CN114634955B

CN114634955B - Method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof

Info

Publication number: CN114634955B
Application number: CN202210431124.XA
Authority: CN
Inventors: 祝俊; 徐飞; 王苓; 何宝亮; 李丹; 李斌; 陈剑; 余长泉
Original assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Nanjing Huaguan Biotechnology Co ltd; Jindawei Biotechnology Jiangsu Co ltd
Current assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Nanjing Huaguan Biotechnology Co ltd; Jindawei Biotechnology Jiangsu Co ltd
Priority date: 2022-04-22
Filing date: 2022-04-22
Publication date: 2023-07-18
Anticipated expiration: 2042-04-22
Also published as: CN114634955A

Abstract

The invention provides a method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof. The method for preparing the L-tertiary leucine by the biological enzyme catalysis comprises the following steps: 2-hydroxy-3, 3-dimethylbutyric acid is used as a substrate, and L-tertiary leucine is obtained by the reaction under the catalysis of 2-hydroxy acid dehydrogenase and leucine dehydrogenase. The invention adopts the precursor 2-hydroxy-3, 3-dimethylbutyric acid of trimethylpyruvic acid as a substrate, and uses the screened specific 2-hydroxy acid dehydrogenase to carry out coupling reaction with leucine dehydrogenase, thereby realizing the self-circulation of coenzyme NADH and saving the cost; after the generation of trimethylpyruvic acid, the trimethylpyruvic acid is converted into L-tertiary leucine by L-leucine dehydrogenase, and substrate inhibition does not exist. The method for preparing the L-tertiary leucine by the biological enzyme catalysis has the advantages of simplicity in operation, no need of adding extra NADH, high yield, low production cost and the like, is environment-friendly, safe, green and pollution-free, and has wide application prospect in industrial production.

Description

Method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof.

Background

Tertiary leucine is an unnatural amino acid, is a leucine derivative, has large steric hindrance and strong hydrophobicity, and is suitable for manufacturing medicaments, such as antiviral medicaments, for example, atazanavir serving as an anti-AIDS medicament, telaprevir serving as an anti-hepatitis C virus medicament and Paxlovid recently; the market demand for L-tert-leucine is increasing, and the existing synthesis methods of L-tert-leucine mainly comprise a resolution method, a chemical synthesis method and an enzyme catalytic synthesis method.

CN105399642a discloses a process for simultaneously preparing D-type tert-leucine and L-type tert-leucine, said process comprising the steps of: reacting n-butanol with 1, 1-dichloroethylene to obtain a product 3, 3-dimethylbutyric acid; adding a catalyst into 3, 3-dimethylbutyric acid, and simultaneously introducing air and chlorine gas to perform chlorination reaction to obtain 2-chloro-3, 3-dimethylbutyric acid; carrying out ammonolysis reaction on the obtained 2-chloro-3, 3-dimethylbutyric acid to obtain D-, L-tertiary leucine, carrying out acetylation and chloroacetylation on the obtained D-, L-tertiary leucine, and then carrying out resolution and other treatments by using L-thermostable amino acid acylase to obtain L-tertiary leucine and D-tertiary leucine respectively. However, the chemical synthesis method has low yield, toxic gas is needed to be used, the environment is polluted, and the process route is long.

CN102533888A discloses a method for preparing optical isomer by using enzyme to continuously split racemization of nitrogen-containing organic compound, the method uses N-phenylacetyl-DL-tert-leucine and inorganic base as raw materials, and uses aminoacylase reaction column to selectively hydrolyze N-phenylacetyl-L-tert-leucine under enzyme catalysis to produce L-tert-leucine and phenylacetic acid, after the reaction is finished, the reaction solution is subjected to acid regulation, acidification and suction filtration, the L-tert-leucine is purified from filtrate, unreacted N-phenylacetyl-D-tert-leucine is separated from filter residue, and N-phenylacetyl-D-tert-leucine is subjected to high temperature reflux racemization and then is put into resolution reaction, thus realizing continuous cyclic resolution of N-phenylacetyl-DL-tert-leucine, and preparing L-tert-leucine.

CN104561161a discloses a method and an enzyme for preparing chiral tert-leucine by asymmetric reduction catalyzed by marine enzyme, wherein the enzyme is a leucine dehydrogenase which is derived from alcanivorax diesel (Alcanivorax dieselolei). The method comprises the following steps: constructing engineering bacteria expressing the leucine dehydrogenase, culturing the engineering bacteria to prepare cell sap, and catalyzing asymmetric reductive amination of trimethylpyruvic acid by using the cell sap to obtain the chiral tertiary leucine.

The enzyme catalysis has the advantages of green and pollution-free property and high optical purity, and is mainly synthesized by using trimethylpyruvate enzyme, but the substrate and coenzyme account for the main part of the cost, and simultaneously, the substrate inhibition effect exists in the reaction process. Therefore, the method for preparing the L-tertiary leucine by catalyzing the biological enzyme for realizing the self-circulation of the coenzyme NADH and having no substrate inhibition has important application prospect.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention aims to provide a method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof. The invention adopts trimethyl pyruvic precursor 2-hydroxy-3, 3-dimethylbutyric acid as a substrate, and uses the screened specific 2-hydroxy acid dehydrogenase to carry out coupling reaction with leucine dehydrogenase, thereby realizing the self-circulation of coenzyme NADH without adding a coenzyme circulation system additionally; after trimethyl pyruvic acid is generated, the trimethyl pyruvic acid is reacted by L-leucine dehydrogenase and is converted into L-tertiary leucine, and no substrate inhibition effect is generated; the 2-hydroxy acid dehydrogenase is screened from lactobacillus and has wider substrate selectivity for alpha-hydroxybutyric acid. The method for preparing the L-tertiary leucine by the biological enzyme catalysis has the advantages of simplicity in operation, no need of adding extra NADH, high yield, low production cost and the like, is environment-friendly, safe, green and pollution-free, and has wide application prospect in industrial production.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method for preparing L-tertiary leucine by biological enzyme catalysis, wherein the method for preparing L-tertiary leucine by biological enzyme catalysis comprises the following steps:

2-hydroxy-3, 3-dimethylbutyric acid is used as a substrate, and L-tertiary leucine is obtained by the reaction under the catalysis of 2-hydroxy acid dehydrogenase and leucine dehydrogenase.

Preferably, the 2-hydroxy acid dehydrogenase includes D-2-hydroxy acid dehydrogenase and L-2-hydroxy acid dehydrogenase.

Preferably, the coding gene of the D-2-hydroxy acid dehydrogenase comprises a nucleotide sequence shown in SEQ ID NO. 1.

Preferably, the coding gene of the L-2-hydroxy acid dehydrogenase comprises a nucleotide sequence shown as SEQ ID NO. 2.

Preferably, the leucine dehydrogenase comprises an L-leucine dehydrogenase.

The invention takes 2-hydroxy-3, 3-dimethylbutyric acid as a substrate, and the L-tertiary leucine is obtained by the reaction under the catalysis of 2-hydroxy acid dehydrogenase and leucine dehydrogenase.

Preferably, the coding gene of the L-leucine dehydrogenase comprises a nucleotide sequence shown as SEQ ID NO. 3.

SEQ ID NO.1：

ATGAAGATCATCGCGTACGGCATTCGTGATGATGAACAGCCGTATCTGGAACAGTG GTCTAAAGACCAGGGTATCGAAGTTAAGGCGGTTAAAGAGCTGCTGGATGACTCCACCG TTGATCTGGCTAAGGGTTACGACGGCGCGGTGGTGTACCAGCAGAAACCGTACACCGCT TCCGTTCTGGATAAACTGGCGGCGAACGGTGTTACTAACCTGAGCCTGCGCAATGTTGG TGTCGACAACGTAGACGCGGACGCCGTGAAACGTAACGGTTTCAAGGTTACGAACGTA CCAGCATACAGCCCGGAAGCCATCGCGGAGTTCACCGTTACTGAACTGATGCGTCTGCT GCGCCGTACTCCAACCTTTGACCGCAAACAGGCGAACGGCGATCTGCGTTGGGCACCA GATATCGCGGATGAACTGAACAGCATGACCGTGGGCGTTGTAGCGACCGGTCGCATTGG TCGTGCGGCAATGAAAATCTACCAGGGCTTTGGCGCGAAAGTTATCGCATACGACGTGT TTCACAACCCAGAACTGGAAAAACAGGGCATCTACGTAGATACGATGGACGAACTGTAC GCACAGGCTGACGTAATCTCTCTGCATGCACCGGCAACTAAAGACAACGAAAAAATGAT CAATGATGACGCTTTTTCCAAAATGAAAGATGGTGTTTGGCTGCTGAACCCGGCACGTG GTGCACTGGTAGACACCGATGCACTGATCCGTGCGCTGGATTCTGGCAAAGTAGCAGGT GCGGCTCTGGACGTTTACGAAGACGAAGTGGGTATCTTCAACACCGACTTCGGTTCCTT CGACGCAATCCCGGATGAACGTCTGAAAAACCTGATGAAACGTGAGAACGTTCTGGTG TCCCCGCATATCGCCTTCTACACCAAAACTGCCGTGAAAAACATGGTGCAGTATGCACTG AACAACAACAAACAGCTGATTGAAACCGGTAAAGCCGACAATGTAGTAAAATTCTAA。

SEQ ID NO.2：

ATGTCCAACACTCCGAACCACCAAAAAGTTGTTCTGGTGGGTGATGGTGCAGTGGG TTCCTCTTTCGCTTTCGCAATGGCCCAGCAGGGCATCGCGGAAGAGTTCGTAGTAGTAG ACGTGATCAAAGAGCGTACTCAGGGCGACGCACTGGATCTGGAAGACGCTACGCCGTT CACCTCTCCGAAAAAAATCTACTCCGGTGAGTACTCTGACTGCAAAGATGCTGACCTGG TTGTGATCACTGCTGGCGCACCGCAGAAACCGGGTGAAACCCGTCTGGACCTGGTGAA CAAGAATCTGAAGATTCTGAGCACCATCGTTAAACCGATTGTTGATTCTGGCTTCAACGG CATCTTCCTGGTAGCAGCGAACCCGGTTGACATCCTGACTTATGCGACTTGGAAATTTTC TGGTTTCCCGAAAGAAAAAGTTATTGGTTCTGGCATCTCTCTGGATACCGCTCGTCTGCG CGTAGCTCTGGGTAAAAAATTTAATATTAGCCCGGCATCTGTTGACGCTTACATTCTGGGT GAACACGGCGATTCCGAATTTGCAGGTTACAGCGCAGCGACCATCGGCACCAAACCGCT GCTGGAAATCGCCAAGGAAGAAGGTGTAAGCACCGACGACCTGGCTAAAATCGAAGAC GAAGTGCGTAATAAAGCTTATGAAATCATCAACAAAAAAGGTGCGACCTTCTACGGTGT AGCTACTGCTATGACCCGCATCAGCAAGGCCATCCTGCGTGATGAGAACGCCGTACTGC CGGTATCCGCGTATATGGATGGCCAGTATGATGGCCTGAAAGACATCTATATCGGTACTCC AGCGGTTATCAACGGCTCTGGTCTGGCACGTGTTATCGAATCTCCACTGAACGCGGACG AAAAGCAGAAAATGGCAGCATCCGCAAAAACCCTGAAGAAAGTTCTGAACGACGGCCT GGCCAACCTGGAAAAATAA。

SEQ ID NO.3：

ATGGCGCTGGAGATCTTCGAGTATCTGGAGAAATATGATTATGAGCAGGTGGTCTTC TGCCAGGATAAGGAGTCGGGCCTGAAGGCCATCATCGCGATCCATGATACCACCCTGGG CCCCGCGCTGGGCGGCACCCGCATGTGGACCTATGATTCGGAGGAGGCGGCCATCGAGG ATGCCCTGCGCCTGGCGAAGGGCATGACCTATAAGAACGCCGCGGCCGGCCTGAACCTG GGCGGCGCGAAGACCGTCATCATCGGCGATCCGCGCAAGGATAAATCGGAGGCCATGTT CCGCGCGCTGGGCCGCTATATCCAGGGCCTGAACGGCCGCTATATCACCGCCGAGGATG TGGGCACCACCGTCGATGATATGGATATCATCCATGAGGAGACCGATTTTGTCACCGGCA TCTCGCCCTCGTTTGGCTCGTCGGGCAACCCGTCGCCGGTGACCGCGTATGGCGTCTATC GCGGCATGAAAGCGGCGGCGAAAGAGGCGTTCGGCACCGATTCGCTGGAGGGCAAAG TGATCGCGGTCCAGGGCGTGGGCAACGTCGCGTATCATCTGTGCAAGCATCTGCATGCC GAGTCGGCCCAGCTGATCGTGACCGATATCAACAAGGAGGCCGTGCAGCGCGCGGTCG AGGAGTTTGGCGCCACCGCGGTCGAGCCCAACGAGATCTATTCGGTCGAGTGCGATATC TATGCCCCCTGCGCGCTGGGCGCCACCATCAATGATGAGACCATCCCCCAGTTCAAAGC GAAGGTCATCGCCGGCTCGGCCAACAACCAGCTGAAGGAGGATCGCCATGGCGATACC ATCCATGAGATGGGCATCGTCTATGCGCCGGATTATGTCATCAACGCGGGCGGCGTGATC AACGTGGCGGATGAGCTGTATGGCTATAACCGCGAGCGCGCCCTGAAGCGCGTCGAGTC GATCTATGATACCATCGCCAAGGTCATCGAGATCTCGAAGCGCGATGGCGTGCCCACCTA TGTCGCCGCGGATCGCCTGGCGGAGGAGCGCATCGCGTCGCTGAAAAACACCCGCTCG ACCTATCTGCGCAACGGCCATGATATCATCTCGCGCCGCTGA。

In the invention, the combination mode of the D-2-hydroxy acid dehydrogenase, the L-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase has higher reaction efficiency in the biocatalysis reaction taking the 2-hydroxy-3, 3-dimethylbutyric acid as a substrate, and the yield of the obtained product is higher. The invention discovers that the D-2-hydroxy acid dehydrogenase and the L-2-hydroxy acid dehydrogenase have higher catalytic efficiency and higher selectivity on the substrate 2-hydroxy-3, 3-dimethylbutyric acid in a plurality of 2-hydroxy acid dehydrogenases; meanwhile, the D-2-hydroxy acid dehydrogenase and the L-2-hydroxy acid dehydrogenase can generate NADH in the process of catalyzing the conversion of 2-hydroxy-3, 3-dimethylbutyric acid into 3, 3-dimethyl 2-oxobutyric acid, and the generated NADH can be used as a cofactor of a second-step biocatalysis reaction, and the two-step reaction is mutually coupled, so that the reaction efficiency is improved.

Preferably, the biocatalytic reaction comprises the steps of:

mixing 2-hydroxy-3, 3-dimethylbutyric acid, amino donor and water, heating, regulating pH of the reaction solution, adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ Performing biological catalysisAnd (5) carrying out chemical reaction.

Preferably, the mass ratio of the 2-hydroxy-3, 3-dimethylbutyric acid, the amino donor and the water is (1.3-1.5): (0.8-1.5): (20-40), and can be 1.3:0.8:20, 1.4:1:25, 1.5:1.2:30 or 1.5:1.5:40, for example.

Preferably, the amino donor comprises ammonium sulfate.

In the invention, ammonium sulfate is used as an amino donor to participate in biocatalysis reaction, and can also be used as a buffer system for biocatalysis. In the biocatalysis reaction, the proportion of ammonium sulfate is reduced or increased, so that a buffer system of the reaction solution can be influenced, and the catalytic activity of the mixed enzyme powder is inhibited; at the same time, the reduction of the amino donor reduces the reaction rate, and reduces the yield and purity of the product.

Preferably, the heating temperature is 38 to 42 ℃, and may be 38 ℃, 39 ℃, 40 ℃, 41 ℃, 42 ℃ or the like, for example.

The pH of the reaction solution is preferably adjusted to 8.5 to 9.5 using a pH adjuster, and may be, for example, 8.5, 8.7, 8.9, 9.0, 9.1, 9.3, or 9.5.

In the invention, the temperature and the pH value of the biocatalysis reaction influence the yield and the purity of the product, the invention adopts an enzyme catalysis method to prepare the L-tertiary leucine, and the D-2-hydroxy acid dehydrogenase, the L-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase can all reach the optimal reaction activity by adjusting the temperature and the pH value, thereby improving the reaction efficiency.

Preferably, the pH adjuster comprises aqueous ammonia.

The amount of the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase added is preferably 0.2 to 0.4% by weight, and may be, for example, 0.2%, 0.25%, 0.3%, 0.35% or 0.4% by weight, based on the total mass of the reaction solution. Preferably, the NAD ⁺ The amount of (2) added is 0.3 to 0.8% by mass of the total reaction mixture, and may be, for example, 0.3%, 0.4%, 0.5%, 0.6%, 0.7% or 0.8%.

In the present invention, the amount of the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase is too low, the substrate reaction of the reaction solution is incomplete, and the 2-hydroxy acid dehydrogenase and leucine dehydrogenase are mixed together to form a mixtureThe addition amount of the mixed enzyme powder is too high, side reaction products are increased in the reaction process, the subsequent purification is affected, and the purity of the products is reduced; in biocatalytic reactions, NAD ⁺ Too low an amount of (B) may result in a decrease in the reaction rate, increase in the reaction time, decrease in the product yield, and NAD ⁺ Higher cost and NAD ⁺ The addition amount of (2) is continuously increased within a proper range, so that the reaction efficiency cannot be further improved, and the cost is increased; the present invention therefore uses NAD ⁺ The amount of the additive is controlled at a level that enables higher yields and lower costs.

Preferably, the temperature of the biocatalytic reaction is 35 to 40 ℃, for example, 35 ℃, 37 ℃, 39 ℃ or 40 ℃ and the like; the time of the biocatalytic reaction is 1 to 4 hours, and may be, for example, 1 hour, 2 hours, 3 hours, 4 hours, or the like.

Preferably, the preparation method of the mixed enzyme powder of the 2-hydroxy acid dehydrogenase and the leucine dehydrogenase comprises the following steps:

(1) Preparing a co-expression vector for expressing D-2-hydroxy acid dehydrogenase, L-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase, and introducing the co-expression vector into chassis cells to obtain genetically engineered bacteria;

(2) Fermenting and culturing the genetically engineered bacteria obtained in the step (1) to obtain thalli;

(3) And (3) preparing the thalli obtained in the step (2) into mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase.

Preferably, in the step (1), the preparation method of the genetically engineered bacterium comprises the following steps:

synthesizing a gene fragment a encoding D-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase, and synthesizing a gene fragment b encoding L-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase;

cloning the gene fragment a and the gene fragment b onto an expression vector to obtain a co-expression vector, and introducing the co-expression vector into a chassis cell to obtain the genetically engineered bacterium.

Preferably, the gene fragment a further comprises an RBS sequence.

Preferably, the gene fragment b further comprises an RBS sequence.

In the invention, RBS sequences are added between the encoding genes of the hydroxyl acid dehydrogenase and the leucine dehydrogenase, and the RBS sequences are used for regulating the expression quantity of double enzymes, so that the content of the two enzymes in the obtained enzyme powder is more suitable, thereby better performing biocatalysis reaction. The invention co-expresses the D-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase, and co-expresses the L-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase to form fusion-expressed protein, which can couple the first step reaction and the second step reaction together, and shortens the space distance between reactants, thereby increasing the reaction efficiency.

Preferably, the RBS sequence comprises any one of the nucleotide sequences set forth in SEQ ID NO. 4-6.

SEQ ID NO.4：AAGGAGATATACAA。

SEQ ID NO.5：AGGAAGGATATACAA。

SEQ ID NO.6：AAGGAGGATATACAA。

Preferably, the expression vector comprises the pRSFDuet1 plasmid.

Preferably, the chassis cells comprise E.coli.

Preferably, in the step (2), the fermenting and culturing the genetically engineered bacteria to obtain the bacterial cells comprises the following steps:

and (3) carrying out fermentation on the genetically engineered bacteria after activation and expansion culture, supplementing a carbon source in the fermentation process, and carrying out induction treatment to obtain a biological enzyme fermentation broth.

Preferably, the temperature of the activation is 33 to 37 ℃, for example, 33 ℃, 34 ℃, 35 ℃, 36 ℃ or 37 ℃ and the like, and the time of the activation is 8 to 12 hours, for example, 8 hours, 10 hours or 12 hours and the like.

Preferably, the culture medium used for the activation comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mu g/mL kanamycin according to mass concentration, and the solvent is water.

In the present invention, the mass concentration of the yeast extract in the medium used for the activation is 4.5 to 5.5g/L, and may be, for example, 4.5g/L, 5.0g/L, 5.5g/L, or the like.

In the present invention, the concentration of peptone in the medium used for the activation is 9 to 11g/L by mass, and for example, 9g/L, 10g/L, 11g/L, or the like can be used.

In the present invention, the mass concentration of NaCl in the medium used for the activation is 9 to 11g/L, and may be, for example, 9g/L, 10g/L, 11g/L, or the like.

In the present invention, the mass concentration of kanamycin in the medium used for the activation is 45 to 55. Mu.g/mL, and for example, 45. Mu.g/mL, 48. Mu.g/mL, 50. Mu.g/mL, 52. Mu.g/mL, 55. Mu.g/mL, or the like can be used.

Preferably, the expansion culture includes a primary expansion culture and a secondary expansion culture.

Preferably, the temperature of the primary expansion culture is 33 to 37℃and may be 33℃34℃35℃36℃37℃or the like, the time of the primary expansion culture is 16 to 20 hours and may be 16 hours, 17 hours, 18 hours, 19 hours or 20 hours or the like, and the volume of the medium used for the primary expansion culture is 3 to 5mL and may be 3mL, 4mL or 5mL or the like.

Preferably, the temperature of the secondary expansion culture is 33 to 37 ℃, for example, 33 ℃, 34 ℃, 35 ℃, 36 ℃, 37 ℃ or the like, the time of the secondary expansion culture is 4 to 8 hours, for example, 4 hours, 5 hours, 6 hours, 7 hours or 8 hours or the like, and the volume of the culture medium used for the secondary expansion culture is 250 to 300mL, for example, 250mL, 280mL or 300mL or the like.

Preferably, the culture medium used for the expansion culture comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mu g/mL kanamycin according to mass concentration, and the solvent is water.

In the present invention, the mass concentration of the yeast extract in the medium used for the expansion culture is 4.5 to 5.5g/L, and may be, for example, 4.5g/L, 5.0g/L, 5.5g/L, or the like.

In the present invention, the mass concentration of peptone in the medium used for the amplification culture is 9 to 11g/L, and may be, for example, 9g/L, 10g/L, 11g/L, or the like.

In the present invention, the mass concentration of NaCl in the medium used for the expansion culture is 9 to 11g/L, and may be, for example, 9g/L, 10g/L, 11g/L, or the like.

In the present invention, the mass concentration of kanamycin in the medium used for the amplification culture is 45 to 55. Mu.g/mL, and for example, 45. Mu.g/mL, 48. Mu.g/mL, 50. Mu.g/mL, 52. Mu.g/mL, 55. Mu.g/mL, or the like may be used.

Preferably, the culture medium used for the fermentation comprises 5-7 g/L Na by mass concentration ₂ HPO ₄ 、2.5～3.5g/L KH ₂ PO ₄ 、 0.246～0.25g/L MgSO ₄ ^. 7H ₂ O、2.24～2.3g/L(NH ₄ ) ₂ SO ₄ 0.45-0.5 g/L NaCl, 18-22 g/L glucose and 45-55 mu g/mL kanamycin, and the solvent is water.

In the invention, na in the culture medium is adopted for fermentation ₂ HPO ₄ The mass concentration of (C) is 5-7 g/L, and may be, for example, 5g/L, 6g/L, 7g/L, or the like.

In the invention, KH in the culture medium used for fermentation ₂ PO ₄ The mass concentration of (C) is 2.5-3.5 g/L, for example, 2.5 g/L, 3.0g/L or 3.5 g/L.

In the invention, mgSO in the culture medium used for fermentation ₄ ^. 7H ₂ The mass concentration of O is 0.246 to 0.25g/L, and may be, for example, 0.246g/L, 0.248g/L, 0.25g/L, or the like.

In the present invention, the medium (NH ₄ ) ₂ SO ₄ The mass concentration of (C) is 2.24-2.3 g/L, and may be, for example, 2.24g/L, 2.26g/L, 2.28g/L, or 2.3 g/L.

In the present invention, the mass concentration of NaCl in the medium used for the fermentation is 0.45 to 0.5g/L, and may be, for example, 0.45. 0.45 g/L, 0.46g/L, 0.48g/L, or 0.5 g/L.

In the present invention, the mass concentration of glucose in the medium used for the fermentation is 18 to 22g/L, and may be, for example, 18g/L, 20g/L, 22g/L, or the like.

In the present invention, the mass concentration of kanamycin in the medium used for fermentation is 45 to 55. Mu.g/mL, and for example, 45. Mu.g/mL, 48. Mu.g/mL, 50. Mu.g/mL, 52. Mu.g/mL, 55. Mu.g/mL, or the like can be used.

Preferably, the stirring speed of the fermentation is 300 to 600rpm, for example, 300rpm, 350rpm, 400rpm, 450rpm, 500rpm, 550rpm, 600rpm, or the like, the temperature of the fermentation is 33 to 37 ℃, for example, 33 ℃, 34 ℃, 35 ℃, 36 ℃, 37 ℃, or the like, and the time of the fermentation is 6 to 8 hours, for example, 6 hours, 7 hours, 8 hours, or the like.

Preferably, the dissolved oxygen value of the fermentation is 20% or more, for example, 20%, 22%, 24%, 26% or 28%, and the ventilation ratio of the fermentation is 1 (1-4), for example, 1:1, 1:2, 1:3 or 1:4.

Preferably, the fermentation process further comprises the step of adjusting the pH of the fermentation broth using a pH adjustor.

Preferably, the pH adjuster comprises aqueous ammonia.

Preferably, the pH value of the fermentation broth is maintained between 7.0 and 7.3, and the pH value can be 7.0, 7.1, 7.2 or 7.3, for example.

Preferably, the carbon source comprises a glucose solution.

Preferably, the final concentration of the carbon source in the fermentation broth after supplementing the carbon source is 15-20 g/L, and for example, 15g/L, 16g/L, 17g/L, 18g/L, 19g/L, 20g/L, etc. can be used.

Preferably, the induction treatment comprises the steps of: and adding an inducer into the fermentation broth for induction treatment.

Preferably, the temperature of the fermentation liquid in the induction treatment is 20 to 25 ℃, and for example, 20 ℃, 22 ℃, 24 ℃, 25 ℃ or the like can be used.

Preferably, the OD of the fermentation broth in the induction treatment ₆₀₀ Is 28 to 32 OD ₆₀₀ For example 28, 29, 30, 31 or 32, etc.

Preferably, the inducer comprises IPTG.

Preferably, the final concentration of the inducer in the fermentation broth is 0.8 to 1.2mM, for example, 0.8mM, 1.0mM, 1.2mM, etc.

Preferably, the time for inducing the expression is 20 to 24 hours, and may be, for example, 20 hours, 22 hours, 24 hours, or the like.

Preferably, in the step (3), the step (2) of preparing the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase comprises the following steps:

Centrifuging the fermentation liquor, collecting thalli, re-suspending thalli by using a buffer solution, cracking, centrifuging the cracking liquor, collecting supernatant, concentrating and drying the supernatant to prepare mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase.

Preferably, the centrifugal force of the fermentation broth is 5000-6000 g, for example, 5000g, 5500g or 6000g, the temperature of the fermentation broth is 0-4 ℃, for example, 0 ℃, 2 ℃ or 4 ℃, and the time of the fermentation broth is 30-35 min, for example, 30min, 31min, 33min or 35 min.

Preferably, the buffer comprises a PBNa buffer.

Preferably, the concentration of the PBNa buffer is 45-55 mmol, for example, 45mmol, 48mmol, 50 mmol, 52mmol, 55mmol, or the like.

Preferably, the volume ratio of the PBNa buffer to the cell is (3-4): 1, and may be, for example, 3:1, 3.5:1, or 4:1.

Preferably, the lysis is performed by means of ultrasonic lysis.

Preferably, the centrifugal force of the lysate is 10000 to 11000g, for example 10000g, 10500g or 11000g, the temperature of the lysate is 0 to 4 ℃, for example 0 ℃, 2 ℃ or 4 ℃, and the time of the lysate is 10 to 15min, for example 10min, 11min, 13min or 15 min.

Preferably, the concentration and drying are performed by vacuum freeze drying.

Preferably, the parameters of the vacuum freeze drying are as follows: vacuum freeze-drying is carried out at a temperature of-60 to-50 ℃ and a pressure of 2 to 7Pa for 10 to 20 hours, the temperature of vacuum freeze-drying can be-60 ℃, -58 ℃, -55 ℃, -52 ℃ or-50 ℃ and the like, the pressure of vacuum freeze-drying can be 2Pa, 3Pa, 4Pa, 5Pa, 6Pa or 7Pa and the like, and the time of vacuum freeze-drying can be 10 hours, 12 hours, 14 hours, 16 hours, 18 hours or 20 hours and the like.

As a preferred technical scheme of the invention, the method for preparing the L-tertiary leucine by the biological enzyme catalysis comprises the following steps:

(1) Synthesizing a gene fragment a for encoding D-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase, and synthesizing a gene fragment b for encoding L-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase, wherein the gene fragment a and the gene fragment b also comprise RBS sequences, and the RBS sequences comprise any one of nucleotide sequences shown in SEQ ID NO. 4-6; cloning the gene fragment a and the gene fragment b onto an expression vector to obtain a co-expression vector, and introducing the co-expression vector into a chassis cell to obtain the genetically engineered bacterium.

(2) Activating the genetically engineered bacteria, performing primary expansion culture and secondary expansion culture, fermenting, adding glucose solution in the fermentation process, and adding IPTG in the fermentation liquor for induction treatment to obtain the biological enzyme fermentation liquor.

The culture medium adopted by the activation comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mu g/mL kanamycin according to mass concentration, and the solvent is water;

the culture medium adopted by the expansion culture comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mu g/mL kanamycin according to mass concentration, and the solvent is water;

the culture medium adopted by the fermentation comprises 5-7 g/L Na by mass concentration ₂ HPO ₄ 、2.5～3.5g/L KH ₂ PO ₄ 、 0.246～0.25g/L MgSO ₄ ^. 7H ₂ O、2.24～2.3g/L(NH ₄ ) ₂ SO ₄ 0.45-0.5 g/L NaCl, 18-22 g/L glucose and 45-55 mu g/mL kanamycin, and the solvent is water.

The activation temperature is 33-37 ℃, and the activation time is 8-12 h.

The temperature of the primary expansion culture is 33-37 ℃, the time of the primary expansion culture is 16-20 h, the volume of a culture medium used for the primary expansion culture is 3-5 mL, the temperature of the secondary expansion culture is 33-37 ℃, the time of the secondary expansion culture is 4-8 h, and the volume of a culture medium used for the secondary expansion culture is 250-300 mL.

The fermenter parameters for the fermentation include:

the dissolved oxygen value in the whole fermentation process is controlled to be more than 20%, the ventilation ratio is 1 (1-4), the stirring speed is 100-300 rpm, the fermentation culture temperature is controlled to be 33-37 ℃, and ammonia water is used for regulating the pH value of fermentation liquor to be 7.0-7.3; fermenting and culturing for 6-8 h, adding glucose solution, and adding carbon source, wherein the final concentration of the carbon source in the fermentation broth is 15-20 g/L; OD (optical density) ₆₀₀ And (3) adding an inducer IPTG for induction at the beginning of 28-32, wherein the final concentration of the IPTG in the fermentation broth is 0.8-1.2 mM, the temperature of induction expression is controlled at 20-25 ℃, and the induction expression is performed for 20-24 h.

(3) Centrifuging the fermentation liquor at the centrifugal force of 5000-6000 g and the temperature of 0-4 ℃ for 30-35 min, collecting thalli, re-suspending the thalli by using a PBNa buffer solution with the concentration of 45-55 mmol and cracking, wherein the volume ratio of the PBNa buffer solution to the thalli is (3-4): 1, centrifuging the cracking liquor at the centrifugal force of 10000-11000 g and the temperature of 0-4 ℃ for 10-15 min, collecting supernatant, concentrating and drying the supernatant to prepare the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase.

Mixing 2-hydroxy-3, 3-dimethylbutyric acid, an amino donor and water (0.8-1.5) (20-40) according to the mass ratio of (1.3-1.5), heating to 38-42 ℃, regulating the pH value of the reaction solution to 8.5-9.5, and adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ Performing biocatalysis reaction, wherein the temperature of the biocatalysis reaction is 35-40 ℃, the reaction time is 1-4 h, the addition amount of the mixed enzyme powder of the 2-hydroxy acid dehydrogenase and the leucine dehydrogenase accounts for 0.2-0.4% of the total mass of the reaction solution, and the NAD is obtained by mixing the NAD with the mixed enzyme powder of the leucine dehydrogenase ⁺ The addition amount of the catalyst accounts for 0.3 to 0.8 percent of the total mass of the reaction liquid.

In a second aspect, the invention provides an application of the method for preparing L-tertiary leucine by catalyzing with biological enzyme in the first aspect in preparing antiviral drugs.

The numerical ranges recited herein include not only the above-listed point values, but also any point values between the above-listed numerical ranges that are not listed, and are limited in space and for the sake of brevity, the present invention is not intended to be exhaustive of the specific point values that the stated ranges include.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention takes 2-hydroxy-3, 3-dimethylbutyric acid as a substrate, and the L-tertiary leucine is obtained by the reaction under the catalysis of 2-hydroxy acid dehydrogenase and leucine dehydrogenase, and the method is an enzyme-catalyzed biosynthesis method, and has the advantages of simple operation, no need of adding extra NADH, high yield, low production cost and the like, the yield reaches 90% -92.5%, and the e.e. value is 99.5% -99.9%.

(2) The 2-hydroxy acid dehydrogenase screened in the invention comprises D-2-hydroxy acid dehydrogenase and L-2-hydroxy acid dehydrogenase, and the 2-hydroxy acid dehydrogenase has wider substrate selectivity to alpha-hydroxybutyric acid and higher reaction efficiency.

(3) In the invention, the D-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase are co-expressed, and the L-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase are co-expressed to form fusion-expressed protein, so that the first-step reaction and the second-step reaction can be coupled together, the space distance between reactants is shortened, and the reaction efficiency is increased.

Drawings

FIG. 1 is a schematic representation of the biocatalytic process described in example 1.

Detailed Description

The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

The sources of the components used in the following examples and comparative examples are as follows:

example 1

The embodiment provides a method for preparing L-tertiary leucine by biological enzyme catalysis, which comprises the following steps:

(1) Preparing a co-expression vector for expressing D-2-hydroxy acid dehydrogenase, L-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase, and introducing the co-expression vector into escherichia coli to obtain genetically engineered bacteria:

synthesizing a gene fragment a for encoding the D-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase, wherein the gene fragment a also comprises an RBS sequence, and cloning the gene fragment a into a pET28a vector by using NcoI and BamHI to obtain a D2DH-BcLeuDH-pET28a plasmid;

Synthesizing a gene fragment b encoding the L-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase, wherein the gene fragment b also comprises an RBS sequence, and cloning the gene fragment b into a pET24a vector by using NdeI and XhoI to obtain an L2DH-BcLeuDH-pET24a plasmid;

cloning the L2DH-BcLeuDH fragment in the L2DH-BcLeuDH-pET24a plasmid onto pRSFDuet1 vector using NdeI and XhoI to obtain L2DH-BcLeuDH-pRSFDuet1 plasmid; the D2DH-BcLeuDH fragment of the D2DH-BcLeuDH-pET28a plasmid was cloned into the L2DH-BcLeuDH-pRSFDuet1 plasmid using NcoI and BamHI to obtain the co-expression vector L2DH-BcLeuDH-D2DH-BcLeuDH-pRSFDuet1.

The nucleotide sequence of the gene for encoding the D-2-hydroxy acid dehydrogenase is shown as SEQ ID NO. 1.

The nucleotide sequence of the gene for encoding the L-2-hydroxy acid dehydrogenase is shown as SEQ ID NO. 2.

The nucleotide sequence of the gene for encoding the L-leucine dehydrogenase is shown as SEQ ID NO. 3.

The nucleotide sequence of the RBS sequence in the gene fragment a is shown as SEQ ID NO. 4.

The nucleotide sequence of the RBS sequence in the gene fragment b is shown as SEQ ID NO. 5.

The above nucleotide sequences were all synthesized by Changzhou-made group Biotechnology.

The activation adopts a culture medium: 5g/L yeast extract, 10g/L peptone, 10g/L NaCl and 50. Mu.g/mL kanamycin, the solvent being water;

the culture adopted by the expansion culture comprises the following steps: 5g/L yeast extract, 10g/L peptone, 10g/L NaCl and 50. Mu.g/mL kanamycin, the solvent being water;

the culture medium adopted by the fermentation comprises the following components: 6g/L Na ₂ HPO ₄ 、3g/L KH ₂ PO ₄ 、0.246g/L MgSO ₄ ^. 7H ₂ O、2.24g/L (NH ₄ ) ₂ SO ₄ 0.5g/L NaCl, 20g/L glucose and 50. Mu.g/mL kanamycin, and the solvent is water.

The activation temperature was 37℃and the activation time was 10 hours.

The temperature of the primary expansion culture is 37 ℃, the time is 18 hours, and the volume of the used culture medium is 3mL; the temperature of the secondary expansion culture is 37 ℃, the time is 6 hours, and the volume of the used culture medium is 300mL.

The fermenter parameters for the fermentation include:

the dissolved oxygen value is controlled at 20% in the whole fermentation process, the ventilation ratio is 1:3, the stirring speed is 400rpm, the fermentation culture temperature is controlled at 37 ℃, and ammonia water is used for regulating the pH value of the fermentation liquor to 7.2; fermenting and culturing for 7h, adding glucose solution, and adding carbon source to obtain final concentration of glucose in fermentation broth of 18g/L; OD of fermentation broth ₆₀₀ The induction is carried out by adding an inducer IPTG to 30, the final concentration of the IPTG in the fermentation broth is 1mM, the induction temperature is controlled at 25 ℃, and the induction expression is carried out for 22 hours.

(3) Centrifuging the fermentation liquor at the centrifugal force of 5500g and the temperature of 4 ℃ for 30min, collecting thalli, re-suspending the thalli by using a PBNa buffer with the concentration of 50mmol and cracking, wherein the volume ratio of the PBNa buffer to the thalli is 3:1, centrifuging the cracking liquor at the centrifugal force of 10000 g and the temperature of 4 ℃ for 10min, collecting the supernatant, and freeze-drying the supernatant under the vacuum condition of parameters of vacuum freeze drying to prepare mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase, wherein the parameters of the vacuum freeze drying are as follows: vacuum freeze-drying at-55deg.C under 6Pa for 15h.

A schematic diagram of the biocatalytic process described in this example is shown in fig. 1. The biocatalytic process is as follows:

mixing 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water according to a mass ratio of 1.3:1.32:40, heating to 40 ℃, regulating the pH value of the reaction solution to 9.0, and adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ Performing biocatalysis reaction, wherein the temperature of the biocatalysis reaction is 38 ℃, the reaction time is 3 hours, the addition amount of mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase accounts for 0.3 percent of the total mass of the reaction solution, and the NAD is obtained by mixing the mixed enzyme powder with the leucine dehydrogenase ⁺ The addition amount of (2) is 0.5% of the total mass of the reaction solution.

Example 2

(1) The procedure for the preparation of genetically engineered bacteria is described in example 1.

The media used for the activation, primary expansion, secondary expansion and fermentation are described in example 1.

The activation temperature was 36℃and the activation time was 8 hours.

The temperature of the primary expansion culture is 36 ℃, the time is 16 hours, and the volume of the used culture medium is 4mL; the temperature of the secondary expansion culture is 36 ℃, the time is 4 hours, and the volume of the used culture medium is 280mL.

The fermenter parameters for the fermentation include:

the dissolved oxygen value is controlled at 25% in the whole fermentation process, the ventilation ratio is 1:2, and the stirring speed is300rpm, controlling the fermentation culture temperature at 36 ℃, and regulating the pH of the fermentation liquor to 7.3 by using ammonia water; culturing for 6h, adding glucose solution, and adding carbon source to obtain final concentration of glucose in fermentation broth of 15g/L; OD of fermentation broth ₆₀₀ The induction was started by adding the inducer IPTG at a final concentration of 1.2mM in the fermentation broth, the induction temperature was controlled at 23℃and the induction was performed for 20h.

(3) Centrifuging the fermentation liquor at a centrifugal force of 5000g and a temperature of 4 ℃ for 30min, collecting thalli, re-suspending the thalli by using a PBNa buffer with a concentration of 50mmol and cracking the thalli, wherein the volume ratio of the PBNa buffer to the thalli is 4:1, centrifuging the cracking liquor at a centrifugal force of 10500 g and a temperature of 4 ℃ for 12min, collecting a supernatant, and freeze-drying the supernatant under the condition of vacuum to prepare mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase, wherein the parameters of the vacuum freeze-drying are as follows: vacuum freeze-drying at-60deg.C under 5Pa for 17 hr.

Mixing 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water according to a mass ratio of 1.5:0.8:20, heating to 38 ℃, regulating the pH value of the reaction solution to 8.5, and adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ Performing biocatalysis reaction, wherein the temperature of the biocatalysis reaction is 35 ℃, the reaction time is 4 hours, the addition amount of mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase accounts for 0.4% of the total mass of the reaction solution, and the NAD is obtained by mixing the mixed enzyme powder with the leucine dehydrogenase ⁺ The addition amount of (2) is 0.3% of the total mass of the reaction solution.

Example 3

The activation temperature is 35 ℃, and the activation time is 12 hours.

The temperature of the primary expansion culture is 35 ℃, the time is 20 hours, and the volume of the used culture medium is 5mL; the temperature of the secondary expansion culture is 35 ℃, the time is 8 hours, and the volume of the used culture medium is 300mL.

The fermenter parameters for the fermentation include:

the dissolved oxygen value is controlled at 28% in the whole fermentation process, the ventilation ratio is 1:4, the stirring speed is 600rpm, the fermentation culture temperature is controlled at 35 ℃, and ammonia water is used for regulating the pH value of the fermentation liquor to 7; culturing for 8h to mutate dissolved oxygen, adding 650g/L glucose solution, and adding 20g/L glucose final concentration in fermentation broth; OD of fermentation broth ₆₀₀ The induction was performed by starting 28 with the inducer IPTG, the final concentration of which in the fermentation broth was 0.8mM, the induction temperature was controlled at 20℃and the induction was performed for 24h.

(3) Centrifuging the fermentation liquor at the centrifugal force of 6000g and the temperature of 4 ℃ for 35min, collecting thalli, re-suspending the thalli by using a PBNa buffer solution with the concentration of 50mmol and cracking, wherein the volume ratio of the PBNa buffer solution to the thalli is 3.5:1, centrifuging the cracking liquor at the centrifugal force of 11000g and the temperature of 4 ℃ for 15min, collecting a supernatant, and freeze-drying the supernatant under the vacuum condition to prepare mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase, wherein the parameter conditions of the vacuum freeze-drying are as follows: vacuum freeze-drying at-50deg.C under 7Pa for 13h.

Mixing 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water according to a mass ratio of 1.3:1.5:40, heating to 42 ℃, regulating the pH value of the reaction solution to 9.5, and adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ Performing biocatalysis reaction, wherein the temperature of the biocatalysis reaction is 40 ℃, the reaction time is 2 hours, the addition amount of mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase accounts for 0.2% of the total mass of the reaction solution, and the NAD is obtained by mixing the mixed enzyme powder with the leucine dehydrogenase ⁺ The addition amount of (2) is 0.8% of the total mass of the reaction solution.

Example 4

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the mass ratio of 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water is 1.3:0.6:40, and the rest of the steps are described with reference to example 1.

Example 5

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the mass ratio of 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water is 1.3:2:40, and the rest of the steps are described with reference to example 1.

Example 6

This example provides a method for producing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the pH of the reaction solution is 8, and the rest of the steps are described with reference to example 1.

Example 7

This example provides a method for producing L-tert-leucine by the catalysis of a biological enzyme, which differs from example 1 only in that in the enzyme-catalyzed reaction, the pH of the reaction solution is 10, and the rest of the steps are described with reference to example 1.

Example 8

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the temperature of the bio-catalyzed reaction is 30℃and the rest of the steps are described with reference to example 1.

Example 9

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the temperature of the bio-catalyzed reaction is 45℃and the rest of the steps are described with reference to example 1.

Example 10

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the time of the bio-catalyzed reaction is 0.5h, and the rest of the steps are described with reference to example 1.

Example 11

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the time of the bio-catalyzed reaction is 5 hours, and the rest of the steps are described with reference to example 1.

Example 12

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which is different from example 1 only in that in the enzyme catalysis reaction, the addition amount of the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase is 0.1% of the total mass of the reaction solution, and the rest steps are described in example 1.

Example 13

This example provides a method for preparing L-tert-leucine by bio-enzyme catalysis, which is different from example 1 only in that in the enzyme catalysis reaction, the addition amount of the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase is 0.6% of the total mass of the reaction solution, and the rest steps are described in example 1.

Example 14

This example provides a method for producing L-tert-leucine by biological enzyme catalysis, which differs from example 1 only in that in the enzyme-catalyzed reaction, the NAD ⁺ The amount of (2) added was 0.1% by weight based on the total mass of the reaction mixture, and the rest of the procedure was as described in example 1.

Example 15

This example provides a method for preparing L-tert-leucine catalyzed by a biological enzyme, which differs from example 1 only in that the 2-hydroxy acid dehydrogenase is L-2 hydroxy acid dehydrogenase, the NCBI database of the L-2 hydroxy acid dehydrogenase encodes EFK28653.1, and the remaining steps are described in example 1.

Example 16

This example provides a method for preparing L-tert-leucine catalyzed by a biological enzyme, which differs from example 1 only in that the 2-hydroxy acid dehydrogenase is a D-2 hydroxy acid dehydrogenase whose NCBI database encodes EPB99484.1, and the rest of the steps are described in example 1.

Example 17

This example provides a method for the bio-enzyme catalyzed preparation of L-tertiary leucine, which differs from example 1 only in that the code in the NCBI database of leucine dehydrogenase is AIY34661.1, the remaining steps being referred to in example 1.

Example 18

This example provides a method for the bio-enzyme catalyzed preparation of L-tertiary leucine, which differs from example 1 only in that the coding in the NCBI database of leucine dehydrogenase is WP_012369820.1, the remaining steps are described in example 1.

Example 19

This example provides a method for preparing L-tert-leucine under the catalysis of a biological enzyme, which differs from example 1 only in that the 2-hydroxy acid dehydrogenase and leucine dehydrogenase are separately expressed enzyme powders, and the rest of the steps are described in example 1.

The yields, purities and e.e. values of L-tert-leucine obtained by the preparation methods of examples 1 to 19 are shown in Table 1:

TABLE 1

As shown by the results in Table 1, the method for preparing the L-tertiary leucine by the biological enzyme catalysis is green, safe and pollution-free, the yield of the reaction product is high, the purity of the obtained product is high, and the method has important application value.

As is clear from comparison of examples 1 and examples 4 to 5, reducing or increasing the proportion of ammonium sulfate in the biocatalytic reaction affects the buffer system of the reaction solution, and inhibits the catalytic activity of the mixed enzyme powder; at the same time, the reduction of the amino donor reduces the reaction rate, and reduces the yield and purity of the product.

As is clear from comparison of examples 1 and examples 6 to 9, too low or too high pH value in the biocatalytic reaction can inhibit the catalytic activity of the mixed enzyme powder, and affect the reaction rate and the yield and purity of the product; too low a reaction temperature reduces the activity of the enzyme, and the reaction rate is low; too high a reaction temperature can inhibit the catalytic activity of the mixed enzyme powder, and affect the reaction rate and the yield and purity of the product.

As is clear from comparison of examples 1 and examples 10 to 11, the reaction time is too short and incomplete, which lowers the yield, and the reaction time is too long, which generates a large amount of by-products and lowers the purity of the product.

As is clear from the comparison between the examples 1 and 12 to 14, the addition amount of the mixed enzyme powder of the 2-hydroxy acid dehydrogenase and the leucine dehydrogenase is too low, the substrate reaction of the reaction solution is incomplete, and the addition amount of the mixed enzyme powder of the 2-hydroxy acid dehydrogenase and the leucine dehydrogenase is too high, so that side reaction products are increased in the reaction process, and the purity of the products is reduced; in biocatalytic reactions, NAD ⁺ Too low an amount of (c) may result in a decrease in reaction rate, increase in reaction time, and decrease in product yield.

As is clear from comparison of examples 1 and examples 15 to 19, the combination of D-2-hydroxy acid dehydrogenase, L-2-hydroxy acid dehydrogenase and L-leucine dehydrogenase has higher reaction efficiency in biocatalysis reaction using 2-hydroxy-3, 3-dimethylbutyric acid as a substrate, and the yield of the obtained product is higher. Meanwhile, only the combination of the D-2-hydroxy acid dehydrogenase and the L-leucine dehydrogenase can efficiently oxidize the 2-hydroxy-3, 3-dimethylbutyric acid into the 3, 3-dimethyl 2-oxobutyric acid, the catalytic activity of other 2-hydroxy acid dehydrogenases is lower, the rate in the first step of the reaction is slower, and meanwhile, the byproducts are more.

In conclusion, the method for preparing the L-tertiary leucine by using the biological enzyme in the invention has the advantages of simple operation, no need of adding extra NADH, high yield, low production cost and the like, and the yield reaches 90% -92.5%, wherein the e.e. value is 99.5% -99.9%. The precursor 2-hydroxy-3, 3-dimethylbutyric acid of trimethylpyruvic acid is used as a substrate, and the screened specific 2-hydroxy acid dehydrogenase and leucine dehydrogenase are used for coupling reaction, so that the self-circulation of coenzyme NADH is realized, and a coenzyme circulation system is not required to be additionally added; after the generation of trimethylpyruvic acid, the trimethylpyruvic acid is converted into L-tertiary leucine by L-leucine dehydrogenase, and substrate inhibition does not exist. Compared with the traditional chemical method, the method for catalyzing the biological enzyme is more environment-friendly and simple in steps, and meanwhile, the coupling reaction designed by the invention can reduce cost, has higher reaction efficiency and has important application prospect in the field of medicine preparation.

The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.

Sequence listing

<110> Jin Dawei biotechnology (Jiangsu) Inc.; inner Mongolian Jindawei pharmaceutical Co., ltd; betula platyphylla Biotechnology Co.Ltd

<120> method for preparing L-tertiary leucine by biological enzyme catalysis and application thereof

<130> 2022

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 996

<212> DNA

<213> artificial sequence

<400> 1

atgaagatca tcgcgtacgg cattcgtgat gatgaacagc cgtatctgga acagtggtct 60

aaagaccagg gtatcgaagt taaggcggtt aaagagctgc tggatgactc caccgttgat 120

ctggctaagg gttacgacgg cgcggtggtg taccagcaga aaccgtacac cgcttccgtt 180

ctggataaac tggcggcgaa cggtgttact aacctgagcc tgcgcaatgt tggtgtcgac 240

aacgtagacg cggacgccgt gaaacgtaac ggtttcaagg ttacgaacgt accagcatac 300

agcccggaag ccatcgcgga gttcaccgtt actgaactga tgcgtctgct gcgccgtact 360

ccaacctttg accgcaaaca ggcgaacggc gatctgcgtt gggcaccaga tatcgcggat 420

gaactgaaca gcatgaccgt gggcgttgta gcgaccggtc gcattggtcg tgcggcaatg 480

aaaatctacc agggctttgg cgcgaaagtt atcgcatacg acgtgtttca caacccagaa 540

ctggaaaaac agggcatcta cgtagatacg atggacgaac tgtacgcaca ggctgacgta 600

atctctctgc atgcaccggc aactaaagac aacgaaaaaa tgatcaatga tgacgctttt 660

tccaaaatga aagatggtgt ttggctgctg aacccggcac gtggtgcact ggtagacacc 720

gatgcactga tccgtgcgct ggattctggc aaagtagcag gtgcggctct ggacgtttac 780

gaagacgaag tgggtatctt caacaccgac ttcggttcct tcgacgcaat cccggatgaa 840

cgtctgaaaa acctgatgaa acgtgagaac gttctggtgt ccccgcatat cgccttctac 900

accaaaactg ccgtgaaaaa catggtgcag tatgcactga acaacaacaa acagctgatt 960

gaaaccggta aagccgacaa tgtagtaaaa ttctaa 996

<210> 2

<211> 963

<212> DNA

<213> artificial sequence

<400> 2

atgtccaaca ctccgaacca ccaaaaagtt gttctggtgg gtgatggtgc agtgggttcc 60

tctttcgctt tcgcaatggc ccagcagggc atcgcggaag agttcgtagt agtagacgtg 120

atcaaagagc gtactcaggg cgacgcactg gatctggaag acgctacgcc gttcacctct 180

ccgaaaaaaa tctactccgg tgagtactct gactgcaaag atgctgacct ggttgtgatc 240

actgctggcg caccgcagaa accgggtgaa acccgtctgg acctggtgaa caagaatctg 300

aagattctga gcaccatcgt taaaccgatt gttgattctg gcttcaacgg catcttcctg 360

gtagcagcga acccggttga catcctgact tatgcgactt ggaaattttc tggtttcccg 420

aaagaaaaag ttattggttc tggcatctct ctggataccg ctcgtctgcg cgtagctctg 480

ggtaaaaaat ttaatattag cccggcatct gttgacgctt acattctggg tgaacacggc 540

gattccgaat ttgcaggtta cagcgcagcg accatcggca ccaaaccgct gctggaaatc 600

gccaaggaag aaggtgtaag caccgacgac ctggctaaaa tcgaagacga agtgcgtaat 660

aaagcttatg aaatcatcaa caaaaaaggt gcgaccttct acggtgtagc tactgctatg 720

acccgcatca gcaaggccat cctgcgtgat gagaacgccg tactgccggt atccgcgtat 780

atggatggcc agtatgatgg cctgaaagac atctatatcg gtactccagc ggttatcaac 840

ggctctggtc tggcacgtgt tatcgaatct ccactgaacg cggacgaaaa gcagaaaatg 900

gcagcatccg caaaaaccct gaagaaagtt ctgaacgacg gcctggccaa cctggaaaaa 960

taa 963

<210> 3

<211> 1101

<212> DNA

<213> artificial sequence

<400> 3

atggcgctgg agatcttcga gtatctggag aaatatgatt atgagcaggt ggtcttctgc 60

caggataagg agtcgggcct gaaggccatc atcgcgatcc atgataccac cctgggcccc 120

gcgctgggcg gcacccgcat gtggacctat gattcggagg aggcggccat cgaggatgcc 180

ctgcgcctgg cgaagggcat gacctataag aacgccgcgg ccggcctgaa cctgggcggc 240

gcgaagaccg tcatcatcgg cgatccgcgc aaggataaat cggaggccat gttccgcgcg 300

ctgggccgct atatccaggg cctgaacggc cgctatatca ccgccgagga tgtgggcacc 360

accgtcgatg atatggatat catccatgag gagaccgatt ttgtcaccgg catctcgccc 420

tcgtttggct cgtcgggcaa cccgtcgccg gtgaccgcgt atggcgtcta tcgcggcatg 480

aaagcggcgg cgaaagaggc gttcggcacc gattcgctgg agggcaaagt gatcgcggtc 540

cagggcgtgg gcaacgtcgc gtatcatctg tgcaagcatc tgcatgccga gtcggcccag 600

ctgatcgtga ccgatatcaa caaggaggcc gtgcagcgcg cggtcgagga gtttggcgcc 660

accgcggtcg agcccaacga gatctattcg gtcgagtgcg atatctatgc cccctgcgcg 720

ctgggcgcca ccatcaatga tgagaccatc ccccagttca aagcgaaggt catcgccggc 780

tcggccaaca accagctgaa ggaggatcgc catggcgata ccatccatga gatgggcatc 840

gtctatgcgc cggattatgt catcaacgcg ggcggcgtga tcaacgtggc ggatgagctg 900

tatggctata accgcgagcg cgccctgaag cgcgtcgagt cgatctatga taccatcgcc 960

aaggtcatcg agatctcgaa gcgcgatggc gtgcccacct atgtcgccgc ggatcgcctg 1020

gcggaggagc gcatcgcgtc gctgaaaaac acccgctcga cctatctgcg caacggccat 1080

gatatcatct cgcgccgctg a 1101

<210> 4

<211> 14

<212> DNA

<213> artificial sequence

<400> 4

aaggagatat acaa 14

<210> 5

<211> 15

<212> DNA

<213> artificial sequence

<400> 5

aggaaggata tacaa 15

<210> 6

<211> 15

<212> DNA

<213> artificial sequence

<400> 6

aaggaggata tacaa 15

Claims

1. A method for preparing L-tertiary leucine by biological enzyme catalysis, which is characterized in that the method for preparing L-tertiary leucine by biological enzyme catalysis comprises the following steps:

2-hydroxy-3, 3-dimethylbutyric acid is used as a substrate, and L-tertiary leucine is obtained by the reaction under the catalysis of 2-hydroxy acid dehydrogenase and leucine dehydrogenase;

the 2-hydroxy acid dehydrogenase includes D-2-hydroxy acid dehydrogenase and L-2-hydroxy acid dehydrogenase;

The coding gene of the D-2-hydroxy acid dehydrogenase is shown as SEQ ID NO. 1;

the coding gene of the L-2-hydroxy acid dehydrogenase is shown as SEQ ID NO. 2;

the leucine dehydrogenase includes an L-leucine dehydrogenase;

the coding gene of the L-leucine dehydrogenase is shown as SEQ ID NO. 3;

the biological enzyme catalysis comprises the following steps:

mixing 2-hydroxy-3, 3-dimethylbutyric acid, ammonium sulfate and water, wherein the mass ratio of the 2-hydroxy-3, 3-dimethylbutyric acid to the ammonium sulfate to the water is (1.3-1.5) (0.8-1.5) (20-40); heating to raise temperature, regulating pH value of reaction solution, adding mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase and NAD ⁺ The 2-hydroxy groupThe addition amount of the mixed enzyme powder of the acid dehydrogenase and the leucine dehydrogenase accounts for 0.2-0.4% of the total mass of the reaction solution; the NAD ⁺ The addition amount of the catalyst accounts for 0.3-0.8% of the total mass of the reaction solution; and performing a biocatalytic reaction.

2. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 1, wherein the heating temperature is 38-42 ℃.

3. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 1, wherein a pH regulator is adopted to regulate the pH of the reaction solution to 8.5-9.5.

4. The method for producing L-tert-leucine under the catalysis of biological enzymes according to claim 3, wherein the pH adjustor comprises ammonia water.

5. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 1, wherein the temperature of the biological catalysis reaction is 35-40 ℃, and the time of the biological catalysis reaction is 1-4 hours.

6. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 1, wherein the preparation method of the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase comprises the following steps:

7. The method for producing L-tert-leucine under the catalysis of biological enzymes according to claim 6, wherein in the step (1), the method for producing genetically engineered bacteria comprises the steps of:

8. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 7, wherein RBS sequences are further included in the gene fragment a; the gene fragment b also comprises RBS sequences.

9. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 8, wherein the RBS sequence comprises any one of nucleotide sequences shown in SEQ ID NO. 4-6.

10. The method for preparing L-tertiary leucine catalyzed by biological enzymes according to claim 7, wherein the expression vector comprises pRSFDuet1 plasmid.

11. The method for preparing L-tertiary leucine catalyzed by biological enzymes according to claim 7, wherein the chassis cells comprise Escherichia coli.

12. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 6, wherein in the step (2), the genetically engineered bacterium is fermented and cultured to obtain thalli, which comprises the following steps:

13. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the activation temperature is 33-37 ℃, and the activation time is 8-12 hours.

14. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the culture medium used for activation comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mug/mL kanamycin according to mass concentration, and the solvent is water.

15. The method for producing L-tert-leucine under the catalysis of biological enzymes according to claim 12, wherein the expansion culture comprises a primary expansion culture and a secondary expansion culture.

16. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 15, wherein the temperature of the primary expansion culture is 33-37 ℃, and the time of the primary expansion culture is 16-20 h.

17. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 15, wherein the temperature of the secondary expansion culture is 33-37 ℃, and the time of the secondary expansion culture is 4-8 hours.

18. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the culture medium used for the amplification culture comprises 4.5-5.5 g/L yeast extract, 9-11 g/L peptone, 9-11 g/L NaCl and 45-55 mug/mL kanamycin according to mass concentration, and the solvent is water.

19. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the culture medium adopted by the fermentation comprises 5-7 g/L Na by mass concentration ₂ HPO ₄ 、2.5~3.5 g/L KH ₂ PO ₄ 、0.246~0.25 g/L MgSO ₄ ^. 7H ₂ O、2.24~2.3 g/L (NH ₄ ) ₂ SO ₄ 0.45-0.5 g/L NaCl, 18-22 g/L glucose and 45-55 mu g +.Kanamycin mL and water as solvent.

20. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the stirring speed of the fermentation is 300-600 rpm, the temperature of the fermentation is 33-37 ℃, and the time of the fermentation is 6-8 h.

21. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the dissolved oxygen value of the fermentation is more than 20%, and the ventilation ratio of the fermentation is 1 (1-4).

22. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 12, wherein the fermentation process further comprises a step of adjusting the pH of the fermentation broth using a pH adjustor.

23. The method for preparing L-tert-leucine catalyzed by biological enzymes according to claim 22, wherein the pH adjustor comprises ammonia.

24. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 23, wherein the pH value of the fermentation broth is maintained between 7.0 and 7.3.

25. The method for the bio-enzyme catalyzed production of L-tert-leucine according to claim 12, wherein the carbon source comprises a glucose solution.

26. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 25, wherein the final concentration of the carbon source in the fermentation broth after the carbon source is added is 15-20 g/L.

27. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 12, wherein the induction treatment comprises the steps of: and adding an inducer into the fermentation broth for induction treatment.

28. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 27, wherein the temperature of the fermentation broth in the induction treatment is 20-25 ℃.

29. The method for producing L-tert-leucine by biological enzyme catalysis according to claim 27, wherein the OD of the fermentation broth in the induction treatment is ₆₀₀ 28-32.

30. The method of bio-enzyme catalyzed production of L-tert-leucine according to claim 27, wherein the inducer comprises IPTG.

31. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 30, wherein the final concentration of the inducer in the fermentation broth is 0.8-1.2 mM.

32. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 27, wherein the induction treatment time is 20-24 hours.

33. The method for producing L-tert-leucine by biological enzyme catalysis according to claim 6, wherein in the step (3), the step of preparing the mixed enzyme powder of 2-hydroxy acid dehydrogenase and leucine dehydrogenase from the bacterial cells obtained in the step (2) comprises the steps of:

34. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 33, wherein the centrifugal force of the fermentation broth is 5000-6000 g, the centrifugal temperature of the fermentation broth is 0-4 ℃, and the centrifugal time of the fermentation broth is 30-35 min.

35. The method of bio-enzyme catalyzed production of L-tert-leucine according to claim 33, wherein the buffer comprises PBNa buffer.

36. The method for preparing L-tertiary leucine under the catalysis of biological enzymes according to claim 35, wherein the concentration of the PBNa buffer is 45-55 mmol.

37. The method for preparing L-tert-leucine by biological enzyme catalysis according to claim 36, wherein the volume ratio of the PBNa buffer to the thallus is (3-4): 1.

38. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 33, wherein the cleavage is performed by ultrasonic cleavage.

39. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 33, wherein the centrifugal force of the pyrolysis liquid is 10000-11000 g, the centrifugal temperature of the pyrolysis liquid is 0-4 ℃, and the centrifugal time of the pyrolysis liquid is 10-15 min.

40. The method for preparing L-tertiary leucine by biological enzyme catalysis according to claim 33, wherein the concentration and drying are performed by vacuum freeze drying.

41. The method for preparing L-tert-leucine under the catalysis of biological enzymes according to claim 40, wherein the parameters of vacuum freeze drying are as follows: and (3) vacuum freeze-drying for 10-20 h at the temperature of minus 50 ℃ and the pressure of 2-7 Pa.

42. The use of the biological enzyme catalysis method of any one of claims 1-41 for preparing L-tert-leucine in preparing antiviral drugs.