CN114456993B - Bacillus subtilis mutant strain for high-yield protein glutaminase - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and in particular provides bacillus subtilis mutant bacteria for high-yield protein glutaminase and application thereof. Applicants derived from Flavobacterium prion-degrading bacteriaChryseobacterium proteolyticum) The protein glutaminase gene of (2) is over-expressed in a bacillus subtilis host, and a recombinant expression strain is constructed; then ultraviolet mutagenesis is carried out by taking the strain as a starting strain, a mutant strain capable of greatly improving the expression quantity of the protein glutaminase is obtained by screening, meanwhile, the salt tolerance of the mutant strain is also obviously improved, and the preservation number is CCTCC NO: m2021407. The mutant bacteria can be widely applied to the production of protein glutaminase, and is beneficial to reducing the production cost of the enzyme.

Description

Bacillus subtilis mutant strain for high-yield protein glutaminase

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a bacillus subtilis mutant strain for high-yield protein glutaminase and application thereof.

Background

Deacylation of proteinsAmine action is recognized as the most promising way to improve the solubility of vegetable proteins, and has become a hotspot for research at home and abroad. At present, the deamidation method mainly comprises 3 deamidation methods of non-enzymatic method and enzymatic method. Wherein, the non-enzymatic deamidation mainly comprises alkaline deamidation and acid-regulation deamidation. Protein deamination is carried out by an alkaline method, and cysteine in the protein is inevitably destroyed, so that lysine and alanine with certain toxic action on organisms are generated; acid deamidation, i.e. acid provision H ^＋ Breaking amide bond and deaminizing. Non-enzymatic deamidation can cause structural damage to proteins to different degrees, cause some adverse side reactions, and have no specificity. The enzyme method deamidation has the advantages of low reaction condition, high specificity, no adverse side effects and much attention.

The protein glutaminase (EC 3.5.1.44, protein-glutaminase, PG for short) hydrolyzes glutamine in the protein side chains and produces L-glutamate and ammonia, which is a novel protein deaminase and has no protease activity and no glutamine transaminase activity. Japanese Yamaguchi S. Et al published literature states that a strain having deamidation activity against CBZ-Gln-Gly and casein and protease activity was isolated from soil of Japanese tsukubaea, and identified as a novel species of Flavobacterium, designated asChryseobacterium proteolyticum(A. Prion) strain 9670T was used as a model strain, and PG having potential for industrial application was purified from the culture supernatant thereof. PG enzyme can directly catalyze the deamination of macromolecular proteins without hydrolyzing the proteins, and the deamination process does not cause adverse changes of protein structures; and has high specificity, only acts on the glutamine of the protein side chain, but cannot deamidate asparagine. Thus, the protein glutaminase is known as the most potential protein modification tool.

The wild chrysobacterium utilis has low enzyme activity and can not meet the requirements of industrial production. The traditional mutagenesis and protoplast fusion have certain uncertainty, can not directionally improve the enzyme activity, and have no molecular biological tool which can be directly applied to the host bacteria of the flavobacterium prions. Therefore, the heterologous expression of the protein glutaminase is the best means to increase its yield and is a research hotspot in this field.

Disclosure of Invention

The invention provides a bacillus subtilis mutant strain for high-yield protein glutaminase and application thereof, aiming at solving the problems in the prior art. Applicants derived from Flavobacterium prion-degrading bacteriaChryseobacterium proteolyticum) The protein glutaminase gene of (2) is obtained in bacillus subtilis @Bacillus subtilis) Over-expressing in a host, and constructing to obtain a recombinant expression strain; then ultraviolet mutagenesis is carried out by taking the strain as a starting strain, and a mutant strain capable of greatly improving the expression quantity and the salt tolerance of the protein glutaminase is obtained by screening. The mutant bacteria can be widely applied to the production of protein glutaminase, and is beneficial to reducing the production cost of the enzyme.

In one aspect, the invention provides an engineered strain of bacillus subtilis carrying a recombinant plasmid expressing the protein glutaminase.

The amino acid gene sequence of the protein glutaminase is SEQ ID NO:1, which encodes a nucleotide sequence of SEQ ID NO:2.

in one aspect, the invention provides a mutant strain named bacillus subtilis ZXPMBacillus subtilis ZXPM) is obtained by taking the bacillus subtilis engineering bacteria as starting bacteria through an ultraviolet mutagenesis method, and is preserved in China center for type culture collection (CCTCC NO) of university of Wuhan and Wuhan in China in 2021, 4 months and 19 days: m2021407.

The invention also provides application of the mutant strain in production of protein glutaminase.

The invention also provides a production method of the protein glutaminase, which takes the mutant strain as a fermentation strain.

The invention firstly expresses a protein glutaminase gene in a bacillus subtilis host, and constructs an engineering strain bacillus subtilis ZXPB for recombinant expression of the protein glutaminase. The enzyme activity of the protein glutaminase in the shake flask fermentation supernatant of the strain reaches 11.2U/mL.

In order to improve the yield of the protein glutaminase, the invention takes the bacillus subtilis ZXPB as an initial strain, and further screens and obtains a mutant bacillus subtilis ZXPM by an ultraviolet mutagenesis method. The protein glutaminase in the shake-flask fermentation supernatant of the mutant strain is up to 25.3U/mL, which is 125.9% higher than that of the parent strain; the enzyme activity of the protein glutaminase in the 15L tank fermentation supernatant is up to 143U/mL, which is 125.6% higher than that of the starting strain, and unexpected technical effects are obtained.

The protein glutaminase expressed by the mutant bacillus subtilis ZXPM has strong tolerance to high-salt environment, and the enzyme activity residual rate is generally higher than that of the starting bacterium after the mutant bacillus subtilis ZXPM is treated for 16 hours under the condition of 15% -30% NaCl; when the NaCl content reaches 30%, the enzyme activity residual rate of the fermentation supernatant of the mutant bacteria is still up to 69.9%, which is 20% higher than that of the starting bacteria, and unexpected technical effects are achieved.

The mutant strain can be widely applied to the production of protein glutaminase, is beneficial to reducing the production cost of the enzyme and promotes the wide application of the enzyme in the field of food industry.

Drawings

FIG. 1 is a pZX-PG plasmid map;

FIG. 2 is a 15L tank fermentation curve of Bacillus subtilis ZXPM.

Detailed Description

The method of the present invention is further described below with reference to examples, in which the experimental methods without specific conditions are not specified, and may be performed under conventional conditions, such as those described in the molecular cloning experimental guidelines written by j. The present invention may be better understood and appreciated by those skilled in the art by reference to examples. However, the method of implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.

The formula of the culture medium related in the embodiment of the invention is as follows:

LB liquid medium: 1% of tryptone, 0.5% of yeast powder and 0.5% of NaCl;

LB plate: 1% of tryptone, 0.5% of yeast powder, 0.5% of NaCl and 2% of agar;

the preparation method of the GM I comprises the following steps: 95.6ml of the lowest salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein and 1ml of 10% yeast powder juice; the preparation method of the 1-x lowest salt solution comprises the following steps: k (K) ₂ HPO ₄ 14 g/L，KH ₂ PO ₄ 6 g/L，（NH ₄ ） ₂ SO ₄ 2 g/L, trisodium citrate 1 g/L, mgSO ₄ •7H ₂ O0.2 g/L, sequentially dissolving in distilled water;

the preparation method of GM II comprises the following steps: 96.98 ml of 1-min salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast powder juice and 1M MgCl ₂ 0.25 ml，1 M CaCl ₂ 0.05 ml；

Seed culture medium: yeast extract 0.5%, tryptone 0.5%, glycerol 1%, K ₂ HPO ₄ 1.8%；

Fermentation medium: 1-2% of yeast powder, 2-5% of bean cake powder, 5-10% of maltodextrin, 0.1-0.5% of sodium citrate and CaCl ₂ 0.1~0.5%，MgSO ₄ 0.1~0.5%，K ₂ HPO ₄ 0.5~2%。

EXAMPLE 1 cloning of the protein glutaminase Gene

Applicants have come from the prion-dissolving golden rodChryseobacterium proteolyticum) The protein glutaminase of (2) is named PG, the amino acid sequence of which is SEQ ID NO:1, and the encoding nucleotide sequence of which is SEQ ID NO:2. the PG gene is synthesized by Beijing Liuhua big Gene technology Co. And then amplifying the PG gene fragment by using the synthesized gene fragment as a template and utilizing the primer PG-F and the primer PG-RV.

The PCR primers and reaction conditions were as follows:

PG-F：ctgctggcaggaggcgcaactcaagcttttgccgatagcaatggcaaccaagaaatc；

PG-Rv：aaataaaaaaacggatttccttcaggaaatccgctattaaaagccgcagctgctaac。

the PCR conditions were: 98 ℃ for 2min;98 ℃ for 10s;58 ℃ for 20s,72 ℃ for 30s,30 cycles; and at 72℃for 5min. And (5) recovering PCR amplification products by using a gel recovery kit.

EXAMPLE 2 construction of expression vector pZX-PG

The expression vector pX131 was subjected to restriction enzyme HindIII single cleavage under the following conditions:

pX131	20uL
		10*Buffer	5ul
HindIII	2.5uL
		ddH 2 O	22.5ul
total volume of	50ul

Cutting with water bath at 37deg.C for 2 hr, respectively recovering target fragments after electrophoresis, and dissolving in 20ul ddH ₂ O。

Using NEB Gbison assembly reagent box, 20uL reaction system, PG fragment and carrier pX131 in mole ratio of 1:3, 50 deg.C, reacting for 60min, taking 10uL reaction liquid to transform colibacillus, coating LB plate containing 100ug/ml ampicillin, culturing at 37 deg.C overnight.

5 transformants were selected from the above transformation plate, and sent to Qingdao Hua big gene sequencing center for sequencing analysis using the plasmid extraction kit from omega company, to obtain a plasmid conforming to the expected sequence, which was named pZX-PG.

EXAMPLE 3 construction of genetically engineered bacterium recombinantly expressing the protein glutaminase

The recombinant expression plasmid pZX-PG is subjected to cotransformation of host cell bacillus subtilis 168 by a competent method, and the specific transformation process is as follows: freshly activated bacillus subtilis 168 was inoculated from LB plates into 5ml GMI solution and shake-cultured overnight at 30 ℃, 125 rpm; the next day 1ml was transferred to 9 ml GMI and incubated at 37℃and 220 rpm for 3.5 h; transferring the culture solution obtained in the previous step of 1ml into 9 ml of GM II solution, culturing at 37 ℃ and 125 rpm for 90 min, and centrifuging for 5000 g and 10 min to collect thalli; the cells were gently suspended with 1ml of GM II solution, and the suspended cells were competent cells. Then, 0.2. 0.2mL competent cells were taken, 10uLpZX-PG plasmid was added, and after shaking culture at 37℃and 200 rpm for 60 minutes, LB plates containing 30. Mu.g/mL kanamycin were applied, and culture was carried out overnight at 37℃and transformants were examined the next day.

EXAMPLE 4 transformant screening

Colonies on the transformation plates were picked, streaked and purified on LB plates containing 30. Mu.g/mL kanamycin, and inoculated into 20 mL seed media, respectively, and shake-cultured at 37℃and 220 rpm for about 6 h; respectively inoculating 2.5. 2.5 mL seed solutions into 50mL fermentation medium, and shake culturing at 37deg.C and 220 rpm for 48 hr; and centrifuging the thalli to obtain supernatant, and respectively carrying out SDS-PAGE protein electrophoresis detection and protein glutaminase enzyme activity detection.

The results show that the activity of the protein glutaminase in the fermentation supernatant of the positive transformant obtained above reaches 11.2U/ml at the highest under the shake flask fermentation condition. The positive transformant with the highest enzyme activity level is named as bacillus subtilis ZXPB #Bacillus subtilis ZXPB）。

Enzyme activity detection method

(1) The protein glutaminase activity is defined as the amount of enzyme required to hydrolyze the substrate Z-Gln-Gly (benzyloxycarbonyl-glutamine-glycine) to 1. Mu. Mol of ammonium ion, expressed as U, by reacting at 37℃and pH6.5 for 30min, and is defined as 1 protein glutaminase activity unit.

(2) Enzyme activity determination method

Standard curve: 1mL of 50. Mu. Mol/mL ammonium chloride solution was diluted to 10mL, and 5. Mu. Mol/mL ammonium chloride solution was prepared. 80, 40, 20, 15, 10, 8-fold to concentrations of 0.0625, 0.125, 0.25, 0.333, 0.5, 0.625. Mu. Mol/ml, respectively, are diluted with distilled water. Taking 0.2mL of the solution and distilled water blank respectively, adding 0.8mL of distilled water, mixing uniformly, adding 1mL of developing solution A, 0.5mL of developing solution B and 1mL of developing solution C, mixing uniformly, developing at 37 ℃ for 20min, measuring the light absorption value at 630nm, and drawing a quasi-curve y=kx+b by taking the ammonium chloride concentration as the abscissa and the light absorption value as the ordinate.

Color development liquid A: 2.023g of phenol and 0.0075g of sodium nitrosoferricyanide are weighed, dissolved with water to 50mL and stored at 4 ℃ in a dark place.

Color development liquid B: 2.5g of potassium hydroxide was weighed, dissolved in distilled water and then fixed to a volume of 50ml. Color developing solution C: 10.5g of anhydrous potassium carbonate is weighed, dissolved in distilled water and added with 0.5ml of hypochlorous acid

Sodium is added with water to constant volume to 50mL and is prepared for use.

Sample reaction: 1mL of substrate is taken and added into a 10X 100mm test tube, pre-heated at 37 ℃ for 5min, 0.1mL of enzyme solution is added for 30min at 37 ℃, then 1mL of stop solution is added, and the mixture is uniformly mixed and taken out of a water bath kettle.

Blank reaction: adding 1mL of substrate into a 10X 100mm test tube, preheating at 37 ℃ for 5min, adding

Adding 1mL of stop solution, reacting for 30min at 37 ℃, adding 0.1mL of enzyme solution, uniformly mixing, and taking out from the water bath. Taking 0.2mL of the solution after termination to a 5mL of a buckling cover centrifuge tube, adding 0.8mL of distilled water, mixing uniformly, then adding 1mL of a developing solution A, 0.5mL of a developing solution B and 1mL of a developing solution C respectively, mixing uniformly, developing at 37 ℃ for 20min, and measuring a sample absorbance AS and a blank absorbance Ab at 630 nm.

(3) Enzyme activity calculation

Enzyme activity x= (((AS-Ab) -b)/k) ×n×v1/V2/T. Wherein: x-enzyme activity of sample, U/g (U/mL); AS-absorbance of sample; ab-blank absorbance; b-standard curve intercept; k-slope of standard curve; n-sample dilution; v1-total volume of reaction system, 2.1mL; v2-the volume of enzyme solution added to the reaction system, 0.1mL; t-response time, 30min.

EXAMPLE 5 mutagenesis screening

Mutation caused by ultraviolet mutagenesis is very random, and the effect of mutation is also random and difficult to predict. Therefore, in order to obtain effective positive mutation, the skilled person is usually required to perform multiple rounds of ultraviolet mutagenesis, the screening effort is large, and there is a possibility that effective positive mutation cannot be obtained. However, since ultraviolet mutagenesis requires simple equipment and is inexpensive, a large number of mutants can be obtained in a short time. Therefore, it is still a common mutation breeding method.

The applicant uses bacillus subtilis ZXPB%Bacillus subtilisZXPB) is used as an original strain, and is genetically modified by an ultraviolet mutagenesis method to further improve the yield of the protein glutaminase.

5.1 UV mutagenesis treatment and determination of mutagen quantity

Centrifuging bacillus subtilis ZXPB bacterial liquid cultured for 9h to remove supernatant, washing thallus twice with sterile physiological saline, suspending scattered cells in physiological saline, and finally regulating cell concentration to 10 ⁸ And each mL. Opening a 9W ultraviolet lamp switch, and preheating for about 30 min; taking a sterile plate with diameter of 9 cm, adding the above cells to a concentration of 10 ⁸ And adding a sterile magnetic stirring rotor into each mL of bacterial suspension 10mL, opening a magnetic stirrer, opening a dish cover, and carrying out ultraviolet irradiation for different time (0 s-300 s) at the position with the vertical distance of 15 cm, wherein samples are taken every 20 s. Cover the dish, turn off the ultraviolet lamp, incubate in the dark for 30min. Diluting the irradiated bacterial suspension with 0.85% physiological saline to 10% by gradient ^-1 ~10 ^-6 The method comprises the steps of carrying out a first treatment on the surface of the Take 10 ^-4 、10 ^-5 、10 ^-6 100. Mu.L each of three dilutions of the bacterial suspension were plated on LB plates, three plates were plated on each dilution; in the same manner, a control was made by diluting the plating solution without the ultraviolet irradiation treatment. The evenly coated flat plate is wrapped by black cloth or newspaper and then placed at 37 ℃ for overnight culture. Counting the number of single colonies growing on the plate at each dilution under different irradiation time, and considering that the dilution is proper if the number of single colonies growing at a certain dilution is between 30 and 300. Grow out on three plates at this dilutionThe bacterial suspension concentration was calculated by the following formula:

bacterial suspension concentration (CFU/mL) =average number of colonies at a certain dilution x 10.

The mortality at a certain uv treatment dose was calculated according to the following formula:

mortality (%) = (1-concentration of bacterial suspension after treatment/concentration of bacterial suspension before treatment) ×100%.

The bacterial suspension is treated with a mutagen at a mortality rate of about 80% -90%. When the irradiation time is 145s, the mortality rate reaches 86.33%. Thus, the mutagenesis time finally established by the applicant was 145s.

5.2 Mutant strain screening for high-yield protein glutaminase

Colonies were picked from LB plates with a mortality rate of 86.33%, streaked to obtain single colonies, inoculated on LB plates containing 30. Mu.g/mL kanamycin, 3 parallel plates were set per group, and the starting strain was inoculated as a control, cultured at 37℃for 10 h, and co-screened for 627 mutant strains. Each single colony was inoculated into a 96-well plate containing 200uL of LB liquid medium, after shaking culture for 6 hours at 37 ℃,30 uL was transferred to a 96-well plate containing 200uL of fermentation medium (glucose 1%, disodium hydrogen phosphate 0.2%, peptone 1%, sodium chloride 1%, yeast powder 0.5%), shaking culture was performed at 37 ℃ 500rpm for 7 d, and the cells were removed by centrifugation to obtain fermentation supernatant, and the enzyme activity of protein glutaminase in the supernatant was measured, and the starting strain was used as a control to select a mutant strain having significantly improved activity of the starting enzyme.

The results show that the protein glutaminase activity in the fermentation supernatant of none of 627 mutant strains obtained by the first round of ultraviolet mutation screening is higher than that of the starting strain.

The applicant continuously carries out 17 rounds of mutation screening according to the method to finally obtain a mutant strain with the protein glutaminase yield obviously higher than that of the starting strain, which is named as bacillus subtilis ZXPM #Bacillus subtilis ZXPM). The mutant strain has the advantages that the protein glutaminase activity in the shake-flask fermentation supernatant reaches 25.3U/ml, which is improved by 125.9% compared with the starting strain, and unexpected technical effects are achieved。

5.3 Salt tolerance comparison

Respectively diluting shake flask fermentation supernatants of the bacillus subtilis ZXPB and the bacillus subtilis ZXPM with 0.1M phosphate buffers with different salt contents by 10 times to ensure that the mass percentages of NaCl in the supernatants reach 15%, 20%, 25% and 30% respectively; treated overnight at 37℃for 16h. After the completion of the reaction, the salt ions were removed by ultrafiltration with a 30K ultrafiltration tube, and the enzymatic activity of the protein glutaminase in each supernatant was measured at 37℃and pH6.0, and the residual rate of the enzymatic activity was calculated by taking the enzymatic activity of the untreated sample as 100%. The specific results are shown in Table 1.

Enzyme activity residual rate (%) =enzyme activity of treated sample/enzyme activity of untreated sample×100%.

TABLE 1 comparison of salt tolerance of fermentation supernatants of starting and mutant bacteria

As can be seen from the results in Table 1, the residual rate of the enzyme activity of the fermentation supernatant of the mutant strain Bacillus subtilis ZXPM after 16 hours of treatment under the salt content condition of 15% -30% is generally higher than that of the starting strain. When the salt content reaches 30%, the enzyme activity residual rate of the fermentation supernatant of the mutant bacteria is still up to 69.9%, and is improved by 20% compared with that of the parent bacteria. Therefore, the mutant bacillus subtilis ZXPM expressed protein glutaminase has obviously higher tolerance to high-salt environment than that of starting bacteria, and has unexpected technical effects.

EXAMPLE 6 15L tank fermentation

Fermenting the bacillus subtilis ZXPB and the bacillus subtilis ZXPM on a 15L fermentation tank respectively, wherein the formula of a culture medium used for fermentation is as follows: glucose 10 g/L, bean cake powder 15 g/L, naCl 5 g/L, K ₂ HPO ₄ 0.3 g/L, calcium chloride 5 g/L, magnesium sulfate heptahydrate 1 g/L, pH7.1.

The fermentation production process comprises the following steps: pH7.1, temperature 37 ℃, stirring speed 800rpm, ventilation rate 2.16m ³ And/h, the inoculation amount is 3%, and the dissolved oxygen is controlled to be more than 25%.

By measuring the protein glutaminase enzyme activity in the fermentation broth at different times, a fermentation enzyme activity curve can be obtained (FIG. 2).

The results show that: after 30h of fermentation, the activity of the protein glutaminase in the fermentation broth of the bacillus subtilis ZXPB of the starting strain is 63.4 and U/ml, and the activity of the fermentation enzyme of the bacillus subtilis ZXPM of the mutant strain is 143U/ml, which is improved by 125.6% compared with the starting strain, thus obtaining unexpected technical effects.

In conclusion, the mutant bacillus subtilis ZXPM provided by the invention can obviously improve the yield and salt tolerance of the protein glutaminase, is beneficial to reducing the production cost of the enzyme and improving the application effect of the enzyme, thereby being beneficial to the wide application of the enzyme in the field of food industry.

The applicant has produced the mutant strain Bacillus subtilis ZXPM at 2021, 4 and 19Bacillus subtilis ZXPM) is preserved in the China center for type culture collection (CCTCC NO: m2021407.

Sequence listing

<110> Weifang Kangdi En Biotechnology Co., ltd

QINGDAO VLAND BIOTECH Inc.

QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

<120> A Bacillus subtilis mutant strain for high-yield protein glutaminase

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 320

<212> PRT

<213> golden yellow bacillus (Chryseobacterium proteolyticum)

<400> 1

Met Lys Asn Leu Phe Leu Ser Met Met Ala Phe Val Thr Val Leu Thr

1 5 10 15

Phe Asn Ser Cys Ala Asp Ser Asn Gly Asn Gln Glu Ile Asn Gly Lys

20 25 30

Glu Lys Leu Ser Val Asn Asp Ser Lys Leu Lys Asp Phe Gly Lys Thr

35 40 45

Val Pro Val Gly Ile Asp Glu Glu Asn Gly Met Ile Lys Val Ser Phe

50 55 60

Met Leu Thr Ala Gln Phe Tyr Glu Ile Lys Pro Thr Lys Glu Asn Glu

65 70 75 80

Gln Tyr Ile Gly Met Leu Arg Gln Ala Val Lys Asn Glu Ser Pro Val

85 90 95

His Ile Phe Leu Lys Pro Asn Ser Asn Glu Ile Gly Lys Val Glu Ser

100 105 110

Ala Ser Pro Glu Asp Val Arg Tyr Phe Lys Thr Ile Leu Thr Lys Glu

115 120 125

Val Lys Gly Gln Thr Asn Lys Leu Ala Ser Val Ile Pro Asp Val Ala

130 135 140

Thr Leu Asn Ser Leu Phe Asn Gln Ile Lys Asn Gln Ser Cys Gly Thr

145 150 155 160

Ser Thr Ala Ser Ser Pro Cys Ile Thr Phe Arg Tyr Pro Val Asp Gly

165 170 175

Cys Tyr Ala Arg Ala His Lys Met Arg Gln Ile Leu Met Asn Asn Gly

180 185 190

Tyr Asp Cys Glu Lys Gln Phe Val Tyr Gly Asn Leu Lys Ala Ser Thr

195 200 205

Gly Thr Cys Cys Val Ala Trp Ser Tyr His Val Ala Ile Leu Val Ser

210 215 220

Tyr Lys Asn Ala Ser Gly Val Thr Glu Lys Arg Ile Ile Asp Pro Ser

225 230 235 240

Leu Phe Ser Ser Gly Pro Val Thr Asp Thr Ala Trp Arg Asn Ala Cys

245 250 255

Val Asn Thr Ser Cys Gly Ser Ala Ser Val Ser Ser Tyr Ala Asn Thr

260 265 270

Ala Gly Asn Val Tyr Tyr Arg Ser Pro Ser Asn Ser Tyr Leu Tyr Asp

275 280 285

Asn Asn Leu Ile Asn Thr Asn Cys Val Leu Thr Lys Phe Ser Leu Leu

290 295 300

Ser Gly Cys Ser Pro Ser Pro Ala Pro Asp Val Ser Ser Cys Gly Phe

305 310 315 320

<210> 2

<211> 966

<212> DNA

<213> golden yellow bacillus (Chryseobacterium proteolyticum)

<400> 2

atgaagaacc tgtttctgag catgatggca tttgttacag tcctgacatt taattcatgc 60

gcagatagca atggcaacca agaaatcaat ggcaaagaaa aactgagcgt caacgacagc 120

aaactgaaag attttggcaa aacagttccg gtcggcattg atgaagaaaa cggcatgatt 180

aaagtgagct ttatgctgac agcgcagttc tatgaaatca aaccgacaaa agaaaacgag 240

cagtatattg gcatgctgag acaagcagtc aaaaatgaat caccggtcca catttttctg 300

aaaccgaatt caaacgaaat cggcaaagtt gaatcagcat ctccggaaga tgtccgctac 360

tttaaaacaa ttctgacgaa agaagtcaag ggccagacaa ataaactggc atcagttatt 420

ccggatgttg cgacactgaa tagcctgttt aatcagatca aaaatcaaag ctgcggcaca 480

tcaacagcat catcaccgtg cattacattt agatatccgg ttgatggctg ctatgcaaga 540

gcacataaaa tgagacagat cctgatgaac aatggctacg attgcgaaaa acaatttgtc 600

tacggcaatc tgaaagcatc aacaggcaca tgctgcgttg catggtcata tcatgttgca 660

attctggtca gctataaaaa cgcatcaggc gtcacagaaa aacggattat tgatccgtca 720

ctgttttcaa gcggaccggt tacagataca gcttggagaa atgcatgcgt taatacatca 780

tgcggctcag catcagtttc aagctatgca aatacagcag gcaatgttta ttatcgcagc 840

ccgtcaaata gctatctgta tgataataac ctgatcaaca caaactgcgt cctgacaaaa 900

ttttcactgc tgtcaggctg ctcaccgtca ccggcaccgg atgttagcag ctgcggcttt 960

taatag 966

Claims (3)

1. The bacillus subtilis mutant strain is characterized in that the preservation number of the bacillus subtilis mutant strain is CCTCC NO: M2021407.

2. Use of a bacillus subtilis mutant strain according to claim 1 for the production of a protein glutaminase.

3. A method for producing a protein glutaminase, which comprises using the mutant bacterium according to claim 1 as a fermentation strain.

Images