CN114540520A

CN114540520A - Primer, probe and kit for detecting helicobacter pylori in excrement

Info

Publication number: CN114540520A
Application number: CN202210281976.5A
Authority: CN
Inventors: 刘国栋; 聂艳妮
Original assignee: Beijing Zhongruihengda Technology Co ltd
Current assignee: Suzhou Changbai Biotechnology Co.,Ltd.
Priority date: 2022-03-22
Filing date: 2022-03-22
Publication date: 2022-05-27

Abstract

The invention provides a real-time fluorescent quantitative PCR primer and a probe for detecting helicobacter pylori from excrement by comparing specific genes of the helicobacter pylori, wherein the nucleotide sequences of the primer and the probe are respectively shown as SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. The detection method has the advantages of accurate detection, high sensitivity, strong specificity, simplicity, convenience and rapidness, and has good specimen detection capability.

Description

Primer, probe and kit for detecting helicobacter pylori in excrement

Technical Field

The invention relates to the field of molecular biology, in particular to fluorescent quantitative PCR primers and probes for detecting helicobacter pylori from excrement, and also relates to a method and a kit for detecting helicobacter pylori from excrement by using the primer and probe sequences.

Background

Helicobacter Pylori (HP) is the most important infectious agent causing digestive diseases, and is associated with various diseases of the stomach, such as gastritis, gastric ulcer, MALT lymphoma and gastric cancer, which are the group I carcinogenic factors prescribed by the World Health Organization (WHO) cancer society.

Sensation of helicobacter pyloriThere are various methods for diagnosis by staining, including noninvasive detection methods and invasive detection methods. Such as bacterial isolation culture, serology, rapid urease test, urea breath test. These methods have respective advantages and disadvantages. The separation culture method has great technical difficulty, and consumes time and labor. Serological methods do not well demonstrate whether an infection is occurring. Fast urease has to rely on gastroscopy and the results are not consistent enough for the reagents on the market. Most currently used are urea breath tests, the sensitivity and specificity of which are recognized, whereas the detection is carried out using urea breath tests¹³C or¹⁴The requirement for the raw material of the urea C is high, the price is high, and the detection flux is limited, so that the feasibility of the urea C in large-scale population screening is further limited. From the viewpoint of helicobacter pylori prevention and control, a detection method which is non-invasive, has high-throughput detection capability and has domestic independent intellectual property rights is needed in the future. From the technical point of view, the most suitable method is a real-time fluorescence PCR method using feces as a specimen. Human gastric mucosa cells are partially shed and renewed every 2-3 days, helicobacter pylori on the gastric mucosa also shed along with the cells, and finally the helicobacter pylori is discharged out of the body along with excrement. Thus, detection of H.pylori in feces is very feasible. In recent years, real-time fluorescent PCR has become widely used for clinical infectious disease detection due to its good sensitivity and specificity.

There are many reports on Real-Time fluorescence PCR detection method of Helicobacter pylori, and the target genes mainly include 16S rDNA, 23S rDNA, cagH, etc. (refer to the following documents of like Syahniar, Mardiastuti H Wahid, Ari Fahrial Syam, et al.detecting the Helicobacter pylori pyrori 16S rRNA Gene in Dyspepsilon Patents Using Real-Time PCR. [ J ] Acta Med indexes.2019 Jan; 51(1): 34-41.) building stone, engineering wave, Liu, et al. [ J ] Chinese experimental diagnostics, 2013,17(6),986- & Liu, III ] gastric mucosa multiple Real-Time fluorescence quantitative PCR detection method of Helicobacter pylori [ J ] PCR technology for Helicobacter pylori drug selection based on TaqMan probe ] and eradication of Helicobacter pylori [ 2011 ] C., and eradication center for disease control [ 2011 ]. These methods are mainly directed to gastric mucosa specimens or isolated strains, and it is known that the content of helicobacter pylori in gastric mucosa is far higher than that in feces, so the sensitivity of primers and probes published in the prior literature cannot meet the requirement of detecting helicobacter pylori directly in feces.

In conclusion, the detection of helicobacter pylori infection is necessarily developed in a noninvasive, rapid and high-throughput manner. In response to this situation, we developed a real-time fluorescent PCR technique for the detection of faecal helicobacter pylori.

Disclosure of Invention

The invention aims to provide a specific primer and a probe for real-time fluorescent PCR (polymerase chain reaction) for detecting helicobacter pylori in excrement; the invention also aims to provide the application of the primer and the probe to realize the capability of detecting helicobacter pylori infection from excrement.

In order to achieve the purpose, a specific conservative target sequence is found by comparing the alpB sequence of the helicobacter pylori adhesin gene reported by an NCBI database, particularly Chinese strains, and a nucleotide complete conservative region 95bp is found: nt 1047-nt 1142 (relative to the H.pylori standard strain ATCC26695), the target sequence being a genetic marker for the detection of H.pylori. Furthermore, it will be appreciated by those skilled in the art that specific fragments of this sequence may also serve as genetic markers for the detection of H.pylori.

Furthermore, the invention also provides a primer for specifically amplifying the target sequence and a fluorescent probe matched with the primer. Probes and primers can be designed using software such as Primer Express 3.0. Usually, the length of the primer is 15-30 bases, one primer sequence is the same as the HP genetic marker sequence discovered by the invention through comparison, and the other primer sequence is complementary with the HP genetic marker sequence; usually, the length of the Taqman probe is 20-50 bases, the sequence of the Taqman probe is the same as or complementary to the genetic marker, the Taqman probe is labeled with a fluorescent group FAM at the 5 'end and labeled with a quenching group BHQ1 at the 3' end. The probe and the primer of the invention are not only suitable for the reported foreign helicobacter pylori strain amplification, but also suitable for domestic helicobacter pylori amplification detection.

In one embodiment of the present invention, preferred primer sequences are:

HP alpB-FP:5’-AACCCATGGCTTGGGAATTT-3’，

HP alpB-RP:5’-CCAAAGAATTGCTTATAACCGATTTTA-3’；

the probe sequence is as follows:

(FAM)5’-CAGCTCTCAAGTGAATGCGTTTAACGGG-3’(BHQ1)。

the invention provides a real-time fluorescence quantitative PCR detection method of helicobacter pylori in feces, which comprises the steps of taking total DNA of a sample as a template, taking a genetic marker as a target sequence, utilizing the primer and the probe provided by the invention to carry out real-time fluorescence quantitative PCR, simultaneously setting a template-free control and a positive control, and judging a result according to an amplification curve.

Under the condition that the contrast is effectively amplified, the detection result of the sample is credible, and the test needs to be repeated if the contrast is not effective; when the two controls are effectively amplified in the detection, the judgment standard of the sample result is as follows:

the positive result is obtained when the Ct value of the sample is less than or equal to 38;

the sample with the Ct value larger than 40 is a negative result;

the samples with the Ct value between 38 and 40 need to be repeated, if the Ct value is still lower than 40, the samples are judged to be positively amplified, and if the Ct value is higher than 40, the samples are judged to be negatively amplified.

The real-time fluorescent quantitative PCR amplification reaction system of the invention is preferably configured as follows when the reaction system is a 20 mul reaction system:

the reaction procedure of the real-time fluorescent quantitative PCR of the invention is as follows: decontamination is carried out for 2min at 37 ℃, pre-denaturation is carried out for 10min at 95 ℃, and 1 cycle is carried out; denaturation at 95 ℃ for 10s, annealing at 55-62 ℃ for 30s, and 45 cycles.

The reaction procedure of the real-time fluorescent quantitative PCR is preferably as follows: decontamination is carried out for 2min at 37 ℃, pre-denaturation is carried out for 10min at 95 ℃, and 1 cycle is carried out; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 45 cycles.

According to the invention, an NTC control (no template control) and a POS control (positive control) must be set every time a specimen is detected, and the two controls play a decisive role in interpretation of results:

efficient amplification: NTC (-) AND POS (+)

And (3) ineffective amplification: NTC (+) AND POS (+) prompting system pollution

And (3) ineffective amplification: NTC (-) AND POS (-) suggest system error or reagent failure.

Only the detection result of the sample under the condition that the control is effectively amplified can be credible, and the test needs to be repeated if the control is not effectively amplified.

When the two controls are effectively amplified in the detection, the judgment standard of the sample result is as follows:

the sample with the Ct value less than or equal to 38 is a positive result;

the sample with the Ct value larger than 40 is a negative result;

The invention provides a kit for detecting helicobacter pylori, which comprises a specific primer of the genetic marker or the specific fragment thereof and a Taqman probe matched with the primer.

The primer sequence of the kit is as follows:

HP alpB-FP:AACCCATGGCTTGGGAATTT，

HP alpB-RP:CCAAAGAATTGCTTATAACCGATTTTA，

the probe sequence is as follows: FAM-CAGCTCTCAAGTGAATGCGTTTAACGGG-BHQ 1.

The kit provided by the invention also comprises a fluorescent quantitative reaction solution, a negative template and a positive template, wherein the negative template is enucleated acid water, and the positive template is helicobacter pylori genomic DNA, such as the helicobacter pylori genomic DNA with the concentration of 1.82 ng/mu l.

The results of the detection of the kit of the present invention in example 4 together with helicobacter pylori¹³C and¹⁴c urea breath test for comparison. The results show that the kit of the invention has the detection results¹³C ureaThe breath test showed good consistency, with a kappa consistency test of 0.85, with¹⁴C urea breath test has better consistency, and the result of kappa consistency test is 0.82.

The invention provides a primer and a probe of alpB gene for detecting helicobacter pylori in feces, the primer and the probe have stronger specificity, and the primer and the probe can be used for detecting the helicobacter pylori in the feces without wound, with high speed and good accuracy, and can adapt to the requirement of large-scale crowd screening. The reaction system of the detection kit provided by the invention comprises the primer, the probe and the negative and positive control, and the popularization and the application of the kit are favorable for rapidly and accurately identifying the infection condition of the helicobacter pylori.

Drawings

FIG. 1 shows the optimized detection results of different annealing temperature systems;

FIG. 2 is a standard curve diagram of HP alpB system, in which the abscissa is the logarithmic value of the positive template concentration and the ordinate is the Ct value, R, of the positive template with different concentrations detected by the HP alpB system²＝0.999；

FIG. 3 specificity test of real-time PCR in HP alpB system, except for positive template control, all templates in Table 1 were not amplified.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1

The annealing temperature of the HP alpB real-time fluorescent quantitative PCR system is optimized: the annealing temperature of the system is changed from 55 ℃ to 62 ℃, and the result shows that the amplification effect of the system is the best around 60 ℃ (figure 1)

HP alpB real-time fluorescence quantitative PCR amplification system and optimization of amplification conditions

Amplification conditions:

2min at 37 ℃, 10min at 95 ℃, 45 cycles: 95 ℃ for 10s and 60 ℃ for 30 s.

Example 2

Preparation of System Standard Curve

And (3) drawing a real-time PCR standard curve of the HP alpB system by taking the log value of the standard concentration template as an abscissa and the corresponding Ct value as an ordinate. The results show that: when the positive template amount is in the range of 18.2 fg-18.2 ng, the logarithm value and the Ct value have very good correlation (R is²0.999). See fig. 2.

Example 3

Evaluation of sensitivity, specificity and detection limit of HP alpB fluorescent PCR detection system

1. Evaluation of sensitivity

The sensitivity, also called true positive rate, is the percentage of H.pylori which is actually H.pylori and correctly interpreted according to the criteria of the detection method. The optimized HP alpB real-time PCR detection system of the helicobacter pylori is used for detecting the DNA of 3 ATCC standard strains and 100 clinical isolates of the helicobacter pylori. As a result, all of the 103 H.pylori HP alpB systems were tested positive except for the NTC control.

2. Evaluation of specificity

The specificity, also called the true negative rate, is the percentage of H.pylori which is not actually H.pylori and which is correctly determined according to the criteria of the test method. 20 common strains of the digestive tract and human chromosomes (Table 1) were detected by optimized real-time PCR, with H.pylori as a positive control. Results the remaining 21 non-H.pylori templates were negative except for the positive control (FIG. 3).

TABLE 1 template for the detection of HP alpB fluorescent PCR System specificity

ATCC: american model culture collection and storage; and (3) CICC: china center for the preservation and management of industrial microbial strains.

3. Evaluation of detection lower Limit

The lower detection limit is the ability to detect positive results from a series of double-diluted positive templates using the optimized detection method.

The helicobacter pylori standard strain ATCC26695 template series concentration gradient 3.64 ng/microliter-0.364 fg/microliter is used as template, 5 microliter of each concentration gradient is used for detection, and the amount of the positive template is 18.2 ng-1.82 fg. Real-time PCR was performed according to the optimized reaction system and reaction conditions, and 3 replicates were run for each concentration gradient.

When the amount of the standard template of the system is 18.2 ng-18.2 fg, 3 parallel samples of each concentration gradient are amplified positively, and when the concentration of the template is 1.81fg, only 1 sample of the 3 parallel samples of the concentration gradient is amplified. Therefore, the lower limit of detection of the helicobacter pylori HP alpB system real-time PCR detection system is 18.2fg, about 10 CFU.

Example 4

Evaluation of the detection lower limit of the feces incorporation simulation sample by the HP alpB real-time PCR method.

Mu.l of DNA of H.pylori 26695 at concentrations of 7.28 ng/. mu.l to 7.28 fg/. mu.l, 145.6 fg/. mu.l, and 364 fg/. mu.l were separately incorporated into 200mg of feces, and 3 replicates of each concentration were performed and mixed well. DNA extraction was performed on the spiked samples using QIAGEN (cat 51504) fecal DNA extraction kit, DNA was recovered in 100. mu.l, and finally 5ul was added to the optimized HP alpB real-time PCR system for detection, with 3 replicates per sample concentration.

When the standard template amount of the system is 36.4fg, 3 replicates of each concentration gradient are amplified positively, and when the template concentration is 18.2fg, only 1 sample of the 3 replicates of the concentration gradient is amplified. Therefore, the lower limit of detection of the helicobacter pylori HP alpB system real-time PCR detection system on the feces simulation sample is 36.4fg, which is about 20 CFU.

Example 5

HP alpB real-time PCR fecal nucleic acid detection method and detection method¹³C and¹⁴c Urea breath test comparison

HP alpB real-time PCR method and¹³c Urea breath test comparison

120 cases of helicobacter pylori screeners are selected, and an HP alpB real-time PCR fecal nucleic acid detection method are adopted¹³C Urea breath test and kappa consistency test analysis of the results (see Table 2). The results show a kappa value of 0.85, indicating good agreement between the two methods. (generally, kappa. gtoreq.0.85, which is considered to be good in consistency of the test results; 0.6. ltoreq. kappa<0.85, the consistency of the test results is considered to be better; kappa of 0.45-0<0.6, the consistency of the test results is considered to be general; kappa type<0.45, the test results were considered to have poor consistency. )

TABLE 2 HP alpB real-time PCR fecal nucleic acids and¹³c Urea breath test kappa test

kappa＝0.85

HP alpB real-time PCR method and¹⁴c Urea breath test comparison

120 cases of helicobacter pylori screeners are selected, and an HP alpB real-time PCR fecal nucleic acid detection method are adopted¹⁴C Urea breath test and kappa consistency test analysis of the results (see Table 3). The results show a kappa value of 0.82, indicating a better agreement between the two methods.

kappa＝0.82 。

Claims

1. A specific primer for real-time fluorescence PCR for detecting Helicobacter Pylori (HP) from feces.

2. The primer of claim 1, which has the nucleotide sequence:

HP alpB-FP:5’-AACCCATGGCTTGGGAATTT-3’，

HP alpB-RP:5’-CCAAAGAATTGCTTATAACCGATTTTA-3’。

3. a fluorescent probe used in combination with the primer according to claim 1 or 2.

4. The fluorescent probe of claim 3, which has a nucleotide sequence of:

(FAM)5’-CAGCTCTCAAGTGAATGCGTTTAACGGG-3’(BHQ1)。

5. a method for detecting helicobacter pylori in feces, characterized in that a real-time fluorescent quantitative PCR is carried out using a total DNA of a sample as a template, the primer of claim 1 or 2 and the probe of claim 3 or 4, and the result is judged based on the amplification curve.

6. The method for detecting helicobacter pylori according to claim 5, wherein the reaction system of real-time fluorescence quantitative PCR is

7. The method of claim 5 or 6, wherein the reaction procedure of the real-time fluorescent quantitative PCR is as follows: decontamination is carried out for 2min at 37 ℃, pre-denaturation is carried out for 10min at 95 ℃ for 1 cycle; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 45 cycles.

8. A kit comprising the primer of claim 1 or 2 and/or the probe of claim 3 or 4.

9. The kit of claim 8, further comprising: the kit comprises a fluorescent quantitative reaction solution, a negative template and a positive template, wherein the negative template is enucleated acid water, and the positive template is helicobacter pylori genome DNA with the concentration of 0.364 fg/mu l-3.64 ng/mu l.