CN114438099A - Tobacco cadmium transporter NtNRAMP6A and application thereof - Google Patents

Tobacco cadmium transporter NtNRAMP6A and application thereof Download PDF

Info

Publication number
CN114438099A
CN114438099A CN202210150243.8A CN202210150243A CN114438099A CN 114438099 A CN114438099 A CN 114438099A CN 202210150243 A CN202210150243 A CN 202210150243A CN 114438099 A CN114438099 A CN 114438099A
Authority
CN
China
Prior art keywords
leu
gene
tobacco
ntnramp6a
cadmium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210150243.8A
Other languages
Chinese (zh)
Inventor
张吉顺
张孝廉
付强
王志红
孔德钧
林英超
陈懿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guizhou Institute of Tobacco Science
Original Assignee
Guizhou Institute of Tobacco Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guizhou Institute of Tobacco Science filed Critical Guizhou Institute of Tobacco Science
Priority to CN202210150243.8A priority Critical patent/CN114438099A/en
Publication of CN114438099A publication Critical patent/CN114438099A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a tobacco cadmium transporter NtNRAMP6A and application thereof. The tobacco NtNRAMP6A has a nucleotide sequence shown in SEQ ID NO. 1, and a coding protein of the tobacco NtNRAMP6A has an amino acid sequence shown in SEQ ID NO. 2. The NtNRAMP6A gene is obtained by cloning, and cadmium sensitive yeast transformation and tobacco gene editing prove that the NtNRAMP6A gene has a cadmium transport function and can be used for reducing the enrichment of cadmium elements in tobacco.

Description

Tobacco cadmium transporter NtNRAMP6A and application thereof
Technical Field
The invention relates to the field of genetic engineering, in particular to a tobacco cadmium transport related NtNRAMP6A gene and application thereof.
Background
Tobacco has strong cadmium enrichment capacity, and the tobacco plants can increase the cadmium concentration in smoke gas to harm the health of smokers by absorbing excessive cadmium. In addition, cadmium is one of the non-essential elements for plant growth, and the higher concentration of cadmium in soil can affect the root growth and chloroplast formation of tobacco, thereby affecting the biological yield and quality of the tobacco. The accumulation of cadmium in plants involves many processes such as absorption, transport, distribution and the like of cadmium, and the regulation network and molecular mechanism thereof are still to be further analyzed.
At present, cadmium transporters found in tobacco are relatively short, and a few of NtHMA2/4, NtNRAMP5 and the like are reported. The NRAMP gene family of plants has complex functions, wide substrate specificity, and transport activity of various metals such as iron, manganese, zinc and the like, and maintains the balance of metal ions in plants. In addition, the gene family also plays an important role in the aspects of photosynthesis, protein activity maintenance, metabolism, environmental stress response and the like. Tobacco belongs to an allotetraploid plant, the gene family members are numerous, new tobacco cadmium transport related NRAMP genes are discovered and identified, and then a new low-cadmium enriched variety is obtained by means of gene editing and the like, so that the method has important significance for guaranteeing the safety of tobacco leaves.
Disclosure of Invention
The invention aims to provide a tobacco NtNRAMP6A gene and a protein coded by the gene.
Another objective of the invention is to provide application of the tobacco NtNRAMP6A gene.
The nucleotide sequence of the tobacco NtNRAMP6A gene is shown as SEQ ID NO. 1, and the total length of the gene is 1602 bp.
The invention provides a tobacco NtNRAMP6A gene, which is a gene for coding the following protein (a):
(a) a protein consisting of an amino acid sequence shown as SEQ ID NO. 2;
the invention provides application of the tobacco NtNRAMP6A gene or mutant gene in reduction of cadmium ion enrichment of plants.
The invention also provides application of the tobacco NtNRAMP6A gene or the mutant gene in tobacco breeding. The breeding aims to reduce absorption and transportation of cadmium ions in tobacco.
Preferably, the tobacco NtNRAMP6A gene is mutated, so that the tobacco NtNRAMP6A gene is mutated to reduce the cadmium enrichment capacity of tobacco plants, or a material carrying the mutation of the NtNRAMP6A gene is obtained by means of hybridization and the like.
The invention also provides a specific PCR primer pair for amplifying the tobacco NtNRAMP6A gene, wherein the nucleotide sequence of the primer pair is shown as SEQ ID NO. 3 and 4.
The invention also provides a method for reducing the absorption and the transportation of cadmium ions in plants, which comprises the following steps:
the tobacco NtNRAMP6A gene is mutated by methods including but not limited to gene editing, mutagenesis, hybridization.
The invention clones the tobacco NtNRAMP6A from the tobacco for the first time, and verifies the biological function of the gene through yeast experiments and gene editing. The recombinant yeast with the NtNRAMP6A gene transferred into the cadmium sensitive yeast mutant strain delta ycf has cadmium sensitive characteristic, and the cadmium content of leaves of an edited homozygous plant is reduced. Therefore, the tobacco NtNRAMP6A gene provided by the invention has a cadmium transfer function.
Drawings
FIG. 1 shows the results of the yeast function complementation test in example 1 of the present invention. Wherein, A: the concentration of cadmium ions in the medium was 0. mu.M, B: the concentration of cadmium ions in the medium was 20. mu.M. In the figure, Δ ycf + Pyes2 is a negative control group (transferred into an empty vector), and Δ ycf + NtNRAMP6A is a recombinant yeast transferred into the tobacco NtNRAMP6A gene; the growth results of 10-time dilution, 100-time dilution, 1000-time dilution and 10000-time dilution on the culture medium are sequentially obtained from left to right.
Detailed Description
Example 1: tobacco NtNRAMP6A gene clone
After the tobacco K326 is sown, when 5-6 true leaves are cultivated in a greenhouse, taking fresh leaves, extracting total RNA by using a plant total RNA extraction kit of Axygen company, and carrying out reverse transcription by using a reverse transcription kit of TaKaRa company to synthesize cDNA.
Using the NRAMP gene (accession number: XM-016625392.1) in the Genbank database as a reference sequence, a forward Primer and a reverse Primer were designed using Primer 5. The nucleotide sequence of the forward primer is SEQ NO. 3: 5'-ATGGCGGCGAACTCGACCCCA-3', and the reverse primer nucleotide sequence is SEQ NO. 4: 5'-TCAATTAGTGGTCCTCTGCTGA-3' are provided.
Tobacco NRAMP6A gene amplification was performed using the KOD Fx NEO high fidelity enzyme from NEB using a cDNA template from tobacco 'K326'. The reaction system was 50. mu.l: 2 XPCR Buffer 25 uL, dNTPs 10 uL, KOD Fx NEO 1 uL, forward primer 2 uL, reverse primer 2 uL, tobacco cDNA 2 uL, dd H2O 8μL；
The amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 68 ℃ for 30 s; 35 cycles; extending for 15min at 72 ℃; keeping the temperature at 4 ℃.
And (3) carrying out gel recovery on the PCR product by using a gel recovery kit, connecting the PCR product with a pGEM-T vector, transforming the connection product into escherichia coli DH5 alpha, and inoculating the escherichia coli DH5 alpha on an LB plate with ampicillin to carry out screening culture to obtain positive clones. The positive clone is verified by adopting a colony PCR method, wherein a forward primer of the colony PCR is SEQ NO: 5: 5'-ACTGATTTACAAGCTGGAGCTC-3', and the reverse primer is SEQ NO: 6: 5'-AGAACTTCTGAAGACTCCGGCT-3' are provided.
The reaction system of colony PCR is 20 μ L, including Premix Ex Taq10 μ L, forward primer 1 μ L, reverse primer 1 μ L, dd H2O 7 μ L, bacterial liquid 1 μ L. Then, 3 independent positive clones are randomly selected from the verified positive clones and sent to a biological company for sequencing, and the sequence of the tobacco NRAMP6A gene obtained through sequencing is shown as SEQ ID NO. 1.
EXAMPLE 2 transformation and phenotypic determination of cadmium-sensitive Yeast
1. Yeast competent preparation
1) The yeast strain was Δ ycf1 (MATa; his3 Δ l; leu2 Δ 0; lys2 Δ 0; ura3 Δ 0; YDRl35c:: kan MX 4). Selecting yeast strain (delta ycf), drawing a plate on YPDA solid medium, carrying out inverted culture at 30 ℃, and waiting for the strain to grow to a proper size. A single colony is selected and inoculated into a centrifuge tube containing 3mL YPDA liquid culture medium, and the bacteria are shaken at the speed of 250rpm and the temperature of 30 ℃ for 8 to 12 hours. 5. mu.L of the inoculum was aspirated into a 250mL Erlenmeyer flask containing 50mL YPDA broth. Shaking at 250rpm at 30 deg.C for 16-20 hr, measuring OD value, and stopping shaking when OD600 reaches 0.15-0.3.
2) The cells were collected by centrifugation at 700g for 5min at room temperature, the supernatant was discarded, and 100mL of YPDA liquid medium was added to resuspend the cells. Shaking at 250rpm for 3-5 hr at 30 deg.C until OD600 is 0.4-0.5. 50mL of the bacterial solution was collected by centrifugation at 700g for 5 min. 30mL of sterile ultrapure water was added thereto, and the cells were resuspended. The cells were collected by centrifugation at 700g for 5 min. The supernatant was discarded, and 1.5mL of 1.1xTE/LiAc was added to resuspend the cells.
3) The bacterial solution was transferred to a 1.5mL centrifuge tube and centrifuged at high speed for 15 s. The supernatant was discarded, 600uL of 1.1xTE/LiAc was added, and the cells were resuspended to obtain yeast competent cells.
2. Construction and transformation of recombinant yeast expression vector
1) The T vector to which the NRAMP6A gene described in example 1 was ligated and the yeast expression vector pYES2 were subjected to Smal I and BamH I double digestion, respectively, and the objective gene and the expression vector pYES2 were recovered and ligated with ligase. Obtaining a recombinant expression vector NRAMP6A-pYES2 containing a target gene, then carrying out PCR amplification and sequencing verification, and sequencing a correct plasmid, namely the recombinant yeast expression vector.
2) mu.L of recombinant plasmid and 10. mu.L of denatured Yeast maker host DNA were added to a pre-cooled centrifuge tube (1.5mL) and mixed well. Add 100. mu.L yeast competent cells and 500. mu.L PEG/LiAc and mix gently. Incubating in 30 deg.C incubator for 30min, adding 20 μ L DMSO, and mixing.
3) Warm-bathing in 42 deg.C water bath for 15 min. High speed centrifugation is carried out for 1min to collect thalli. The supernatant was discarded and 1mL YPD Plus liquid medium was added. Shaking and culturing at 150rpm for 30min at 30 ℃. High speed centrifugation is carried out for 1min to collect thalli. The supernatant was discarded, and 1mL of 0.9% (w/v) NaCl solution was added to resuspend the cells.
4) Coating the plate, and culturing in an inverted incubator at 30 deg.C for 2-3 days.
3. Phenotypic characterization of recombinant yeasts
1) Single clones were picked from yeast transformation plates into SD-Ura medium and shaken overnight at 180rpm at 30 ℃.
2) Collecting the bacterial liquid by using a 2mL centrifuge tube, centrifuging for 60s at 12000rpm for 1.5mL each time, collecting twice, washing the thalli by using sterile water for 2-3 times, centrifuging, discarding supernatant, adding 1mL sterile water, sucking, beating and uniformly mixing, taking 200 mu L to measure the light absorption value of OD600, and measuring for three times.
3) Absorbance at OD600 of 10-1、10-2、10-3And 10-4Gradient dilutions were performed and spotting was performed on solid media containing 0 μ M and 20 μ M cadmium, respectively.
4) The cells were cultured in an inverted state at 30 ℃ for 3 to 7 days, and photographed by observation.
The results show (fig. 1) that the growth states of the yeast (Δ ycf + pYES2) transferred to the unloaded control group and the recombinant yeast (Δ ycf + NtNRAMP6A) transferred to the tobacco NRAMP6A gene are consistent on a cadmium-free medium (fig. 1A), while the growth of the recombinant yeast (Δ ycf + NtNRAMP6A) transferred to the tobacco NRAMP6A gene is obviously inhibited on a cadmium-containing medium (fig. 1B) compared with the yeast (Δ ycf + pYES2) transferred to the unloaded control group, and the tobacco NRAMP6A gene is proved to have cadmium absorption and transport functions.
Example 3 tobacco NRAMP6A Gene editing and cadmium determination
1) SgRNA design and vector construction of NRAMP6A gene
Design specific sgRNA: GAGCTTGGATATGCAAAGC, the sgRNA is connected to the vector by gateway method to obtain a recombinant vector, and the recombinant CRISPR/Cas9 vector is obtained.
2) Genetic transformation and mutation detection
The constructed recombinant CRISPR/Cas9 vector is transferred to agrobacterium-infected GV3101 through heat shock, the recombinant CRISPR/Cas9 vector is transferred to cultivated tobacco K326 through a tobacco genetic transformation experiment by obtaining positive clone, a resistant bud growing on a resistant culture medium is transferred to a rooting culture medium, and after a root grows out, a small amount of water is added for hardening seedlings for 2-3 days; and (4) taking out the seedlings after hardening, washing off the root culture medium, transferring the seedlings to a tobacco seedling culture medium, and culturing the seedlings in an artificial climate chamber. Extracting genome DNA sequencing to identify the mutation situation of the target sequence, wherein the mutation form of the T2-N strain is as follows: TTTTTTGTGGAGCTTGGATA- -GCCGGAGTC, while the sequence of wild type K326 is TTTTTTGTGGAGCTTGGATATGCAAAGCCGGAGTC, which demonstrates that the strain is mutated.
3) Determination of cadmium content
Simultaneously sowing an edited homozygous strain T2-N and a wild type K326, transplanting the seedlings into a water culture device when the seedlings grow to 6-8 leaves, culturing the seedlings in a Horgland nutrient solution of 1/2 for 2 weeks, respectively treating the seedlings by using 20 mu M CdCl2 solution, respectively sampling the seedlings after 10 days of treatment, and determining the cadmium content of the sample by adopting a GC-MS (gas chromatography-mass spectrometry) method after water-removing and drying.
The result shows that the cadmium content of the leaf of the wild control K326 is 73mg/Kg, the cadmium content of the leaf of the editing line is 48mg/Kg, and the mutant tobacco NtNRAMP6A gene can obviously reduce the cadmium content of the tobacco leaf.
Sequence listing
<110> Guizhou province tobacco science research institute
<120> tobacco cadmium transporter NtNRAMP6A and application thereof
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1602
<212> DNA
<213> NtNRAMP6A
<400> 1
atggcggcga actcgacccc acagccgcag tttatgacaa acactgcaaa caataacctt 60
tcaaatcagc cactgattga tgatatcgaa tatgatcaga ttgttgtacc cgataagaaa 120
agctggaaga acatattttc atatgttggt cctggtttcc ttgtttgtat tgcctatatc 180
gatcctggaa attttcaaac tgatttacaa gctggagctc aatacaaata tgggttgctt 240
tggataatct tactggcttc ctttgctgct cttgtgatcc aatccttggc agcaaatcta 300
ggggtggtta cagggaagca tttagcggag cattgtagaa aggagtaccc aaaggtgcca 360
aatttcatct tatggatcat agcagaaatc gctattgtgg catgtgacat tcctgaggtt 420
attgggacag catttgcttt aaacatgctg ttcaaaatac caatatggtg cggtgtgctg 480
atcacagggc tgagtacttt gagtctacta ttattacaac agtatggggt tcggaaactt 540
gaattcttga ttgcattcct tgtacttacc atagctgtat gcttttttgt ggagcttgga 600
tatgcaaagc cggagtcttc agaagttctc catgggcttt ttgttcctca actcaaaggg 660
agtggtgcaa ctaagcttgc tatttcccta cttggtgcta tggttatgcc gcacaatctt 720
ttcctccatt cagccctggt gctttccagg aaaattcctc gatctgtcaa tggcatcagg 780
gacgcatgca gatattatct aatcgaaagt ggtctggctt tgatggtggc atttcttatc 840
aacatatcag ttatctcagt cagtggtgct gtctgcaatt ccgcaactat gaccccagat 900
gaccgggaga agtgtgagga cttagacctg aacaaagcct cttttttact caaaaatgtt 960
ttaggcaact ggagttccaa gctatttgca attgctttac tagcatccgg acagagttcg 1020
acaataactg ggacatatgc cgggcaatac gttatgcagg gttttcttga tttgcggctg 1080
aagccgtgga taaggaactt cttaactcgt agcttagcta tagtcccaag tttagttgtt 1140
tcactcattg gaggctctgc tggggctgga gacttgatca ttattgcttc gatgatctta 1200
tcttttgagc tgccctttgc tctgattcca ttgctcaaat tcacaagcag taaaaccaag 1260
atgggttcac atgtaaatcc aattgcggtt tcaggagcaa cctggctaat tggcacactc 1320
atcatgggaa taaatatata ttatctagca gaaaagttgg ttacttctct caaggatagc 1380
catttaggaa aggcggttaa ggttctatgt ggaatattag gcgccttgtg tttgttagtt 1440
tatctgtgca gtatcttata cttggctatc cgaaaaaata aggaaagcac acaccttctg 1500
gcgcttacag ggcaagaagg tttacaagtt tctgaatcaa acaatctacc tagagaggac 1560
attctgcgca tgcagttgcc tcagcagagg accactaatt ga 1602
<210> 2
<211> 533
<212> PRT
<213> NtNRAMP6A
<400> 2
Met Ala Ala Asn Ser Thr Pro Gln Pro Gln Phe Met Thr Asn Thr Ala
1 5 10 15
Asn Asn Asn Leu Ser Asn Gln Pro Leu Ile Asp Asp Ile Glu Tyr Asp
20 25 30
Gln Ile Val Val Pro Asp Lys Lys Ser Trp Lys Asn Ile Phe Ser Tyr
35 40 45
Val Gly Pro Gly Phe Leu Val Cys Ile Ala Tyr Ile Asp Pro Gly Asn
50 55 60
Phe Gln Thr Asp Leu Gln Ala Gly Ala Gln Tyr Lys Tyr Gly Leu Leu
65 70 75 80
Trp Ile Ile Leu Leu Ala Ser Phe Ala Ala Leu Val Ile Gln Ser Leu
85 90 95
Ala Ala Asn Leu Gly Val Val Thr Gly Lys His Leu Ala Glu His Cys
100 105 110
Arg Lys Glu Tyr Pro Lys Val Pro Asn Phe Ile Leu Trp Ile Ile Ala
115 120 125
Glu Ile Ala Ile Val Ala Cys Asp Ile Pro Glu Val Ile Gly Thr Ala
130 135 140
Phe Ala Leu Asn Met Leu Phe Lys Ile Pro Ile Trp Cys Gly Val Leu
145 150 155 160
Ile Thr Gly Leu Ser Thr Leu Ser Leu Leu Leu Leu Gln Gln Tyr Gly
165 170 175
Val Arg Lys Leu Glu Phe Leu Ile Ala Phe Leu Val Leu Thr Ile Ala
180 185 190
Val Cys Phe Phe Val Glu Leu Gly Tyr Ala Lys Pro Glu Ser Ser Glu
195 200 205
Val Leu His Gly Leu Phe Val Pro Gln Leu Lys Gly Ser Gly Ala Thr
210 215 220
Lys Leu Ala Ile Ser Leu Leu Gly Ala Met Val Met Pro His Asn Leu
225 230 235 240
Phe Leu His Ser Ala Leu Val Leu Ser Arg Lys Ile Pro Arg Ser Val
245 250 255
Asn Gly Ile Arg Asp Ala Cys Arg Tyr Tyr Leu Ile Glu Ser Gly Leu
260 265 270
Ala Leu Met Val Ala Phe Leu Ile Asn Ile Ser Val Ile Ser Val Ser
275 280 285
Gly Ala Val Cys Asn Ser Ala Thr Met Thr Pro Asp Asp Arg Glu Lys
290 295 300
Cys Glu Asp Leu Asp Leu Asn Lys Ala Ser Phe Leu Leu Lys Asn Val
305 310 315 320
Leu Gly Asn Trp Ser Ser Lys Leu Phe Ala Ile Ala Leu Leu Ala Ser
325 330 335
Gly Gln Ser Ser Thr Ile Thr Gly Thr Tyr Ala Gly Gln Tyr Val Met
340 345 350
Gln Gly Phe Leu Asp Leu Arg Leu Lys Pro Trp Ile Arg Asn Phe Leu
355 360 365
Thr Arg Ser Leu Ala Ile Val Pro Ser Leu Val Val Ser Leu Ile Gly
370 375 380
Gly Ser Ala Gly Ala Gly Asp Leu Ile Ile Ile Ala Ser Met Ile Leu
385 390 395 400
Ser Phe Glu Leu Pro Phe Ala Leu Ile Pro Leu Leu Lys Phe Thr Ser
405 410 415
Ser Lys Thr Lys Met Gly Ser His Val Asn Pro Ile Ala Val Ser Gly
420 425 430
Ala Thr Trp Leu Ile Gly Thr Leu Ile Met Gly Ile Asn Ile Tyr Tyr
435 440 445
Leu Ala Glu Lys Leu Val Thr Ser Leu Lys Asp Ser His Leu Gly Lys
450 455 460
Ala Val Lys Val Leu Cys Gly Ile Leu Gly Ala Leu Cys Leu Leu Val
465 470 475 480
Tyr Leu Cys Ser Ile Leu Tyr Leu Ala Ile Arg Lys Asn Lys Glu Ser
485 490 495
Thr His Leu Leu Ala Leu Thr Gly Gln Glu Gly Leu Gln Val Ser Glu
500 505 510
Ser Asn Asn Leu Pro Arg Glu Asp Ile Leu Arg Met Gln Leu Pro Gln
515 520 525
Gln Arg Thr Thr Asn
530
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 3
atggcggcga actcgacccc a 21
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 4
tcaattagtg gtcctctgct ga 22
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 5
actgatttac aagctggagc tc 22
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 6
agaacttctg aagactccgg ct 22
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 7
gagcttggat atgcaaagc 19
<210> 8
<211> 29
<212> DNA
<213> T2-N
<400> 8
ttttttgtgg agcttggata gccggagtc 29
<210> 9
<211> 35
<212> DNA
<213> K326
<400> 9
ttttttgtgg agcttggata tgcaaagccg gagtc 35

Claims (8)

  1. The application of the NRAMP6A gene in reducing absorption and transportation of plant cadmium ions is disclosed, wherein the nucleotide sequence of the NRAMP6A gene is shown as SEQ ID NO. 1.
  2. The application of NRAMP6A gene in preparing transgenic plants, wherein the nucleotide sequence of NRAMP6A gene is shown as SEQ ID NO. 1.
  3. The application of NRAMP6A in plant breeding is shown in SEQ ID NO. 1, wherein the nucleotide sequence of the NRAMP6A gene is shown in SEQ ID NO. 1.
  4. 4. The use according to claim 2, for the purpose of breeding to reduce cadmium ion uptake and transport in plants.
  5. 5. The use according to claim 3, for the purpose of breeding to reduce cadmium ion uptake and transport in plants.
  6. 6. Use according to claim 2 or 3, wherein the plant is tobacco.
  7. 7. The amino acid sequence of NRAMP6A gene of claim 1, 2 or 3, as represented in SEQ ID NO. 2.
  8. 8. A method for reducing absorption and transport of cadmium ions in plants, comprising: the method for mutating the NRAMP6A gene in tobacco comprises gene editing, mutagenesis and hybridization.
CN202210150243.8A 2022-02-18 2022-02-18 Tobacco cadmium transporter NtNRAMP6A and application thereof Pending CN114438099A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210150243.8A CN114438099A (en) 2022-02-18 2022-02-18 Tobacco cadmium transporter NtNRAMP6A and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210150243.8A CN114438099A (en) 2022-02-18 2022-02-18 Tobacco cadmium transporter NtNRAMP6A and application thereof

Publications (1)

Publication Number Publication Date
CN114438099A true CN114438099A (en) 2022-05-06

Family

ID=81374142

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210150243.8A Pending CN114438099A (en) 2022-02-18 2022-02-18 Tobacco cadmium transporter NtNRAMP6A and application thereof

Country Status (1)

Country Link
CN (1) CN114438099A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116199760A (en) * 2023-04-07 2023-06-02 西北农林科技大学 Wheat metal transporter TaNRAMP3 and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103917646A (en) * 2011-11-04 2014-07-09 独立行政法人农业环境技术研究所 Cadmium absorption regulation gene, protein, and rice plant having reduced cadmium absorption
CN105274121A (en) * 2015-12-04 2016-01-27 中国林业科学研究院亚热带林业研究所 Gene capable of promoting cadmium accumulation and application of gene
CN111334524A (en) * 2020-02-19 2020-06-26 山东农业大学 Method for improving cadmium sensitivity of tobacco
CN111349650A (en) * 2020-02-19 2020-06-30 山东农业大学 Method for improving cadmium sensitivity of apple callus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103917646A (en) * 2011-11-04 2014-07-09 独立行政法人农业环境技术研究所 Cadmium absorption regulation gene, protein, and rice plant having reduced cadmium absorption
CN105274121A (en) * 2015-12-04 2016-01-27 中国林业科学研究院亚热带林业研究所 Gene capable of promoting cadmium accumulation and application of gene
CN111334524A (en) * 2020-02-19 2020-06-26 山东农业大学 Method for improving cadmium sensitivity of tobacco
CN111349650A (en) * 2020-02-19 2020-06-30 山东农业大学 Method for improving cadmium sensitivity of apple callus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GENBANK: ""metal transporter Nramp6-like isoform X1 [Nicotiana tomentosiformis]"，Accession Number：XP_009594426.2", 《GENBANK》, pages 1 - 2 *
GENBANK: ""PREDICTED: Nicotiana tabacum metal transporter Nramp6-like (LOC107801964), transcript variant X4, mRNA"，Accession Number： XM_016625417.1", 《GENBANK》, pages 1 - 2 *
REMY CAILLIATTE ET AL.: ""The NRAMP6 metal transporter contributes to cadmium toxicity"", 《BIOCHEM. J.》, vol. 422, pages 217 - 228 *
余沁 等: ""烟草NRAMP家族全基因组鉴定及响应重金属胁迫的表达分析"", 《分子植物育种》, pages 1 - 22 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116199760A (en) * 2023-04-07 2023-06-02 西北农林科技大学 Wheat metal transporter TaNRAMP3 and application

Similar Documents

Publication Publication Date Title
CN112831478B (en) Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof
CN107299103B (en) Thick boisiana IpASR gene and its coding albumen and application
CN111018959B (en) Application of BMDR protein and coding gene thereof in regulating and controlling plant drought resistance
CN106754957B (en) OsSCAMP13 gene, encoding protein, application of stress resistance and acquisition method
KR20230009299A (en) Protein gsw8 for regulating and controlling grain shape and thousand grain weight of rice, and coding gene and application of protein gsw8
CN109879944B (en) EAR1 protein related to plant drought resistance and coding gene and application thereof
CN110452911A (en) Corn ATP binding cassette transporter body protein raq gene ZmABCE2 and application
CN114606245B (en) Tea tree CsVAAT3 gene and application thereof
CN110183526B (en) Protein OsPPR5 for controlling rice grain thickness and thousand grain weight and coding gene and application thereof
CN109355295B (en) Peanut AhWRKY75 gene and application thereof in improving peanut salt tolerance
CN114438099A (en) Tobacco cadmium transporter NtNRAMP6A and application thereof
CN113621625A (en) Application of sesame SiERF103 gene in enhancing plant resistance
CN107177603A (en) Tobacco growing element transport protein NtPIN4 and its application
CN114657188B (en) Gene PK1 for regulating cadmium accumulation of rice, protein and application thereof
CN114540373B (en) Gene for reducing cadmium content in rice grains and application thereof
CN114410658B (en) Gene OsWNK9 for reducing cadmium content of rice brown rice, encoding protein and application thereof
CN116041460A (en) Rice Xa48 (t) protein and application of coding gene thereof
CN110156883A (en) Tobacco SLs signal transducer NtDAD2 and its encoding gene, recombinant expression carrier, gene editing carrier and application
CN112029777B (en) OsALIS4 gene for reducing rice setting percentage and protein obtained by encoding same and application thereof
CN113337522B (en) Application of cotton GhNFYC4 gene in promoting plant flowering
CN115850413A (en) Polypeptide CYS3 influencing seed germination
CN111073896B (en) Gene for controlling corn grain filling, encoding product, primer, carrier and application
CN111560055B (en) Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat
CN114921583A (en) QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application
CN110407922B (en) Rice cold-resistant gene qSCT11 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20220506