CN114149934B - Protein glutaminase production strain, screening and characteristic analysis method - Google Patents
Protein glutaminase production strain, screening and characteristic analysis method Download PDFInfo
- Publication number
- CN114149934B CN114149934B CN202010927185.6A CN202010927185A CN114149934B CN 114149934 B CN114149934 B CN 114149934B CN 202010927185 A CN202010927185 A CN 202010927185A CN 114149934 B CN114149934 B CN 114149934B
- Authority
- CN
- China
- Prior art keywords
- strain
- protein
- ser
- asn
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
- C12Y305/01044—Protein-glutamine glutaminase (3.5.1.44)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a high-yield protein glutaminase strain which is named as chrysobacterium prinus chrysogenum protein ycarpus A4142 and is preserved in China general microbiological culture Collection center (China center for type 1, no. 3) in the Korean positive area of Beijing city in 7 months and with a preservation number of CGMCC NO.20337. The strain is rod-shaped, does not produce spores, is gram-negative, has round colony, full colony state, smooth edge, no nick and sticky colony. Fermenting and culturing the strain A4142 of the golden yellow bacillus in a culture medium, wherein the enzyme yield is up to 2.15U/mL. The invention also discloses a novel screening method of the protein glutaminase high-yield strain, and characteristic analysis is carried out on the strain, so that the strain is determined to be the bacillus utilis. The invention has good implementation prospect in the aspect of industrial production of protein glutaminase.
Description
Technical Field
The invention relates to the field of bioengineering, and relates to screening (enrichment culture) of protein glutaminase production strains and characteristic analysis of growth metabolism thereof.
Background
Natural proteins contain a large number of glutamine and asparagine residues which are crosslinked with other amino acids in the form of hydrogen bonds, resulting in reduced solubility of the protein, and further affecting the technological properties of the protein, such as emulsifying properties, foaming properties, gelling properties, etc., thereby limiting the application of the protein in the fields of foods, beverages, health products, medicines, etc.
Protein deamidation is a potentially useful modification of soy and other glutamine-rich proteins, and is of interest for biochemical and industrial applications. The protein modification technology can make the amino acid and peptide chain of the protein changed by physical, chemical and biological enzyme method 2 . The enzyme deamidation has wider application than the chemical treatment method because of the characteristics of high speed, mild reaction condition, high specificity and the like in protein modification.
Glutaminase, protease and peptide glutaminase may be used for deamidation of proteins. But all have certain disadvantages: the excessive use of transglutaminase causes aggregation of proteins; the protease can hydrolyze protein into short peptide, the substrate specificity is poor, and bitter taste is easy to generate; peptide glutaminase does not act on high molecular weight polypeptides and proteins and has a low degree of deamidation.
Protein glutaminase (EC3.5.1.44) is called PG for short, and is a novel deaminase 3 Can remove amino groups of various proteins, polypeptides or short peptides, only acts on glutamine groups of the proteins or peptides, has no influence on asparagine residues and free glutamine, and can not cause cross-linking and hydrolysis of the proteins, thereby improving the solubility of the proteins and the like, and having good market potential in foods 4 . However, the wild strain has low enzyme activity, so that the strain capable of producing the protein glutaminase has little research in China, and the industrial application of the protein glutaminase is limited.
In the prior report, bacteria capable of producing protein glutaminaseThere are Bacillus utilis (Chryseobacterium proteolyticum), bacillus mucilaginosus (Chryseobacterium gleum), and Bacillus indoxylus (Chryseobacterium indologenes), etc. The only protease-decomposing bacteria approved for industrial production at present have low enzyme production capacity and about 0.34U/mL enzyme activity 1 。
Disclosure of Invention
In order to overcome the defects in the prior art, one of the purposes of the invention is to establish a novel enrichment culture method, which aims to screen novel protein glutaminase strains with high enzyme activity, expand strain sources and provide high-quality strains for application in foods.
The invention provides a culture medium capable of enriching high-yield protein glutaminase strains, which can be used for screening a plurality of high-yield protein glutaminase strains, wherein the strain is preferably a strain of flavobacterium prions (Chryseobacterium proteolyticum A4142) which is preserved in China general microbiological culture Collection center (China general microbiological culture Collection center) at 7 and 10 days of 2020, and has the preservation addresses of: the preservation number of the Beijing city Chaoyang area North Chen Xili No.1 and 3 is CGMCC No.20337.
The culture medium comprises the following components in percentage by weight: lactose 5g, yeast powder 11.7g, CBZ 1g, K 2 HPO 4 0.1g，KH 2 PO 4 0.1g of sodium chloride 0.1g, pH7.2, distilled water is added to a constant volume of 1L, and the mixture is sterilized at 115 ℃ for 20min.
The bacterial colony of the bacillus thuringiensis Chryseobacterium proteolyticum A4142 is round, is full in bacterial colony state, smooth in edge, free of nicks and sticky; the strain is rod-shaped, does not produce spores and is gram-negative.
The protein glutaminase producing strain A4142 can secrete protein glutaminase, namely PG enzyme, and the strain A4142 is fermented and cultured in the culture medium for 16h, and the enzyme yield is up to 2.15U/mL, which is higher than that of the prior art report 1 The yield of the golden yellow bacillus prion QRD1265 with the highest enzyme activity is improved by 532 percent.
The invention also provides a screening method of the protein glutaminase high-yield strain, which comprises the following steps:
(1) Enrichment culture of soil suspension
And taking the soil suspension to an enrichment medium for shake culture.
Wherein, the enrichment medium is: lactose 5g, yeast powder 11.7g, CBZ 1g, K 2 HPO 4 0.1g，KH 2 PO 4 0.1g of sodium chloride 0.1g, pH7.2, distilled water is added to a constant volume of 1L, and the mixture is sterilized at 115 ℃ for 20min.
The temperature of the shaking culture is 20-37 ℃; preferably 30 ℃.
The rotation speed of the shaking culture is 150r/min-240r/min; preferably 200r/min.
The shaking culture time is 3-7 days; preferably, it is 5 days.
The enrichment medium of the method can effectively enrich strains, and has high enzyme activity and high screening efficiency.
(2) Flat plate primary screen
Diluting the bacterial liquid enriched in the step (1) by multiple ratio, coating the bacterial liquid in an LB plate, and then placing the bacterial liquid in an incubator for inverted culture for 3-5 days at 20 ℃ -37 ℃ (preferably 30 ℃). Selecting yellow or orange strain, transferring to a new LB plate, culturing for 1-2 days at 20-37 ℃ (preferably 30 ℃), then dripping 3% (w/v) KOH solution into the strain, and if the strain turns red, adding HCl for neutralization and then recovering yellow, wherein the strain is a suspected strain.
Wherein the bacterial liquid is diluted by multiple ratio, namely 100 mu L of bacterial liquid is taken into 900 mu L of sterile water, namely 10 times of bacterial liquid is diluted, and the like, so as to prepare 10 times of diluted bacterial liquid 2 、10 3 、10 4 Bacterial solutions with different dilution factors are taken out, 100 mu L of diluted bacterial solution is placed in an LB plate, and then the bacterial solutions are uniformly coated by a coating rod.
Wherein, the components of the culture medium in the LB plate comprise: 3-7g of yeast powder, 8-12g of NaCl,8-12g of tryptone and 10-20g of agar powder, and adding distilled water to fix the volume to 1L; the most suitable culture medium comprises the following components: 5g of yeast powder, 10g of NaCl,10g of tryptone, 18g of agar powder and distilled water are added to fix the volume to 1L.
(3) Shaking bottle re-screening device
The bacterial liquid after two times of activation is inoculated into a fermentation culture medium according to an inoculum size of 5% (v/v), the temperature is 20 ℃ -37 ℃ (preferably, 30 ℃), the speed is 150-240r/min (preferably, 200 r/min), the bacterial liquid is cultured for 16-20 h (preferably, 16 h), and the enzyme activity is measured at intervals.
The fermentation medium comprises the following components in percentage by weight: mgSO (MgSO) 4 ·7H 2 O 0.25g，Na 2 HPO 4 ·12H 2 O 3.8g，KH 2 PO 4 0.25g，FeSO 4 ·7H 2 O0.05 g, lactose 5g, polypeptone 10g, constant volume to 1L, adjusting pH to 7.2, sterilizing with high pressure steam at 115 ℃ for 20min.
The invention further comprises pretreatment before the step (1): preparation of soil suspension:
distilled water and 20-30 glass beads are added into a shaking flask, and the flask is sterilized by high-pressure steam at 121 ℃ for 20min. The soil sample is then added to a shake flask containing distilled water at 20-37℃ (preferably 30℃), 150-240rpm/min (preferably 200 r/min), and shaken for 30-60min (preferably 30 min) to make a 10% (w/v) soil suspension. Then placing the mixture in an ultra-clean workbench and standing the mixture.
In one embodiment, the method of screening for a protein glutaminase-producing strain comprises: preparing soil suspension, enriching and culturing the soil suspension, performing flat plate primary screening and shaking and secondary screening.
(1) Preparation of soil suspension
90mL of distilled water was added to a 250mL shake flask, and 20-30 glass beads were added, and the flask was autoclaved at 121℃for 20min. In an ultra clean bench, 10g of soil sample was weighed, added to a shake flask containing distilled water, and shaken at 30℃and 200rpm/min for 30min to prepare a 10% soil suspension. Then placing the mixture in an ultra-clean workbench and standing the mixture.
(2) Enrichment culture of soil suspension
10% (w/v) of the soil suspension was taken into enrichment medium (60 mL), and cultured at 30℃for 5 days with shaking at 200 rpm/min.
The enrichment medium is lactose 5g, yeast powder 11.7g, CBZ 1g and K 2 HPO 4 0.1g，KH 2 PO 4 0.1g of sodium chloride 0.1g, pH7.2, distilled water is added to a constant volume of 1L, and the mixture is sterilized at 115 ℃ for 20min.
The enrichment medium of the method can effectively enrich strains, and has high enzyme activity and high screening efficiency.
(3) Flat plate primary screen
Diluting the enriched bacterial liquid by multiple ratio, selecting bacterial liquid with proper gradient, taking 100 mu L of bacterial liquid into an LB plate, uniformly coating, then placing the plate into an incubator at 30 ℃, and inversely culturing for 3-5 days. Selecting yellow or orange strain, transferring to a new LB plate, culturing at 30deg.C for 1-2 days, dripping 3% (w/v) KOH solution into the strain, and recovering yellow after neutralizing with HCl if the strain turns red.
(4) Shaking bottle re-screening device
The twice activated bacterial liquid is inoculated to a fermentation medium according to an inoculum size of 5% (v/v), and is cultured for 16 hours at 30 ℃ and 200rpm/min, and the enzyme activity is measured at intervals.
The invention also provides a protein glutaminase high-yield strain prepared by the method.
The invention screens out strain A4142 by a novel method for screening protein glutaminase producing strain, the enzyme activity is 2.15U/mL, which is reported in comparison with the literature 1 The highest enzymatic activity of the bacterium aureobacterium prion QRD1265 is improved by 532 percent.
The invention also provides a fermentation culture method of the protein glutaminase, which comprises the following steps:
(1) Seed culture
The golden yellow bacillus prion solution A4142 is cultivated in a seed culture medium.
Wherein the temperature range of the culture is 20-40 ℃, the pH range is 6.0-9.0, the rpm/min is 150-240, and the culture time is 12-16h. Preferably, the temperature range of the culture is 30 ℃ and the pH range is 7.0; the rotation speed is 200rpm/min, and the culture time is 12 hours.
Wherein, the seed culture medium comprises the following formula: 10g/L polypeptone, 2g/L yeast extract, anhydrous MgSO 4 1g/L, pH 7.2.
(2) Fermentation culture
Inoculating the strain A4142 of the golden yellow bacillus to a fermentation medium at an inoculum size of 5%, culturing for 16h at 30 ℃ at 200r/min, and obtaining an enzyme yield up to 2.15U/mL, which is higher than that reported in the literature 1 The highest enzymatic activity of the bacterium aureobacterium prion QRD1265 is improved by 532 percent.
Wherein, the components of the fermentation medium are as follows: mgSO (MgSO) 4 ·7H 2 O 0.25g，Na 2 HPO 4 ·12H 2 O 3.8g，KH 2 PO 4 0.25g，FeSO 4 ·7H 2 O0.05 g, lactose 5g, polypeptone 10g, constant volume to 1L, adjusting pH to 7.2, sterilizing with high pressure steam at 115 ℃ for 20min.
The invention also provides a characteristic analysis method of the protein glutaminase-producing strain, which comprises the following steps: strain morphology observation, seed growth curve, fermentation metabolism curve, PG enzyme sequence analysis.
The invention also provides a 16S rDNA upstream and downstream primer pair for amplifying a protein glutaminase high-yield strain, which is respectively shown as SEQ ID No.1 and SEQ ID No. 2.
The invention also provides a pair of primers for amplifying the upstream and downstream of the PG enzyme gene of the protein glutaminase high-producing strain, which are respectively shown as a Seq ID No.3 and a Seq ID No. 4.
The invention carries out PCR amplification and sequencing on PG enzyme gene of protein glutaminase producing strain, and the gene sequence of A4142 is shown as Seq ID No.5 (the total DNA sequence is 963 bp); the protein sequence is shown as Seq ID No.6, wherein the total protein sequence is 320 amino acids, the signal peptide of 21 amino acids is shown as SEQ ID No.7, the propeptide of 114 amino acids is shown as SEQ ID No.8, and the mature enzyme composed of 185 amino acids is shown as SEQ ID No. 9.
The invention compares and analyzes the PG enzyme sequences of different strains, wherein the amino acid sequence similarity of the PG enzymes of A4142 and 9670T reaches 100 percent.
The invention has the beneficial effects that firstly, the invention provides the culture medium capable of enriching the high-yield protein glutaminase strains, and a plurality of strains of high-yield protein glutaminase can be screened by using the enrichment culture medium. Secondly, the strain with high-yield protein glutaminase is screened, the related strain A4142 of the golden yellow bacillus is safe and nontoxic, the growth is rapid, the enzyme yield is up to 2.15U/mL, and the yield is 532 percent higher than that of the golden yellow bacillus QRD1265 with the highest enzyme activity reported in the literature. Thirdly, knowing the growth enzyme production condition of the strain, determining the logarithmic growth phase, the rapid enzyme production phase and the highest enzyme activity point of the strain, and facilitating better guiding the application of the strain in practice.
Drawings
FIG. 1 shows the dilution spread after the soil suspension enrichment culture according to the present invention in example 1.
FIG. 2 shows the color change of the KOH strain added dropwise in example 1 according to the present invention.
FIG. 3 shows the form of F.prion (Chryseobacterium proteolyticum A4142) according to the invention in example 2.
FIG. 4 shows a growth curve of F.prion disinfestation (Chryseobacterium proteolyticum A4142) according to the invention in example 4.
FIG. 5 shows an enzyme production curve of F.prion (Chryseobacterium proteolyticum A4142) according to the invention in example 5.
FIG. 6 shows SDS-PAGE of fermentation broths of different strains according to the present invention in example 5, M is protein Marker,1 is SDS-PAGE of fermentation broths of F.prion (Chryseobacterium proteolyticum A4142) (16 h), and the arrow indicates PG enzyme band.
Detailed Description
The present invention will be described in further detail with reference to the following specific examples and drawings. The procedures, conditions, experimental methods, etc. for carrying out the present invention are common knowledge and common knowledge in the art, except for the following specific references, and the present invention is not particularly limited.
The protein glutaminase-producing strain of the present invention is A4142, which is classified and named: gold-degrading bacillus, latin academy name: chryseobacterium proteolyticum, which has been deposited in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) on the 7 th month 10 th year 2020, has a deposit address: the preservation number of the Beijing city Chaoyang area North Chen Xili No.1 and 3 is CGMCC No.20337.
The preparation of the protein glutaminase which is the fermentation product of the strain according to the present invention is carried out in the following manner.
EXAMPLE 1 selection of protein-producing glutaminase Strain
(1) Enrichment culture of soil suspension
The screening steps are as follows:
90mL of distilled water was added to a 250mL shake flask, and 20-30 glass beads were added, and the flask was autoclaved at 121℃for 20min. In an ultra clean bench, 10g of soil sample was weighed, added to a shaking flask containing distilled water, and shaken at 30℃and 200rpm/min for 30min to prepare a 10% (w/v) soil suspension. Then placing the mixture in an ultra-clean workbench and standing the mixture. 1% (v/v) of the soil suspension was taken into enrichment medium (60 mL), and cultured at 30℃for 5 days with shaking at 200 rpm/min.
The enrichment medium is as follows: lactose 5g, yeast powder 11.7g, CBZ 1g, K 2 HPO 4 0.1g，KH 2 PO 4 0.1g of sodium chloride 0.1g, pH7.2, distilled water is added to a constant volume of 1L, and the mixture is sterilized at 115 ℃ for 20min.
(2) Flat plate primary screen
Diluting the enriched bacterial liquid by multiple ratio, selecting bacterial liquid with proper gradient, taking 100 mu L of bacterial liquid into an LB plate, uniformly coating, placing the plate into an incubator at 30 ℃, and culturing for 3 days in an inverted mode. Then, observation was performed. As shown in FIG. 1, there are a plurality of strains with different forms and colors on LB plates, and according to the literature report, strains Chryseobacterium proteolyticum and 9670T for fermenting PG enzymes are Flavobacterium, the strains are yellow or yellow orange, and flexirubin reversible pigments are produced.
Wherein, the components of the culture medium in the LB plate comprise: 5g of yeast powder, 10g of NaCl,10g of tryptone, 18g of agar powder and distilled water are added to fix the volume to 1L.
As shown in FIG. 2, a yellow or orange strain was selected, transferred to a new LB plate, then cultured at 30℃for 2 days, 3% (w/v) KOH solution was added dropwise to the strain, and if the strain became red in color, the strain was recovered to yellow after neutralization with HCl, and the strain was a suspected strain.
(3) Determination of enzyme production ability of bacterial strain fermentation
Fermentation culture of protein a glutaminase
The twice activated bacterial liquid is inoculated to a fermentation medium according to an inoculum size of 5% (v/v), and is cultured for 16 hours at 30 ℃ and 200rpm/min, and the enzyme activity is measured at intervals. Wherein, the components of the fermentation medium are as follows: mgSO (MgSO) 4 ·7H 2 O 0.25g，Na 2 HPO 4 ·12H 2 O 3.8g，KH 2 PO 4 0.25g，FeSO 4 ·7H 2 O0.05 g, lactose 5g, polypeptone 10g, constant volume to 1L, adjusting pH to 7.2, sterilizing with high pressure steam at 115 ℃ for 20min.
Enzyme activity assay for protein glutaminase
Removing thalli from the fermentation liquor through 10000r/min and 4 ℃ centrifugation for 20min to obtain supernatant, diluting the supernatant 5 times, taking 0.1mL of supernatant diluent, adding the supernatant diluent into a test tube, adding 1mL of preheated 0.01mol/L Cbz-Gln-Gly solution into the supernatant diluent, carrying out a warm bath reaction for 60min at 37 ℃, adding 1mL of trichloroacetic acid solution, uniformly mixing, and stopping the reaction. The ammonia content of the solution after the reaction was measured by phenol method. A is that 630 The absorbance A1 was measured. The control group is that trichloroacetic acid solution is added first for reaction for 60min, then substrate solution is added, the rest operation is the same as that of the experimental group, and A is measured 630 Is A2. The amount of enzyme required to produce 1. Mu. Mol of ammonia per minute is defined as one enzyme activity unit (U). The calculation formula of the enzyme activity in the fermentation broth is as follows:
enzyme Activity (U/mL) = (A1-A2) ×2.1/0.1X1/17.03X1/60×aX15
A1: absorbance of the experimental group; a2: absorbance of control group; a: slope of the ammonia standard curve.
The conditions of the strain producing protein glutaminase by strain fermentation are shown in Table 1:
TABLE 1 summary of fermentation and enzyme production conditions of strains
The PG enzyme activity produced by fermenting the strain A4142 is 2.15U/mL, which is reported in comparison with the literature 1 Highest of (2)The enzymatic activity of the golden yellow bacillus QRD1265 is improved by 532 percent.
EXAMPLE 2 identification of protein-producing glutaminase strains
The suspected strains screened in the embodiment 1 of the invention are re-streaked on an LB plate to obtain single bacterial colonies, then the color and the state of the bacterial strains are observed, the bacterial colonies are round, the bacterial colonies are full in state, smooth in edge and free of nicks, and the bacterial colonies have viscosity, as shown in figure 3.
Subsequent gram staining was performed, the strain was rod-shaped, sporulated, and gram negative.
According to the using instruction of the physiological and biochemical identification tube, the strain is activated first, then is prepared into bacterial suspension, inoculated into the physiological and biochemical tube for culturing for 24 hours, and the experimental phenomenon is observed and recorded. Wherein "+" indicates that the strain is positive and "-" indicates that the strain is negative. The identification result is different from Chryseobacterium proteolyticum 9670T strain reported in Japanese literature, and shows that the strain is a novel strain of the bacterium flavobacterium prion.
TABLE 2
Extracting total genome DNA of the strain A4142, and using the total genome DNA as a template to amplify a 16SrDNA sequence of the strain, wherein the primer sequence is as follows:
SEQ ID No.1 F：5'-AGAGTTTGATCCTGGCTCAG-3'
SEQ ID No.2 R：5'-CTACGGCTACCTTGTTACGA-3'
after the PCR products were detected by 1% agarose gel electrophoresis, the tapping was recovered and sent to commercial company for sequencing. Sequencing work was done by Shanghai Sanny Inc. The similarity between the measured 16S rDNA sequence and the 16S rDNA sequence of the existing bacteria in the BLAST database shows that the homology between the strain A4142 and the strain A Chryseobacterium proteolyticum 9670T of the flavobacterium prions is highest and reaches 98%, so that the strain is the flavobacterium prions.
Example 3 identification and analysis of the protein glutaminase of Strain A4142
Extracting total genome DNA of strain A4142, and using the total genome DNA as a template to amplify the full-length DNA sequence of protein glutaminase produced by the strain, wherein the primer sequence is as follows:
SEQ ID No.3：F-proteolyticum AACTTGCTTATGTTATTTTTTTTAT
SEQ ID No.4：R-proteolyticum GGATGTTATCATACAAAAAAATAAT
after the PCR product was detected by 1% agarose gel electrophoresis, the tapping was recovered and sent to Shanghai Sannnia company for sequencing. The gene sequence of PG enzyme of strain A4142, namely SEQ ID No.5 (the total DNA sequence is 963 bp) is obtained, the sequence is translated to obtain PG enzyme protein sequence, which is shown in SEQ ID No.6, wherein the protein sequence is 320 amino acids, 21 amino acid signal peptide (shown in SEQ ID No. 7), 114 amino acid propeptide (shown in SEQ ID No. 8) and 185 amino acid mature enzyme (shown in SEQ ID No. 9).
EXAMPLE 4 growth curves of protein glutaminase-producing Strain
The strain (Chryseobacterium proteolyticum A4142) was inoculated into a seed medium, cultured at 30℃at 200rpm/min for 12 hours, and the seed solution was inoculated into a new seed medium at an inoculum size of 5% (v/v) for reactivation, and cultured at 30℃at 200rpm/min for 12 hours. Wherein the seed culture medium formula is polypeptone 10g/L, yeast extract 2g/L, anhydrous MgSO 4 1g/L, pH 7.0.
The growth curve is shown in FIG. 4, strain A4142 grows rapidly at 2h, enters the logarithmic phase, 2-6h is the logarithmic phase, and enters the stationary phase after 12h. A4142 is the bacterial concentration OD at 12-22 h 600 Maintained at 6.5-6.7.
EXAMPLE 5 enzyme production Curve of protein glutaminase-producing Strain
Bacterial liquid A4142 is inoculated into a fermentation medium, fermentation liquid samples are taken every 2 hours at 30 ℃ and 200rpm/min, and PG enzyme activity is measured.
The enzyme activity of the strain A4142 is measured by the method, the enzyme production curve is shown in FIG. 5, and the enzyme activity of the strain A4142 reaches the highest point at 16h and is 2.30U/mL.
As shown in FIG. 6, SDS-PAGE of the strain broth has a band at 18.4KD, and the strain fermentation is proved to produce PG enzyme as the theoretical molecular weight of PG enzyme 19860 reported in the literature.
Reference is made to:
1. qu Ruidan screening, identification and media optimization of protein glutaminase-producing strains [ D ]; university of eastern China, 2016.
2. Dong Xingong, zhao Mouming, jiang Yueming. Research on modification of peanut proteins proceeds [ J ]. Chinese grain and oil journal, 2011,26 (12): 109-117.
3.Yamaguchi S,Yokoe M.A novel protein-deamidating enzyme from Chryseobacterium proteolyticum sp.nov.,a newly isolated bacterium from soil[J].Applied and environmental microbiology,2000,66(8):3337-3343.
4.Jiang ZQ,Sontag-Strohm T,Salovaara H,et al.Oat protein solubility and emulsion properties improved by enzymatic deamidation[J].J Cereal Sci,2015,64:126-132.
SEQUENCE LISTING
<110> university of east China
<120> A protein glutaminase-producing Strain, screening, and characterization method
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> artificial sequence
<400> 1
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
<210> 3
<211> 25
<212> DNA
<213> artificial sequence
<400> 3
aacttgctta tgttattttt tttat 25
<210> 4
<211> 25
<212> DNA
<213> artificial sequence
<400> 4
ggatgttatc atacaaaaaa ataat 25
<210> 5
<211> 963
<212> DNA
<213> PG enzyme Gene sequence
<400> 5
atgaaaaatc tttttttatc aatgatggcc tttgtgaccg tcttaacttt taattcctgt 60
gccgattcca acgggaatca ggaaatcaac ggaaaggaaa aactaagtgt aaatgattct 120
aagctgaaag atttcggaaa gactgtaccg gtagggatag acgaagaaaa cggaatgata 180
aaggtgtcat ttatgttaac tgcgcaattc tatgaaatta agccgaccaa agaaaacgag 240
cagtatatcg gaatgcttag acaggctgtt aagaatgaat ctcctgtaca cattttctta 300
aagcctaata gcaatgaaat aggaaaagtg gagtctgcaa gcccggaaga cgtaagatat 360
tttaaaacga tcctgacaaa agaagtaaaa gggcaaacca ataaattggc gagtgtaatt 420
cctgatgtag ctacattaaa ttctttattc aatcaaataa agaatcagtc ttgcggtacc 480
tctacggcgt cctcaccatg catcacattc agatatcctg tagacggatg ttatgcaaga 540
gcccataaga tgagacaaat cttaatgaac aacggctatg actgtgaaaa acaatttgta 600
tacggaaacc taaaggcatc aacaggaact tgctgtgtgg cgtggagcta ccacgttgca 660
atattggtaa gctataaaaa tgcttccgga gtaacggaaa aaagaattat tgatccttcc 720
ctattttcaa gcggtcctgt aacagataca gcatggagaa acgcttgcgt taacacctct 780
tgcggatctg catccgtttc ctcttatgct aatactgcag gaaatgttta ttacagaagt 840
ccgagtaatt cttacctgta tgacaacaat ctgatcaata ccaactgtgt actgactaaa 900
ttttcactgc tttccggatg ttctccttca cctgcaccgg atgtatccag ctgtggattt 960
taa 963
<210> 6
<211> 320
<212> PRT
<213> PG enzyme amino acid sequence
<400> 6
Met Lys Asn Leu Phe Leu Ser Met Met Ala Phe Val Thr Val Leu Thr
1 5 10 15
Phe Asn Ser Cys Ala Asp Ser Asn Gly Asn Gln Glu Ile Asn Gly Lys
20 25 30
Glu Lys Leu Ser Val Asn Asp Ser Lys Leu Lys Asp Phe Gly Lys Thr
35 40 45
Val Pro Val Gly Ile Asp Glu Glu Asn Gly Met Ile Lys Val Ser Phe
50 55 60
Met Leu Thr Ala Gln Phe Tyr Glu Ile Lys Pro Thr Lys Glu Asn Glu
65 70 75 80
Gln Tyr Ile Gly Met Leu Arg Gln Ala Val Lys Asn Glu Ser Pro Val
85 90 95
His Ile Phe Leu Lys Pro Asn Ser Asn Glu Ile Gly Lys Val Glu Ser
100 105 110
Ala Ser Pro Glu Asp Val Arg Tyr Phe Lys Thr Ile Leu Thr Lys Glu
115 120 125
Val Lys Gly Gln Thr Asn Lys Leu Ala Ser Val Ile Pro Asp Val Ala
130 135 140
Thr Leu Asn Ser Leu Phe Asn Gln Ile Lys Asn Gln Ser Cys Gly Thr
145 150 155 160
Ser Thr Ala Ser Ser Pro Cys Ile Thr Phe Arg Tyr Pro Val Asp Gly
165 170 175
Cys Tyr Ala Arg Ala His Lys Met Arg Gln Ile Leu Met Asn Asn Gly
180 185 190
Tyr Asp Cys Glu Lys Gln Phe Val Tyr Gly Asn Leu Lys Ala Ser Thr
195 200 205
Gly Thr Cys Cys Val Ala Trp Ser Tyr His Val Ala Ile Leu Val Ser
210 215 220
Tyr Lys Asn Ala Ser Gly Val Thr Glu Lys Arg Ile Ile Asp Pro Ser
225 230 235 240
Leu Phe Ser Ser Gly Pro Val Thr Asp Thr Ala Trp Arg Asn Ala Cys
245 250 255
Val Asn Thr Ser Cys Gly Ser Ala Ser Val Ser Ser Tyr Ala Asn Thr
260 265 270
Ala Gly Asn Val Tyr Tyr Arg Ser Pro Ser Asn Ser Tyr Leu Tyr Asp
275 280 285
Asn Asn Leu Ile Asn Thr Asn Cys Val Leu Thr Lys Phe Ser Leu Leu
290 295 300
Ser Gly Cys Ser Pro Ser Pro Ala Pro Asp Val Ser Ser Cys Gly Phe
305 310 315 320
<210> 7
<211> 21
<212> PRT
<213> PG enzyme Signal peptide sequence
<400> 7
Met Lys Asn Leu Phe Leu Ser Met Met Ala Phe Val Thr Val Leu
1 5 10 15
Thr Phe Asn Ser Cys Ala
20
<210> 8
<211> 114
<212> PRT
<213> PG enzyme propeptide sequence
<400> 8
Asp Ser Asn Gly Asn Gln Glu Ile Asn Gly Lys Glu Lys Leu Ser
5 10 15
Val Asn Asp Ser Lys Leu Lys Asp Phe Gly Lys Thr Val Pro Val
20 25 30
Gly Ile Asp Glu Glu Asn Gly Met Ile Lys Val Ser Phe Met Leu
35 40 45
Thr Ala Gln Phe Tyr Glu Ile Lys Pro Thr Lys Glu Asn Glu Gln
50 55 60
Tyr Ile Gly Met Leu Arg Gln Ala Val Lys Asn Glu Ser Pro Val
65 70 75
His Ile Phe Leu Lys Pro Asn Ser Asn Glu Ile Gly Lys Val Glu
80 85 90
Ser Ala Ser Pro Glu Asp Val Arg Tyr Phe Lys Thr Ile Leu Thr
95 100 105
Lys Glu Val Lys Gly Gln Thr Asn Lys
110 114
<210> 9
<211> 185
<212> PRT
<213> PG enzyme mature peptide sequence
<400> 9
Leu Ala Ser Val Ile Pro Asp Val Ala Thr Leu Asn Ser Leu Phe
5 10 15
Asn Gln Ile Lys Asn Gln Ser Cys Gly Thr Ser Thr Ala Ser Ser
15 20 30
Pro Cys Ile Thr Phe Arg Tyr Pro Val Asp Gly Cys Tyr Ala Arg
35 40 45
Ala His Lys Met Arg Gln Ile Leu Met Asn Asn Gly Tyr Asp Cys
50 55 60
Glu Lys Gln Phe Val Tyr Gly Asn Leu Lys Ala Ser Thr Gly Thr
65 70 75
Cys Cys Val Ala Trp Ser Tyr His Val Ala Ile Leu Val Ser Tyr
80 85 90
Lys Asn Ala Ser Gly Val Thr Glu Lys Arg Ile Ile Asp Pro Ser
95 100 105
Leu Phe Ser Ser Gly Pro Val Thr Asp Thr Ala Trp Arg Asn Ala
110 115 120
Cys Val Asn Thr Ser Cys Gly Ser Ala Ser Val Ser Ser Tyr Ala
125 130 135
Asn Thr Ala Gly Asn Val Tyr Tyr Arg Ser Pro Ser Asn Ser Tyr
140 145 150
Leu Tyr Asp Asn Asn Leu Ile Asn Thr Asn Cys Val Leu Thr Lys
155 160 165
Phe Ser Leu Leu Ser Gly Cys Ser Pro Ser Pro Ala Pro Asp Val
170 175 180
Ser Ser Cys Gly Phe
185
Claims (1)
1. A high-yield protein glutaminase strain is characterized in that the strain is chrysobacterium prinus chrysogenum protein bacterium column A4142 which is preserved in China general microbiological culture collection center (CGMCC) with the preservation number of 20337 at 7/10/2020.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010927185.6A CN114149934B (en) | 2020-09-07 | 2020-09-07 | Protein glutaminase production strain, screening and characteristic analysis method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010927185.6A CN114149934B (en) | 2020-09-07 | 2020-09-07 | Protein glutaminase production strain, screening and characteristic analysis method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114149934A CN114149934A (en) | 2022-03-08 |
| CN114149934B true CN114149934B (en) | 2023-05-09 |
Family
ID=80460281
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010927185.6A Active CN114149934B (en) | 2020-09-07 | 2020-09-07 | Protein glutaminase production strain, screening and characteristic analysis method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114149934B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114717145B (en) * | 2022-03-21 | 2024-03-22 | 广西中烟工业有限责任公司 | Cucumber golden fungus and application thereof in degradation of seaweed residues |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8735131B2 (en) * | 2008-09-09 | 2014-05-27 | Amano Enzyme Inc. | Method for designing mutant protein deamidase |
| CN104736135B (en) * | 2012-10-17 | 2019-07-09 | 味之素株式会社 | Cosmetic composition |
| CN107325978B (en) * | 2016-04-28 | 2020-10-16 | 华东师范大学 | Protein glutaminase producing strain, preparation and application of fermentation product |
-
2020
- 2020-09-07 CN CN202010927185.6A patent/CN114149934B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| Complete Genome Sequenceand Characterization of a Protein-Glutaminase Producing Strain, Chryseobacterium proteolyticum QSH1265.;Ruidan Qu等;《Frontiers in Microbiology》;20180904;第9卷;全文 * |
| 应用常压室温等离子体诱变技术选育蛋白质谷氨酰胺酶高产菌株;叶坚;《中国优秀硕士学位论文全文数据库》;20190115(第01期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114149934A (en) | 2022-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110777136B (en) | Alkaline protease mutant for washing and application thereof in liquid detergent | |
| CN106754508B (en) | Bacillus subtilis strain and application thereof in soy sauce fermentation and aroma enhancement | |
| CN113549609B (en) | Carbonic anhydrase SaCA and coding gene and application thereof | |
| CN113621676B (en) | Method for one-step high-efficiency screening aflatoxin prevention and control bacteria | |
| WO2016155568A1 (en) | Streptomyces and method for producing milbemycin a3 using same | |
| CN114456993B (en) | Bacillus subtilis mutant strain for high-yield protein glutaminase | |
| CN114149934B (en) | Protein glutaminase production strain, screening and characteristic analysis method | |
| CN114806988A (en) | Bacillus subtilis and application thereof in production of glutaminase | |
| CN113308453B (en) | Amidohydrolase SaAH, and coding gene and application thereof | |
| CN116855414B (en) | Bacillus belicus and application thereof in fermented bean products | |
| CN114097459B (en) | Method for preventing and controlling aflatoxin and increasing number of active root nodules of nitrogen fixation enzyme and application | |
| CN116286565B (en) | Bacillus subtilis strain for high yield of alkaline protease and application thereof | |
| CN111808784B (en) | Heat-denitrifying Geobacillus Y62 for producing high-temperature-resistant alpha-amylase and application thereof | |
| US20230250389A1 (en) | Leuconostoc citreum and use thereof in precipitating starch emulsion | |
| CN110484477B (en) | Lactobacillus delbrueckii subsp bulgaricus strain and application thereof | |
| CN104357346B (en) | The protease producing strains of one plant of hydrolysis rice residue: bacillus subtilis and its screening and application method | |
| CN113637650A (en) | Alanine dehydrogenase SaAD and coding gene and application thereof | |
| CN113801831B (en) | Bacillus subtilis capable of producing neutral protease with high yield and application thereof | |
| CN106011010B (en) | Pseudomonas stutzeri for producing biological emulsifier | |
| CN110438039B (en) | Strain for alanine fermentation | |
| CN104805042B (en) | A kind of gas germ and its application | |
| CN116286557B (en) | Salt-tolerant bacillus beijerinckii for producing cellulase and culture method thereof | |
| CN115820470B (en) | Bacillus amyloliquefaciens ZH804 and application thereof | |
| CN114350523B (en) | Aspergillus oryzae combined microbial inoculum and application thereof in preparation of Pi county thick broad-bean sauce | |
| CN115786300B (en) | Bacillus amyloliquefaciens with low yield and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |