CN111349650A - Method for improving cadmium sensitivity of apple callus - Google Patents

Abstract

The invention relates to a method for improving cadmium sensitivity of apple calluses, in particular to a method for over-expressing MhNRAMP6 gene in the healing of apples, wherein the Open Reading Frame (ORF) length of the MhNRAMP6 gene is 1638bp, and the protein containing 545 amino acids is coded, is predicted to have the molecular weight of 59.12kD, is positioned in a plasma membrane and has 11 strong transmembrane helices; the nucleotide sequence is shown in SEQ No. 1. The cadmium sensitivity of the apple calluses containing the overexpression gene MhNRAMP6 is stronger, so that the cadmium resistance of the apple calluses is reduced, and the problems that the fruit trees generate various stress reactions and the fruit yield and quality are influenced due to aggravation of heavy metal Cd pollution in orchards are solved.

Description

Method for improving cadmium sensitivity of apple callus

Technical Field

The invention relates to a method for improving cadmium sensitivity of apple callus, and belongs to the field of research on influence of cadmium on growth of apples.

Background

Cadmium (Cadmium, Cd) is a heavy metal with strong toxicity, and can inhibit plant growth at a lower concentration. After long-term absorption and accumulation, plant cells can be promoted to generate a large amount of active oxygen, protein denaturation and inactivation are promoted, plant cell membranes are further damaged, internal structures of the cells are damaged, cell metabolic balance is damaged, leaves are speckled, photosynthesis efficiency is reduced, plants grow slowly and are short and small, even plant pathological changes and death are caused, and finally crop yield and quality are affected (Semiaquilegia linguae et al, 2013; Malaya et al, 2014). With the industrial development, the pollution of water sources, the emission of waste gas and the like cause that the cadmium content of soil partially used for agriculture in China seriously exceeds the standard, and the cadmium content of the soil in some areas even reaches 124mg kg^-1(Yuan et al, 2016). Soil in many orchards has also become cadmium contaminated, seriously threatening fruit safety (Cheng et al, 2015).

Cadmium in edible parts of fruits and crops is enriched in human bodies in a first-level and first-level mode in a food chain transmission mode, and harm is caused to human health. Cadmium can cause cardiovascular and cerebrovascular diseases, cause hypertension and cardiovascular dilatation, inhibit hemoglobin synthesis, interfere absorption of trace elements, and cause kidney function damage and lung damage; cadmium can also destroy bone calcium, and if the cadmium is taken for a long time, the cadmium can cause the problems of osteoporosis and even spinal deformity, and irreversible damage can be caused to reproductive systems, for example, "pain bone disease" is a disease caused by cadmium pollution (Akesson et al, 2014; Zhang Jia, 2016).

The apple is one of four fruits in the world, and the apple yield and cultivation area are the top of the world in China. The apple is cultivated by mainly utilizing a stock for grafting propagation (Zhou et al, 2016), and the stock is used as a receptor for apple production, so that the growth and development of overground parts can be regulated, and the yield and the quality of fruits are improved. The Malus hupehensis Rehd is a precious and scarce excellent apple stock resource produced in China, has developed root system, and has extremely strong waterlogging resistance, cold resistance and disease resistance and extremely strong adaptability. The cadmium absorption capacity of the root system of the stock is adjusted, so that the cadmium absorption capacity has important significance for improving the overground part growth and development of fruit trees and the safety of fruits.

Disclosure of Invention

Aiming at the problems, the invention provides a method for improving cadmium sensitivity of apple calli, and the invention utilizes an over-expression gene MhNRAMP6 to improve the cadmium sensitivity of the apple calli and reduce the cadmium resistance of the apple calli.

The inventor utilizes homologous cloning and PCR technology to separate an MhNRAMP (natural resistance associated macrophage protein) gene from the root system of Malus hupehensis Rehd, the Open Reading Frame (ORF) length of the MhNRAMP gene is 1638bp, the MhNRAMP gene codes a protein containing 545 amino acids, the molecular weight of the protein is predicted to be 59.12kD, the protein is positioned in a plasma membrane, and 11 strong transmembrane helices are provided, so that the protein is presumed to be a transmembrane protein. The homology of MhNRAMP6 and MdNMAMP 6 of apple is the highest and reaches up to 99.08 percent, the gene is named as MhNRAMP6, and the nucleotide sequence of the gene is shown as SEQ No. 1.

The technical scheme of the invention is as follows:

a method for improving cadmium sensitivity of apple callus is to overexpress MhNRAMP6 gene in the apple callus. The method comprises the following specific steps:

(1) PCR amplification is carried out on pMD18-T-MhNRAMP6 by using a specific primer with an enzyme cutting site, a product is recombined with pROKII, a plant over-expression vector pROKII-MhNRAMP6 containing MhNRAMP6 gene is constructed, agrobacterium tumefaciens GV3101 is transformed, and a positive strain of the expression vector with a target fragment is obtained; the specific primers and the restriction enzyme sites are as follows:

F:CGGGAATGGCTGTGGCCAGTACGG(BamHI)；

R：GGGGTAGGTCTACCGAAAATATCGA(KpnI)；

(2) and (3) infecting apple calluses with the positive strains, culturing the apple calluses by using an MS solid culture medium containing 30mg/L kanamycin and 250mg/L cefamycin, and then obtaining the apple calluses with the MhNRAMP6 gene overexpression by using a PCR technology.

The overexpression MhNRAMP6 gene can improve the absorption speed of the apple callus on cadmium, increase the accumulation of cadmium in the apple callus and improve the cadmium sensitivity of the apple callus.

Compared with the prior art, the invention has the following advantages:

according to the invention, the MhNRAMP6 gene is overexpressed in apple healing, and experiments prove that the cadmium sensitivity of the apple callus with the overexpressed MhNRAMP6 gene is stronger, so that the cadmium resistance of the apple callus is reduced, and the problems that the fruit yield and the quality are influenced due to various stress reactions of fruit trees caused by aggravation of heavy metal Cd pollution in orchards are solved.

Drawings

FIG. 1 shows the growth of transgenic MhNRAMP6 and wild-type yeast under cadmium treatment;

FIG. 2 shows CdSO 5. mu.M₄Growth curve of yeast under treatment conditions;

FIG. 3 shows the cadmium content after 84h growth of MhNRAMP6 and wild-type yeast;

FIG. 4 is the PCR electrophoretogram of MhNRAMP6 gene in the healed transgenic apple;

FIG. 5 is an analysis of the expression of MhNRAMP6 in transgenic apple healed;

FIG. 6 shows growth phenotype of wild type and MhNRAMP6 transgenic apple calli under cadmium treatment;

FIG. 7a is a fresh weight bar graph of wild type and MhNRAMP6 transgenic apple calli under cadmium treatment; FIG. 7b is the relative conductivity of wild type and MhNRAMP6 transgenic apple calli under cadmium treatment;

FIG. 8 shows overexpression of MhNRAMP6 apple callus on Cd²⁺Bar graph of flow rate effect;

FIG. 9 is cadmium fluorescence staining of wild type and MhNRAMP6 transgenic apple calli;

FIG. 10 shows the cadmium content of wild type and MhNRAMP6 transgenic apple calli.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. The examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example (b): method for improving cadmium sensitivity of apple callus

The MhNRAMP6 gene is overexpressed in apple heals, the Open Reading Frame (ORF) length of the MhNRAMP6 gene is 1638bp, a protein containing 545 amino acids is encoded, the predicted molecular weight of the protein is 59.12kD, the protein is positioned in a plasma membrane, and 11 strong transmembrane helices are provided; the nucleotide sequence is shown in SEQ No. 1. The specific method comprises the following steps:

(1) PCR amplification is carried out on pMD18-T-MhNRAMP6 by using a specific primer with an enzyme cutting site, a product is recombined with pROKII, a plant over-expression vector pROKII-MhNRAMP6 containing MhNRAMP6 gene is constructed, agrobacterium tumefaciens GV3101 is transformed, and a positive strain of the expression vector with a target fragment is obtained; the specific primers and the restriction enzyme sites are as follows:

F:CGGGAATGGCTGTGGCCAGTACGG(BamHI)；

R：GGGGTAGGTCTACCGAAAATATCGA(KpnI)；

(2) the positive strain is infected with wild apple callus, the apple callus is cultured by an MS solid culture medium containing 30mg/L kanamycin and 250mg/L cefamycin, and then the apple callus with the MhNRAMP6 gene overexpression, namely the apple callus with stronger sensitivity to cadmium, is obtained by utilizing a PCR technology.

Examples of the experiments

1 test Material

1.1 apple callus Material and treatment

The experiments were carried out in the greenhouse and fruit tree biology focus laboratory of Shandong university of agriculture. Apple callus: the cells were cultured in the dark at a temperature of 25 ℃ and subcultured every two weeks. The callus solid culture medium comprises: adding 1.6mgL of MS solid minimal medium ^-12,4-D and 0.4mgL^-16-BA. Selecting well-grown callus, and culturing in 50 μ M CdSO₄The treatment is carried out for 15 days.

1.2 strains and vectors

The strains used in this experiment were Escherichia coli (Escherichia coli) Trans 5 α and Agrobacterium LBA4404, both from Beijing Quanyujin Biotechnology (TRANS) Inc. and the yeast strain BY4741, commercially available.

1.3 enzymes, kits and primers

Restriction enzymes, Easy Taq enzyme, TransTaq HiFi DNA Polymerase were purchased from Total gold Biotech (TRANS) Inc. of Beijing.

cDNA reverse transcription kit (PrimeScript)^TMII 1st Strand cDNA Synthesis Kit,6210A), reverse transcription Kit PrimeScript^TMRT reagent Kit with gDNA Eraser (Perfect Real Time, TaKaRa, RR047A) and fluorescent Real-Time quantitative PCR Kit TB Green^TMPremix Ex Taq^TMII (TaKaRa, RR820Q) was supplied by Takara Bio Inc.; RNAprep Pure polysaccharide polyphenol Plant total RNA extraction kit (DP441), DNA gel recovery kit (Axygen), plasmid mini-extraction kit, Plant genome DNA extraction kit (Plant Genomic DNAkit), provided by Beijing Tiangen (TIANGEN) Biochemical technology limited; the Ligation kit Ligation-Freecloning System is available from Eremon Biotechnology Inc. (ABM, Canada).

Experimental all primer sequence synthesis and sequencing was done by Huada Biotechnology Ltd.

1.4 Experimental instruments

(1) Climatic chambers, Ningbo City electric apparatus manufacturing Co., Ltd;

(2) applied Biosystems Veriti PCR instrument, ABI, usa;

(3) real-time fluorescent quantitative PCR instrument

Roche diagnostic products (shanghai) limited;

(4) ultramicro Spectrophotometer Nanodrop-2000UV-Vis Spectrophotometer, ThermoFisher Scientific Inc (USA);

(5) electrophoresis gel imaging SmartGel^TMImage Analysis System, Beijing Suizhi Chuangye science and technology Limited;

(6) table-top high speed refrigerated centrifuge SIGMA 3-18K, Germany;

(7) mini-palm centrifuge Mini-10K, Hema Medical Instrument co.ltd (pearl sea);

(8) ultra-high resolution laser confocal microscopy, ZEISS, germany;

1.5 preparation of reagents and media

(1) The non-damage micrometering test solution formula comprises the following components:

testing liquid: 0.1mM KCl, 0.1mM CaCl₂，0.05mM CdSO₄，0.3mM MES，pH5.8；

(2) LB body culture medium: collecting NaCl5g, collecting yeast extract 2.5g, collecting peptone 5g, collecting agar powder 7.5g (no agar is required for liquid culture medium), and adding ddH₂O and making into volume of 500ml, autoclaving at 121 deg.C for 20min, cooling to 60 deg.C, adding ampicillin (Amp) or kanamycin (Kan) to 100 mg.L^-1And 50 mg. L^-1And (5) waiting for antibiotics, pouring the plate, and storing at 4 ℃ for later use.

(3) YPDA medium: collecting tryptone 10g, yeast extract 5g, and adenine 0.2%, adding ddH 450ml₂O, adjusting pH to 6.5, autoclaving at 121 deg.C for 20min, cooling to 60 deg.C, and adding 20% glucose (filtered and sterilized) 50 ml.

(4) Preparation method of Yeast Selective Medium SD-U (100 ml): 0.67g nitrogen source, 2mg tryptophan, 10mg leucine, 2mg histidine, plus ddH₂Supplementing 90ml of glucose, autoclaving at 121 deg.C for 20min, cooling to about 60 deg.C, and adding 10ml of 20% glucose (which has been sterilized by suction filtration). The agar content of the solid medium was 2%.

1.6 construction of expression vectors

In the experiment, the yeast expression vector is pYES2, the plant overexpression vector is pROKII-GFP, and proper enzyme cutting sites are added at two ends of the primer according to the sequence characteristics of the gene and the vector. The AxyPrep plasmid miniprep kit (Axygen) is used for extracting plasmids, and the plasmids are used as templates for PCR reaction. The vector is subjected to linearization treatment by double enzyme digestion, and the enzyme digestion reaction system is as follows:

reacting at 37 ℃ for 1-2h, observing the size of the enzyme-digested fragment by using 1% agarose gel electrophoresis, and judging whether the enzyme digestion is successful or not.

Recovering the enzyme digestion product, performing PCR product and vector connection reaction according to a Ligation-Free Cloning System kit, then transforming Trans 5 α, screening positive clone colonies, sending to Huada sequencing to determine the correct sequence, and extracting the plasmid.

1.7 transformation of Agrobacterium competent cells

(1) Thawing the competent cells on ice;

(2) adding 1-2ul plasmid DNA, ice-cooling for 30min, rapidly freezing in liquid nitrogen for 1min, water-bathing at 37 deg.C for 3min, and rapidly ice-cooling for 2 min;

(3) adding 1ml of liquid LB culture medium without antibiotics, performing shaking culture at 28 ℃ and 200rpm/min for 3 h;

(4) centrifuging at 12000rpm for 1min, and suspending thallus in 100ul liquid LB culture medium;

(5) smearing the transformed bacterial liquid on a solid LB culture medium added with 50mg/L kanamycin and 50mg/L rifampicin, and culturing for 2-3d at 28 ℃;

(6) and carrying out colony PCR identification.

1.8 Yeast transformation

The experiment employs a lithium acetate conversion method for yeast conversion:

(1) the BY4741 yeast colony is streaked on YPDA solid medium and activated and cultured for 3-4 days at 30 ℃.

(2) Then, a single colony (2-3 mm in diameter) was inoculated into 5ml of YPDA liquid medium and cultured with shaking at 30 ℃ and 200rpm for 8-12 hours.

(2) Inoculating 0.5ml of the bacterial liquid into 50ml of YPDA liquid medium (the medium is filled in a 250ml triangular flask), and culturing at 30 ℃ and 200rpm for 3-5h until the concentration reaches 2 × 10⁷One cell/ml (OD600 ═ 0.15-0.3).

(3) And completely adding the bacterial liquid into a sterile centrifuge tube, centrifuging at 3500rpm for 3min at room temperature, and collecting cells.

(4) After the supernatant was aspirated off by a pipette tip, the cells were resuspended in 30ml of sterilized double distilled water at 3500rpm at room temperature for 3 min;

(5) after discarding the supernatant, it was resuspended in 1.4ml of 1.1 × TE/LiAc, and the resuspended suspension was transferred to 2 1.5ml centrifuge tubes at 12000rpm and centrifuged for 15s

(6) The supernatant was discarded and resuspended in 600ul of 1.1 × TE/LiAc for each tube and prepared for transformation.

(7) The following reagents (360 μ l) were added to the tube: mu.l PEG 3350 (50% w/v), 36. mu.l 1.0mol/L lithium acetate, 5. mu.l salmon sperm DNA (heat-denatured 2.0mg/ml), 5. mu.l plasmid, resuspended and mixed well.

(8) Water bath at 42 deg.C for 30 min;

(9) centrifuging at 3500rpm for 10min, washing with sterile water twice, adding 500 μ l water to resuspend thallus, and plating 100 μ l onto SD-U solid culture medium;

(10) and culturing at 30 ℃ for 3 days, then selecting positive single colonies, and carrying out colony PCR identification.

1.9 transformation of apple callus

(1) Selecting 'Wanglin' apple callus with good growth vigor, and activating agrobacterium transformed with target gene.

(2) Preparing agrobacterium: transferring the bacterial liquid into a 50mL centrifugal tube, centrifuging for 5min at the rotation speed of 5000rpm under the room temperature condition, discarding supernatant, and only keeping thalli precipitate; the cells were washed once and 20mL of sterilized ddH was added₂O, resuspending the agrobacterium tumefaciens precipitate, centrifuging at 6000rpm for 5min at room temperature, and discarding the supernatant; resuspending the Agrobacterium pellet and adjusting to OD₆₀₀Is in the range of 0.6 to 0.8,

(3) infection callus treatment: adding the callus into the bacterial liquid; oscillating at 120rpm for about 30min under dark room temperature; filtering out callus with gauze in a clean bench, drying callus with filter paper, and culturing in solid medium without resistance for 1-2 days

(4) Screening: the callus is paved on a callus solid culture medium (30mg/L kanamycin and 250mg/L cefamycin) containing antibiotics, and cultured in the dark for about 30 days; and subculturing the newly grown apple callus, and carrying out secondary screening in a solid culture medium (30mg/L kanamycin and 250mg/L cefamycin) with related antibiotics, wherein the third generation is screened in the manner.

(5) And (4) checking: firstly, extracting DNA of the screened callus, carrying out PCR reaction, detecting and screening transgenic 'Wanglin' apple callus; then, RNA of the callus is extracted, and the expression level of the target gene is determined.

1.10 bioinformatics analysis method

Carrying out base sequence homology comparison analysis by using BLAST in NCBI; analyzing an Open Reading Frame (ORF) of the MhNRAMP6 gene by DNAMAN; analyzing the physicochemical property of the amino terminal sequence by using computer pI/Mw software; analyzing a signal peptide of the gene MhNRAMP6 by means of software SignalP 4.1 Server; analyzing the hydrophilicity and hydrophobicity of the protein by utilizing ExPASy software; performing multi-sequence alignment by using MEGA4.0 software and constructing a phylogenetic tree; analysis of the transmembrane structure by means of the Protparam software; the structural domain analysis of protein sequences was carried out by SMART (simple modulated Architecture Research tool).

1.11Cd²⁺Flow rate measurement

The method adopts non-damage micrometering technology (NMT) of Beijing Assun corporation to determine Cd in living apple callus cells²⁺Dynamic flow rate, pre-balancing apple callus in test box with test solution for 30 min. During testing, the apple callus is placed in the test solution, the apple callus is fixed and pressed by a small glass block, the tip of an electrode is placed at a position 200 mu m away from the apple callus cells, and data are continuously collected for 15 min.

1.12 determination of cadmium content by ICP-MS

Taking 0.2g apple callus sample into a digestion tube, and adding 7mL of super pure HNO₃Standing overnight, adding 1mL of 30% high-grade pure hydrogen peroxide before loading on the machine, and digesting with a microwave digestion instrument. And (3) metering the volume to 50ml by using ultrapure water, and finally measuring the cadmium content by using an inductively coupled plasma mass spectrometer (ICP-MS).

1.13 laser confocal observation and analysis of cadmium content

According to the improved method of Karin (2017), etc., after the cadmium treatment, the specific fluorescent probe leader of cadmium is utilized^TMGreen AM stain (molecular probes, Invitrogen, Carlsbad, Calif., USA) fluorescence stains the distribution in cells. Adding 50 μ l dimethyl sulfoxide (DMSO) into the staining agent to prepare stock solution, and adding 0.85% of the solutionThe stock solution was diluted with sodium chloride at a ratio of 1: 10. Freshly prepared callus cells were washed twice with HEPES buffer (50mM, pH6.0) and immediately stained. After incubation in the dark for 30min, the callus cells were washed twice with HEPES buffer (50mM, pH6.0, 37 ℃), and fluorescence images were taken by observation at an excitation light wavelength of 494nm and an emission light wavelength of 518nm using a laser confocal microscope.

2. Analysis of results

2.1 analysis of cadmium uptake and tolerance of MhNRAMP6 Gene-transfected Yeast

2.1.1 Effect of overexpression of MhNRAMP6 on Yeast growth under Cd stress

The yeast expression vector pYES2-MhNRAMP6 and the empty expression vector pYES2 with target genes are transferred into a yeast strain BY4741, and a yeast positive strain for over-expressing MhNRAMP6 is obtained BY screening. Activating by shake culture, and then adding OD of two yeasts₆₀₀Diluting to 5 concentrations of 1, 0.1, 0.01, 0.001, and 0.0001, and spotting 4 μ l of the bacterial suspension containing 0 μ M, 10 μ M, and 30 μ MCdSO₄SD-U solid medium. As shown in FIG. 1, the growth conditions of the two yeast strains were substantially the same at different concentrations without cadmium treatment, indicating that the growth of the yeast strains containing the empty expression vector and the MhNRAMP6 gene expression vector were substantially the same. 10 mu MCdSO₄The treatment inhibited the growth of both yeasts to some extent, but the colonies of the yeast expressing the MhNRAMP6 gene were smaller, indicating a stronger inhibition, and when the cadmium concentration reached 30. mu.M, colonies were not visible in the 0.01 concentration of transgenic yeast, while the growth was still slow at the 0.001 concentration of unloaded yeast. Combining the above results, transgenic yeast is more sensitive to cadmium treatment than unloaded yeast and is subject to severe poisoning effects.

The influence of the expression of MhNRAMP6 gene in yeast on the cadmium resistance of the yeast is further studied, and growth curves of the two yeasts under cadmium treatment are determined. Taking 5 μ L of activated to 50ml of activated CdSO containing 5 μ M₄The cells were cultured in SD-U liquid medium, and the growth curve was measured every 6 hours for a total of 84 hours. As shown in FIG. 2, the growth rates of the two yeasts without cadmium treatment were substantially the same, indicating that the growth vigor of the yeasts containing the empty expression vector and the MhNRAMP6 gene expression vector was substantially the same. Under cadmium treatment conditionsThe two yeasts enter an exponential growth stage obviously later than a control group without cadmium treatment, and the speed increase is lower than that of the control group, so that the growth of the yeasts is obviously inhibited by cadmium. Under the cadmium treatment condition, the growth of the unloaded yeast and the yeast expressing the MhNRAMP6 gene is slower at 0-36h, after the cadmium treatment for 36h, the two yeasts enter exponential growth, and the transgenic yeast still grows slower than the unloaded yeast. By 84h, the cell number of the two yeasts basically reaches a stationary phase, and the number of the unloaded yeast is still higher than that of the transgenic yeast. As can be seen from the growth curves, expression of the MhNRAMP6 gene resulted in slow growth and reduced numbers of yeast under cadmium treatment.

In conclusion, the growth curve of the transgenic yeast under the cadmium treatment condition is consistent with the dot plate experiment result, and the fact that the yeast can be more seriously inhibited by over-expressing the MhNRAMP6 gene under the cadmium stress can be shown, the cadmium tolerance of the yeast is reduced by the transformation of the MhNRAMP6 gene, and the cadmium sensitivity of the yeast is improved.

2.1.2 Effect of overexpression of MhNRAMP6 on cadmium accumulation in Yeast under Cd stress

To further analyze the effect of MhNRAMP6 gene on cadmium accumulation in yeast, yeast with empty vector and gene MhNRAMP6 were activated and incubated in the presence of 5. mu.M CdSO₄After culturing in the SD-U liquid culture medium for 84h, the cadmium content is measured. As shown in FIG. 3, after cadmium treatment, the cadmium content of the yeast expressing the MhNRAMP6 gene is significantly higher than that of the yeast with an empty carrier, which indicates that the excessive expression of the MhNRAMP6 gene increases the absorption of cadmium by the yeast. As more cadmium ions are accumulated in the transgenic yeast, more serious cadmium poisoning effect is caused, and the growth of the transgenic yeast is inhibited.

2.2 analysis of cadmium uptake and tolerance of MhNRAMP6 Gene-transfected apple calli

2.2.1 screening and characterization of apple callus transformed with MhNRAMP6 Gene

PCR amplification is carried out on pMD18-T-MhNRAMP6 by using a specific primer with an enzyme cutting site, a product is recombined with pROKII to construct a plant over-expression vector pROKII-MhNRAMP6 containing MhNRAMP6 gene, agrobacterium tumefaciens GV3101 is transformed, and a positive strain of an expression vector with a target fragment is obtained after colony PCR screening;

the positive strain is infected with apple callus, the apple callus is cultured by a resistance culture medium, and then the apple callus with the MhNRAMP6 gene overexpression is obtained by screening by utilizing a PCR technology; the PCR electrophoresis pattern is shown in FIG. 4, then RNA of the callus is extracted, cDNA is obtained through reverse transcription, and the expression quantity of the MhNRAMP6 gene in the apple callus is detected by utilizing the qRT-PCR technology. As shown in FIG. 5, the expression level of the transgenic calli MhNRAMP6 was 11.4 times that of the wild type, and thus "Wanglin" apple calli overexpressing MhNRAMP6 were obtained.

2.2.2 Effect of overexpression of MhNRAMP6 on growth of apple calli under cadmium treatment

Transgenic apple calli overexpressing MhNRAMP6 obtained in Wild Type (WT) and 2.2.1 of similar quality in their growth state were taken in experiments containing 0. mu.M, 10. mu.M and 30. mu.M CdSO, respectively₄Culturing on the solid culture medium for apple callus. As can be seen from FIG. 6, in the absence of CdSO₄In the culture medium, the wild type and the overexpressed transgenic apple callus grow vigorously and have basically consistent growth vigor; in the presence of low concentration 10. mu.M CdSO₄The growth of wild type and overexpression transgenic apple callus is inhibited to a certain degree in the culture medium, the inhibition of the overexpression transgenic apple callus is more serious than that of the wild type, and the trend is more obvious particularly under the concentration of 30 mu M. As can be seen from fig. 7a, both genotype apple calli significantly inhibited the fresh weight throughout the culture period with Cd addition to controls 66.54% and 29.33%, with the transgenic apple calli being 44.07% of the wild type.

To further verify that overexpression of MhNRAMP6 increased the cadmium sensitivity of the calli, the relative conductivities of the two genotype apple calli were determined under cadmium treatment. The results are shown in FIG. 7b, under the cadmium-free treatment condition, the conductivities of the calli of the two genotypes of apples are not different, which indicates that the growth states of the calli are similar; the conductivity of the two genotypes is obviously increased along with the increase of the cadmium treatment concentration, but the over-expressed transgenic apple callus is higher than that of the wild type, and the result shows that the over-expressed transgenic apple callus has stronger sensitivity to cadmium and more serious injury.

2.2.3 Effect of overexpression of MhNRAMP6 on cadmium ion uptake rate of apple calli under Cd stress

To study that overexpression of MhNRAMP6 increased cadmium sensitivity of apple calli and also affected Cd of apple calli²⁺Flow rate, NMT technology from Asahi Yue Co Ltd for Cd on callus cell surface²⁺And (4) performing flow dynamic experiments. As shown in FIG. 8, the surface Cd of the transgenic and wild-type cells in the absence of cadmium stress treatment²⁺The internal flow rate of the callus surface of the transgenic apple is 1.89 times higher than that of the wild apple. In CdsO₄After 24h of treatment, transgenic apple callus Cd²Inflow velocity⁺Still higher than wild type apple callus, 1.43 times higher than wild type, and higher than cadmium-treated control by itself, 2.5 times higher than untreated.

2.2.4 Effect of overexpression of MhNRAMP6 on cadmium accumulation of apple calli under Cd stress

Overexpression of MhNRAMP6 improves apple callus Cd²⁺The inflow speed is further increased, and the cadmium content in the apple callus cells is further increased. According to

Et al, using a specific Cd reagent, Leadmium (TM) Green dye (Life technologies, USA) to observe the intensity of fluorescent staining in cells. As can be seen in FIG. 9, the fluorescence intensity of the overexpressed MhNRAMP6 apple callus cells is significantly higher than that of the wild type, which indicates that the cadmium content of the transgenic apple callus cells is much higher than that of the wild type, and the cadmium is mainly distributed in the plasma membrane and vacuole of the transgenic apple callus cells and is scattered in the cytoplasm of the wild type apple callus cells.

In order to further determine the influence of the over-expression of MhNRAMP6 on the cadmium content of apple callus, the amount of absorbed and accumulated cadmium in the apple callus was determined by MS-ICP. As can be seen from FIG. 10, the cadmium content in the healed transgenic apple is significantly higher than that of the wild apple, and the cadmium content in the healed apple is increased by 159% by over-expression of MhNRAMP 6.

Sequence listing

<110> Shandong university of agriculture

<120> method for improving cadmium sensitivity of apple callus

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>1635

<212>DNA

<213>Malus sylvestris

<400>1

atggctgtgg ccagtacggc ttctgcgcag ccacagttca ttgcaagcac tggaaaccga 60

agcttctcta atgcaccgct cattgaggac acagatactg aacaaattgt tgttcctgat 120

aagacaagct ggaaaaatct ctttgcctac atgggtccag ggtttcttgt ttcaattgcg 180

tatatagatc ctggaaattt tgagacggat ttgcagtcag gggcgcagta caagtatggg 240

ctactctgga taatattagt tgcttcatgt gctgctcttg tcattcagtc ccttgcagcc 300

aatcttgggg tggtcacagg aaagcatttg gcagagcact gtagagcgga atatcctaga 360

gtaacaaact tcattctttg ggttcttgct gagatttcta tagttgcatg tgacattcct 420

gaagtgattg gaactgcctt tgcattgaac atgctcttca acatacccat atggattggc 480

gtacttctga caggacttag tacattgatt cttctggcat tacagcaata tggggttagg 540

aaacttgaat tcttgatcgc attccttgta ctcacaattg ctggatgctt ctttgctgag 600

cttggctacg caaaacctga cgctactgaa gttttggacg ggctttttgt tccccaactc 660

aaaggaaatg gtgctactgg tcttgcaatt tctcttcttg gtgctatggt tatgccgcac 720

aatctcttcc tccactctgc attggtgctt tctgggaaaa taccacgatc tgtccgtggc 780

atcaaagaag catgcagatt ttatatgata gaaagtggct ttgctctcat ggtggcattc 840

ctaataaatg tatccgttat ttctgtaagt ggtgcagttt gcaattcccc agatttgaat 900

gctgaagata agatgaactg ccaggacttg gatttgaata aagcctcctt tttactaaga 960

aatgttttag gtagttggag ttccaagctt tttgctgtag cattgcttgc atcaggtcaa 1020

agttctacta taacaggaac atatgcaggg caatatgtta tgcgggggtt tcttgattta 1080

cgactgaagc catggcttcg aaacttttta accagatgct tggcaatagt ccctagtttg 1140

attgttgcag tcattggcgg ttctgctggg gctggaaagc tgattattat tgcatcaatg 1200

attttatcgt ttgagctgcc tttcgctctt attccacttc ttaagttcac aagttgcaag 1260

accaagatgg gtacacatgc caactctact gcgatttcag ctctcacttg gatcattggt 1320

tctctgctga tggccataaa tgtatattac ctgatgagta gatttatcaa gttgcttctt 1380

cacaaccact tcaaagttgt gggcattgtc tttcttggaa tgttaggatt ctctggtatg 1440

ggattgtatt tggctggaat cgcgtatctg gtgttccgta aaaacaagga ggctacgcat 1500

cttttggctc taacaacacc tgaaagtagg caaacggaaa ctgggcagca gggtactgga 1560

tcgatgtatc atctcgaaag agaagacatt atgagcatgc agctgcctca gaagaggtct 1620

accgaaaata tcgac 1635

Claims (2)

1. A method for improving cadmium sensitivity of apple calluses is characterized in that MhNRAMP6 gene is overexpressed in apple calluses, and the nucleotide sequence of the MhNRAMP6 gene is shown as SEQ No. 1.

2. The method for improving the cadmium sensitivity of apple calluses according to claim 1, which is characterized by comprising the following steps:

(1) PCR amplification is carried out on pMD18-T-MhNRAMP6 by using a specific primer with an enzyme cutting site, a product is recombined with pROKII, a plant over-expression vector pROKII-MhNRAMP6 containing MhNRAMP6 gene is constructed, agrobacterium tumefaciens GV3101 is transformed, and a positive strain of the expression vector with a target fragment is obtained; the specific primers and the restriction enzyme sites are as follows:

F:CGGGAATGGCTGTGGCCAGTACGG，BamHI；

R：GGGGTAGGTCTACCGAAAATATCGA，KpnI；

(2) and (3) infecting apple calluses with the positive strains, culturing the apple calluses by using an MS solid culture medium containing 30mg/L kanamycin and 250mg/L cefamycin, and then obtaining the apple calluses with the MhNRAMP6 gene overexpression by using a PCR technology.

Images