein the fermentation pressure is between 0.01 and 0.05 MPa;

preferably, OD in the fermentation broth₆₀₀From 2.0 to 5.0, preferably from 2.5 to 4.5;

preferably, the pH of the fermentation broth is 4 to 6, preferably 4.3 to 4.9;

preferably, the concentration of residual sugar in the fermentation liquor is 0-1.0 g/L;

preferably, the OD of the seed liquid₆₀₀Is 2.5 or more, preferably 2.5 to 4.5.

10. The use according to any one of claims 6 to 11, wherein in the step of obtaining the seed solution, the method comprises inoculating bifidobacterium animalis into a seed culture medium to culture for 10 to 28 hours to obtain a primary seed solution, and then inoculating the primary seed solution into the seed culture medium to culture to obtain the seed solution;

preferably, the inoculation amount of the primary seed liquid is 1.0-5.0% (v/v);

preferably, the seed culture medium is a modified MRS culture medium.