CN114410813A - Method for identifying plant genome DNA cytosine quadruplet locus at whole genome level - Google Patents

Method for identifying plant genome DNA cytosine quadruplet locus at whole genome level Download PDF

Info

Publication number
CN114410813A
CN114410813A CN202111336972.4A CN202111336972A CN114410813A CN 114410813 A CN114410813 A CN 114410813A CN 202111336972 A CN202111336972 A CN 202111336972A CN 114410813 A CN114410813 A CN 114410813A
Authority
CN
China
Prior art keywords
dna
buffer
reaction
imab
beads
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111336972.4A
Other languages
Chinese (zh)
Other versions
CN114410813B (en
Inventor
张文利
冯逸龙
马星
史依宁
杨莹
程雪姣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202111336972.4A priority Critical patent/CN114410813B/en
Publication of CN114410813A publication Critical patent/CN114410813A/en
Application granted granted Critical
Publication of CN114410813B publication Critical patent/CN114410813B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for identifying a plant genome DNA cytosine quadruplet locus at the whole genome level, which comprises the following steps: (1) preparing plant material; (2) extracting and purifying cell nuclei; (3) fragmenting chromatin within the nuclei and recovering genomic DNA; (4) carrying out renaturation reaction in a renaturation Buffer; (5) iMab-iM DNA complex; (6) recovering the iMab-iMDNA complex formed by the overnight reaction using Protein G Beads; (7) eluting iMab-iM DNA complexes from beads and recovering DNA fragments; (8) detecting the enrichment degree of the DNA iM by using a qPCR method; (9) and (4) building a library, carrying out Illumina sequencing, and identifying iM loci at the whole genome level. The whole method is simple in process, short in time consumption and strong in DNA fragmentation visualization effect, and theoretically, the method is suitable for various plants.

Description

Method for identifying plant genome DNA cytosine quadruplet locus at whole genome level
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a novel method for identifying a plant genome DNA cytosine quadruplet (i-motif, iM) site for the first time at the whole genome level by using an iMab antibody for specifically identifying the DNA cytosine quadruplet (i-motif, iM) site.
Background
In the genome of eukaryotes, the cytosine (C) -rich region of double-stranded DNA can be semi-protonated (C) at 1C under acidic conditions+) Thus, the semi-protonated C forms a cytosine-cytosine + (C: C)+) The structure, two antiparallel the composite structure forms a cross structure, a plurality of similar structures form a three-dimensional stereo structure, it is a special DNA secondary structure, called i-motif (iM) structure (Hala Abou Assi et al, 2018, Nucleic Acids Res.46: 8038-.
Human cell line research results show that the i-motif (iM) structure plays an important role in various biological processes such as stability of human genome structure, DNA replication, gene transcription and translation (Jingking Cui et al, 2013, Molecules,18, 12751-. In particular, iM function is relatively active in telomeres of the human cell line. However, research results show that the DNA iM structure is not only widely distributed in a genome telomere structure, but also commonly exists in normal encoding genes, and even the DNA iM may participate in biological processes such as defense reaction of cells under adversity stress and adversity damage repair. In summary, in the genome of eukaryotes, the DNA iM structure is a secondary structure of DNA that performs certain biological functions.
At present, physical technologies such as Nuclear Magnetic Resonance (NMR) (Lieblein, A.L.et al.,2012, Angew Chem Int Ed Engl,51: 250-. Recently, Mahdi Zeraati et al screened an antibody protein that specifically recognizes the i-Motif structure from a human genomic Garvan-2 single-chain antibody (scFv) library, and further prepared this recombinant protein antibody by genetic engineering means, which was called iMab recombinant protein antibody. Further studies have demonstrated that iMab antibodies specifically recognize iM structures in human genomic DNA (Mahdi Zeraiat, et al, 2018, Nat chem.,10: 631-. Therefore, the iMab antibody is commercialized, and a specific and feasible immunological research method is provided for the extensive research of DNA iM structures in vivo and in vitro of human and animals. At present, the results of immunological studies based on iMab antibodies indicate that under normal physiological conditions, relevant DNA sequences in the human genome can form an i-Motif structure, and the distribution thereof has a certain cell cycle specificity. However, to date, methods for identifying DNA iM sites at the whole genome level have not been reported in humans, animals, and plants.
The closest approach to this method is BG 4-DNA-IP-seq. At present, the method has been successfully applied to identify the structure of guanine quadruplet (G4) in the genome of plants (such as rice). The method comprises the corresponding steps of plant material crosslinking, cell nucleus extraction and purification, wherein the cell nucleus fragments chromatin into a fragment of 100-one and 500-bp through ultrasonic waves, extracts fragmented chromatin DNA and incubates with a BG4 recombinant Protein antibody, then uses Anti-FLAG and Protein G beads to capture a DNA fragment containing a G4 structure specifically combined with BG4, and finally obtains enriched IPed-G4 DNA through the steps of elution, decrosslinking, protease K treatment, phenol-induced extraction, alcohol precipitation and the like, and the G4 site is identified at the whole genome level through library construction sequencing and bioinformatics analysis. The main technical process is shown in figure 1.
We have developed for the first time a DNA-IP (immunoprecipitation) -seq method based on iMab recombinant protein antibodies, called iM-DNA-IP-seq. The method can identify the structure of the DNA iM at the whole genome level, and is successfully applied to the identification of the rice DNA i-Motif (iM) locus at the whole genome level. The method mainly comprises the following steps: extracting and purifying plant tissue cell nuclei, fragmenting the cell nucleus DNA into a fragment of 100-plus 500bp by using ultrasonic waves, extracting the fragmented genome DNA, reconstructing a genome DNA iM structure and incubating the reconstructed genome DNA iM structure with an iMab recombinant Protein antibody, capturing the iMab-specifically-combined DNA fragment containing the iM structure by using Protein G beads, and finally obtaining iM-enriched iM IPed-DNA through the steps of elution, decrosslinking, protease K treatment, phenol-induced extraction, alcohol precipitation and the like, and identifying iM sites and distribution thereof at the whole genome level through library construction sequencing and bioinformatics analysis. The main technical process is shown in figure 2.
In conclusion, the development and application of this approach will facilitate the identification of plant iM structures and the elucidation of their biological functions at the genome-wide level, and in addition, may provide some iM candidate sites for molecular breeding in crops.
Disclosure of Invention
The invention aims to provide an iM-DNA-IP-seq method based on iMab antibody, and a novel method for identifying a plant genome DNA cytosine tetrad (iM) locus at the whole genome level.
The purpose of the invention can be realized by the following technical scheme:
a method (iM-DNA-IP-seq) for identifying iM (i-Motif) sites of plant genomic DNA by using iMab antibodies mainly comprises the following steps:
(1) preparing plant material;
(2) extracting and purifying cell nuclei of the plant material;
(3) fragmenting chromatin in a cell nucleus, detecting the fragmentation effect (fragmenting the chromatin by using an ultrasonic crusher, and detecting the ultrasonic fragmentation effect by using agarose gel electrophoresis), and selecting a sample with the fragmentation degree meeting the requirement to recover DNA fragments;
(4) carrying out renaturation reaction (namely denaturation and renaturation reaction) on the recovered DNA fragment in a renaturation buffer (iGCB buffer), and reconstructing a DNA iM (DNA i-Motif) structure in vitro to obtain an iM reconstruction reaction solution;
(5) adding iM IP Buffer into the iM reconstruction reaction solution, and simultaneously adding iMab antibody for incubation reaction to form iM IP reaction mixed solution containing iMab-iM DNA compound;
(6) separating DNA that does not bind to the iMab antibody by binding Protein G Beads to the iMab-iM DNA complex;
(7) eluting iMab-iM DNA compound from Beads, extracting with phenol, and recovering DNA fragment by alcohol precipitation;
(8) detecting the enrichment degree of the DNA iM by using a qPCR method;
(9) and (3) applying the iM DNA obviously enriched by the enrichment degree detection to library construction and Illumina sequencing, and finally, performing bioinformatics analysis on sequencing data to realize the iM locus identification at the whole genome level.
As a preferred technical scheme, the process for preparing the plant material in the step (1) is as follows: cutting plant material, cleaning with sterilized ultrapure water, fully sucking water on the surface of the leaf, quickly freezing in liquid nitrogen, and storing at-80 deg.C.
Further preferably, in the step (1), the detailed process for preparing the plant material is as follows: cutting the plant material into 1-2cm fragments, washing the material with sterile water and ultrapure water for 3 times, finally 1 time, drying the residual sterile water on the surface of the leaves by using absorbent paper, wrapping the leaves by using tinfoil, quickly freezing the leaves in liquid nitrogen, and storing the leaves in a refrigerator at the temperature of-80 ℃.
As a preferred technical scheme, the process for extracting and purifying the plant material cell nucleus in the step (2) comprises the following steps: fully grinding the plant material into powder by using liquid nitrogen, adding a nuclear extraction buffer solution into the powder, stirring into homogenate, and placing on ice; then filtering, centrifuging, discarding the supernatant to obtain a cell nucleus precipitate, adding a cell nucleus cleaning solution to resuspend the cell nucleus precipitate, centrifuging again, discarding the supernatant, repeating the cell nucleus cleaning process until the cell nucleus is white or light yellow in color, resuspending the purified cell nucleus by using an RSB buffer solution, discarding the supernatant after centrifuging, and finally retaining the precipitate to obtain a purified cell nucleus for a downstream experiment;
the formula of the nuclear extraction buffer (H1B) is as follows: 20mM Tris-HCl (pH 8.0), 50mM EDTA, 5mM Spermidine, 0.15mM speramine, 40% (v/v) Glycerol, 0.1% (v/v) Mercaptoethanol;
the formula of the cell nucleus cleaning solution (H1BW) is as follows: 20mM Tris-HCl (pH 8.0), 50mM EDTA, 5mM Spermidine, 0.15mM speramine, 40% (v/v) Glycerol, 0.1% (v/v) Mercaptoethanol, 0.5% (v/v) Triton X-100;
the formula of the RSB buffer solution is as follows: 10mM Tris-HCl (pH 7.4), 10mM NaCl, 3mM MgCl2。
As a preferred technical scheme, the process of fragmenting the chromatin in the nucleus in the step (3) is as follows: fully suspending the purified cell nucleus in Lysis (lysine) buffer solution, processing the cell nucleus suspension by a non-contact ultrasonic disruptor for 3-15 cycles (setting the parameters of the ultrasonic disruptor pre-cooled at 4 ℃ as High energy, starting 30s and stopping 30s as 1 cycle), extracting DNA from mixed liquor with the volume of 1/20 by a rapid Lysis method, and detecting the fragmentation effect by agarose gel electrophoresis;
the process for recovering the DNA fragments comprises the following steps: if the DNA fragments subjected to fragmentation treatment are uniformly distributed in 100-500bp, putting the corresponding sample in a water bath kettle at 55 ℃ for a cracking reaction overnight; adding RNase A into the reaction solution on the next day, incubating in a water bath at 37 ℃ for 0.5-1 h, then adding Proteinase K, and incubating in a water bath at 55 ℃ for 1-2 h; extracting with equal volume of phenol-imitation (1:1), centrifuging, retaining supernatant, adding Glycogen (Glycogen), 1/10 volume of 3M sodium acetate (pH 5.2) and 2.5 volume times of ice-cooled absolute ethyl alcohol, mixing uniformly, placing at-20 ℃ for 0.5-1.5 h, centrifuging to recover DNA precipitate, washing and drying the recovered DNA precipitate with 75% alcohol, and dissolving with EB buffer solution;
the formula of the lysis buffer solution is 50mM Tris-HCl, 10mM EDTA, 1% SDS (w/v, g/100ml) (the mass percentage of the original SDS solution is 20%, and the lysis buffer solution is prepared by the original SDS solution);
the EB buffer solution comprises the following formula: 10mM Tris-HCl, pH 8.0.
As a preferred technical scheme, the renaturation reaction method in the step (4) is as follows: boiling the DNA fragments recovered in the step (3) in a renaturation Buffer for 3-8 min, stopping heating, and standing overnight to slowly reduce the temperature of the denaturation solution to room temperature;
the formula of the renaturation Buffer is as follows: 50mM Tris-Ac-OH, pH 5.5.
As a preferred technical scheme, the detailed steps of the step (5) are as follows: preparing 2x iM IP Buffer, adding the 2x iM IP Buffer into the iM reconstruction reaction solution prepared in the step (4) according to the proportion, preparing 1x iM IP reaction solution with the final concentration, taking 1/10 volumes of iM IP reaction solution as Input before adding iMab antibody, adding iMab antibody into the iM IP reaction solution, and carrying out rotary incubation at 4 ℃ and 10rpm overnight to obtain iM IP reaction mixed solution containing iMab-iM DNA compound;
the iM IP Buffer formula comprises: 50mM Tris-Ac-OH,1mM MgCl2,130nM CaCl2,1％ BSA(w/v，g/100ml),10mM Complete mini,pH＝5.5。
As a preferred embodiment, the process for recovering iMab-iM DNA complex using Protein G beads in step (6) is: resuspending Protein G Beads stored in a refrigerator, and subpackaging the Beads into new centrifuge tubes; resuspending Beads with 4 ℃ precooled 1 xiM IP Buffer, standing for 1min, then recovering Beads with a magnetic plate, and discarding the supernatant; repeating for 3 times, removing the supernatant for 1 time, adding iM IP reaction mixed liquor containing iMab-iM DNA compound into the cleaned beads, and carrying out rotary reaction for 5h at 4 ℃ and 10rpm on a mixing instrument; beads were collected on a magnetic plate, the iM IP reaction mixture was discarded, and DNA not bound to iMab antibody was separated.
As a preferred embodiment, the process of eluting iMab-iM DNA complexes from Beads and recovering DNA fragments in step (7) is: resuspending beads with a precooling Buffer, standing, collecting the beads with a magnetic plate, discarding the supernatant, and repeating the step for 3 times; finally, 1 time, removing the supernatant as much as possible; eluting iMab-iM DNA compound combined on beads by using an Elution Buffer at 65 ℃ to obtain eluent, taking out Input stored in a refrigerator, adding protease K together with the eluent, digesting for 1h at 55 ℃, extracting by using phenol-imitation (1:1) with the same volume after the reaction is finished, recovering DNA fragments by using an alcohol precipitation method, dissolving DNA by using the Elution Buffer, and obtaining DNA as Input DNA and iM IPed-DNA;
the Washing Buffer formula comprises: 25mM Tris-HCl, 1% (v/v) Tween20, pH 5.5;
the Elution Buffer formula comprises the following components: 0.1M NaHCO3,1％SDS(w/v，g/100ml)。
As a preferred technical scheme, the steps(8) The specific process is that 1 iM locus and 1 non-iM locus are selected to respectively design PCR primers, and the size of the amplified fragment is set to be 100-150 bp; from the DNA fragment obtained in step (7), 1. mu.l of Input DNA and 2. mu.l of iM IPed-DNA were taken as templates, diluted 3-fold respectively, subjected to qPCR with positive and negative primers, and subjected to qPCR with 2(ΔΔCt)The method calculates the enrichment times, and selects the reaction with the positive and negative primer times ratio more than 2 to carry out the next experiment.
As a preferred technical scheme, the specific process of the step (9) is as follows: and (3) using the iM IPed-DNA meeting the requirements in the step (8) to construct an Illumina sequencing library, and separating and purifying a 200-and 600-bp DNA fragment for 2x150 PE sequencing on an Illumina NovaSeq sequencing platform.
TABLE 1 formulation of Nuclear extraction buffer
Figure BDA0003350901110000051
Note: the SDS used was a mass percent SDS solution, and the original SDS solution was a 20% mass SDS solution.
Lysine: lysis buffer; H1B: cell nucleus extraction buffer solution; h1 BW: cell nucleus washing buffer solution; RNase A: ribonuclease A; protease K: proteinase K; glycogen: glycogen; Tris-Ac-OH: tris (hydroxymethyl) aminomethane acetate; pH value is pH value; CaCl2: calcium chloride; MgCl2: magnesium chloride; EDTA: ethylene diamine tetraacetic acid; spermidine; spermidine; speramine: spermine; glycerol, Glycerol; mercaptoethanol: mercaptoethanol; triton X-100: polyethylene glycol octyl phenyl ether; and (mM): millimole; m is mole; sequencing: sequencing; bp: base pairs.
The room temperature of the invention is 24 +/-2 ℃.
The method is mainly different from the existing BG4-DNA-IP-Seq in that the experiment is carried out by extracting the whole genome DNA in vitro, the cross-linking treatment of experimental materials is not needed, and the steps are simple.
Compared with the prior art, the method has the following advantages:
(1) the whole method flow is simpler, is similar to BG4-DNA-IP-seq method in that 1 experiment period needs about 3 days, and consumes short time, and 1 experiment period needs about 2 days. (2) The method has a definite detection method, and the experimental results are easy to repeat among the same 1 or different operators. (3) The theory is applicable to various species including human, animals and plants. (4) Can be directly used for identifying the iM locus of the whole genome. (5) The invention can be widely popularized and applied in different laboratories.
Drawings
FIG. 1, BG4-DNA-IP-seq Main step flow chart
FIG. 2 is a flow chart of the main steps of the iM-DNA-IP-seq method.
FIG. 3 is an agarose electrophoresis test chart of the ultrasonic disruption of rice genomic DNA.
FIG. 4 is a gel diagram of an Illumina sequencing library.
FIG. 5 is a first visualization of rice DNA iM sites.
FIG. 6 is a second visualization chart of rice DNA iM sites.
Detailed Description
The present invention is further illustrated, but not limited, by the following examples.
Example 1:
(1) preparing plant materials:
selecting 2-5g experimental material (wheat, corn, rice or Arabidopsis thaliana leaf) to be tested, cutting into 1-2cm fragments, washing with sterilized distilled water for 3 times, placing all leaves on absorbent paper for the last 1 time, drying in the air for 10min, wrapping the treated leaves with a tin-platinum paper after the surface moisture of all leaves is absorbed, quickly freezing in liquid nitrogen for 10min, taking out the leaves, and placing in a refrigerator at-80 ℃ for storage for later use.
(2) Extraction of nuclei of purified plant material:
the leaves were pulverized with liquid nitrogen, and 10ml of the powder was used for extraction of nuclei. An equal volume of nuclear extraction buffer (H1B) was added to the powder and after stirring to homogenize, the tube was shaken for 6min on ice at 100 rpm.
The homogenate was filtered through 2 layers of microcloth gauze into 1 new 50ml centrifuge tube and centrifuged for 12min at 4 ℃ with a 3,000rpm ramp rate of 8. Discarding the supernatant to obtain cell nucleus precipitate, adding 2ml H1B Washing Buffer (HIBW), gently resuspending the cell nucleus with a writing brush head, flushing the residual cell nucleus on the writing brush head with 3ml HIBW, collecting in the same 1 centrifuge tube, gently turning upside down and mixing for 3 to 5 times, centrifuging for 12min at the speed of 3,000rpm increase and decrease of 8, discarding the supernatant, repeating the step for 3 times until the cell nucleus is white or light yellow in color, discarding the supernatant as far as possible, and precipitating as purified cell nucleus.
The purified nuclei were resuspended in 5ml of RSB buffer, centrifuged at 4 ℃ and 3,000rpm at 8 rpm for 12min, the supernatant discarded and the pellet (nuclei) retained. Resuspend nuclei with 400. mu.l of RSB buffer and transfer nuclei to 1 new 1.5ml centrifuge tube; centrifugation was carried out at 4 ℃ and 3,000rpm ramp rate of 8 for 12min, the supernatant was discarded, and the pellet (nuclei) was retained for use in downstream experiments.
The formula of the nuclear extraction buffer (H1B) is as follows: 20mM Tris-HCl (pH 8.0), 50mM EDTA, 5mM Spermidine, 0.15mM speramine, 40% (v/v) Glycerol, 0.1% (v/v) Mercaptoethanol;
the formula of the cell nucleus cleaning solution (H1BW) is as follows: 20mM Tris-HCl (pH 8.0), 50mM EDTA, 5mM Spermidine, 0.15mM speramine, 40% (v/v) Glycerol, 0.1% (v/v) Mercaptoethanol, 0.5% (v/v) Triton X-100;
the formula of the RSB buffer solution is as follows: 10mM Tris-HCl (pH 7.4), 10mM NaCl, 3mM MgCl2。
(3) Carrying out ultrasonic disruption treatment on cell nucleuses and recovering corresponding fragmented DNA fragments:
and (3) resuspending the purified cell nucleus in 200 mu l lysine Buffer, placing the sample on a non-contact ultrasonic disruptor bracket precooled at 4 ℃ (the parameters of the ultrasonic disruptor are set to High energy, 30s is started, and 30s is stopped for 1 cycle), and performing High-energy disruption treatment for 7-13 cycles.
Taking out 10 mul of mixed solution, extracting DNA by a rapid cracking method, and detecting the crushing condition by agarose gel electrophoresis:
firstly, preparing 10 mu l of the taken mixed solution into a 50 mu l system by using lysine buffer, rapidly cracking cell nucleus for 10min at 100 ℃, then treating for 10min at 55 ℃ by using protease K, extracting for 1 time by using equal volume of phenol-imitative (1:1), reserving supernate, adding 20 mu g of Glycogen, 1/10 volume of 3M sodium acetate (pH 5.2) and 2 times volume of ice-cold absolute ethyl alcohol, mixing uniformly, placing for 1h in a refrigerator at-20 ℃, washing DNA precipitate by using 70% of alcohol after centrifugation, drying for 5min in the air, and dissolving DNA by using 20 mu l of EB. The ultrasonic fragmentation effect was examined by electrophoresis in 1.5% agarose gel.
Selecting a reaction with the fragmentation effect uniformly distributed in 100-500bp, configuring a 400 mu l system by using a lysine buffer, and carrying out heat preservation reaction in a water bath kettle at 55 ℃ overnight to crack cell nuclei.
The next day, 3 μ l RNaseA was added to the reaction system, and the reaction was incubated in a water bath at 37 ℃ for 1 hour; adding 7 mul of protease K, mixing uniformly, and incubating and reacting in water bath at 55 ℃ for 2 h; after the reaction was completed, after mixing uniformly with an equal volume of phenol-chloroform (1:1), centrifuging at 4 ℃ for 10min at 12,000rpm, retaining the supernatant in 1 new 1.5ml centrifuge tube, and adding 20. mu.g of Glycogen, 1/10 volumes of 3M sodium acetate (pH 5.2) and 2.5 volumes of pre-cooled absolute ethanol, after mixing uniformly, placing in a refrigerator at-20 ℃ for 1h, 12,000rpm, 4 ℃, centrifuging for 15min to recover DNA, washing the DNA precipitate with 75% ethanol for 2 times, drying in air for 5min, dissolving the DNA with 20. mu.l of EB buffer and measuring the concentration. Immediately carrying out the next reaction or storing the DNA in a refrigerator at-20 ℃ for later use.
The formula of the lysis buffer solution is 50mM Tris-HCl, 10mM EDTA, 1% SDS (w/v, g/100ml) (the mass percentage of the original SDS solution is 20%, and the lysis buffer solution is prepared by the original SDS solution);
the EB buffer solution comprises the following formula: 10mM Tris-HCl, pH 8.0.
(4) iM-DNA-IP reaction:
and dissolving 5 mu g of the recovered DNA fragment in 100 mu l of renaturation Buffer, boiling for 5min, stopping heating, well preserving heat, standing overnight to slowly cool the denatured solution to room temperature overnight for renaturation reaction to reconstruct a DNA iM structure to obtain an iM reconstruction reaction solution.
The formula of the renaturation Buffer is as follows: 50mM Tris-Ac-OH, pH 5.5.
(5) Preparing 2x iM IP Buffer, and adding the 2x iM IP Buffer into the iM reconstruction reaction solution treated by night according to a proportion to prepare 1x iM IP reaction solution, wherein the final reaction volume is 500 mu l; and before adding iMab antibody, 1/10 volumes of iM IP reaction complex are taken as Input, then appropriate amount of iMab antibody is added into the iM IP reaction complex, and the iM IP reaction mixture containing iMab-iM DNA complex is obtained by incubation overnight at 4 ℃ and 10 rpm.
The iM IP Buffer formula comprises: 50mM Tris-Ac-OH,1mM MgCl2,130nM CaCl2,1％ BSA(w/v，g/100ml),10mM Complete mini,pH＝5.5。
(6) The following day, the Protein G beads, which were kept in a 4 ℃ refrigerator, were resuspended and the beads were dispensed into new centrifuge tubes per 30. mu.l reaction. Resuspending beads with 1ml of 4 ℃ pre-cooled 1 xiM IP Buffer, standing for 1min, recovering beads with a magnetic plate, discarding the supernatant, and repeating for 3 times; finally, 1 time of removing the supernatant as much as possible, adding the iM IP reaction mixed solution containing the iMab-iM DNA compound into the beads, and carrying out rotary reaction at 4 ℃ and 10rpm for 5 hours; beads were collected on a magnetic plate, the iM IP reaction mixture was discarded, and DNA not bound to iMab antibody was separated.
(7) iM-IPed DNA elution and recovery
Resuspending beads with 1ml of precooled Washing Buffer, standing for 1 minute, collecting the beads with a magnetic plate, discarding the supernatant, and repeating the step for 3 times; finally, 1 time, removing the supernatant as much as possible; the antibody-iM DNA complex bound to the beads was eluted with 200. mu.l of Elution Buffer in a water bath at 65 ℃ for 10min each time, 2 times, and the two eluates were combined in 1 new centrifuge tube.
Taking out the Input stored in a refrigerator, respectively adding 3 mul of protease K with eluent, reacting for 1h at 55 ℃, extracting with equal volume of phenol-imitated (1:1) after the reaction is finished, centrifuging for 10min at 12,000rpm and 4 ℃, taking the supernatant into 1 new 1.5ml centrifuge tube, adding 1/10 volume of 3M NaAC, 20 mu g of Glycogen and 2.5 times volume of precooled absolute ethyl alcohol, mixing uniformly, placing for 1h in a refrigerator at-20 ℃, centrifuging for 15min at 12,000rpm and 4 ℃, recovering DNA fragments, washing and precipitating for 2 times with 75% ethyl alcohol, drying at room temperature, and dissolving DNA with 17 mul of EB (Electron Beam Buffer). The DNA after the dissolution was stored in a refrigerator at-20 ℃ or directly subjected to the next experiment.
The Washing Buffer formula comprises: 25mM Tris-HCl, 1% (v/v) Tween20, pH 5.5;
the Elution Buffer formula comprises the following components: 0.1M NaHCO3,1％SDS(w/v，g/100ml)。
(8) qPCR detection of iM enrichment degree
1 iM site and a non-iM site are predicted and selected through bioinformatics to respectively design PCR primers, and the size of the amplified fragment is set to be 100-150 bp. Taking 1 mul Input DNA and 2 mul iM IPed-DNA as templates, diluting the templates by 3 times respectively, using positive and negative primers to make qPCR respectively, and using 2(ΔΔCt)The method calculates the enrichment times, and selects the reaction with the positive and negative primer times ratio more than 2 to carry out the next experiment. The positive primer sequences used were: f: GCCGGAGTAGACCCAGCTA, R: ATGGAACTCCTGGCCGTG, respectively; the sequence of the negative primer is as follows: f: AATGCAATGCGACAGTCCTT, R: GCCAACTAGAATCCACCCAC are provided.
(9) The process of using the iM IPed-DNA fragment for constructing an Illumina sequencing library and sequencing comprises the following steps:
and taking 7 mu l of DNA fragment (iM IPed-DNA) subjected to iM IP reaction meeting the detection requirement for constructing an Illumina sequencing library, wherein the specific experimental scheme is operated according to the experimental scheme given by the kit. The DNA fragments are separated and purified and distributed in 200-600bp DNA library fragments (after library construction reaction, the DNA can be connected with a linker of about 120bp, the DNA distribution of the whole library can be increased by about 120bp, namely the library fragments approximately distributed in 200 bp-600 bp need to be purified), and the DNA fragments are used for carrying out 2x150 PE sequencing on an Illumina NovaSeq sequencing platform.
The experimental results show that:
(1) the iM-DNA-IP-seq system flow established in the experiment is shown in figure 2
(2) After the extracted cell nucleus is subjected to ultrasonic treatment, the DNA fragments are uniformly distributed in the range of 100-500bp, as shown in figure 3.
(3) Appropriate amount of DNA was used to construct Illumina sequencing library, and 200-600bp sized fragment was purified, recovered and sequenced, and library construction detection was shown in FIG. 4.
(4) The visual effect of the iM sites by bioinformatic analysis is shown in fig. 5 and 6.
Noun interpretation of related art terms:
nuclear extraction buffer (HIB): buffer solution for extracting cell nuclei.
Nuclear wash (H1 BW): for purification of the cell nuclei.
RNaseA: an RNA degrading ribonuclease.
Protease K: proteinase K, mainly degrades proteins.
DNA iM: quadruplet structure formed by protonated hydrogen of cytosine on genomic DNA
Illumina sequencing library: DNA libraries based on second generation DNA sequencing technology.
And (3) PCR: the method is characterized in that the reactions of high-temperature denaturation, low-temperature annealing (renaturation), moderate-temperature extension and the like form a period and are circularly carried out, so that the target DNA can be rapidly amplified.
qPCR: real-time fluorescence quantitative nucleic acid amplification detection system
IP, immunoprecipitation.

Claims (10)

1. A method for identifying a plant genome DNA cytosine quadruplet site at the whole genome level is characterized by mainly comprising the following steps:
(1) preparing plant material;
(2) extracting and purifying cell nuclei of the plant material;
(3) carrying out fragmentation treatment on chromatin in a cell nucleus, detecting the fragmentation effect, and selecting a sample with the fragmentation degree meeting the requirement to recover DNA fragments;
(4) carrying out renaturation reaction on the recovered DNA fragments in a renaturation Buffer to reconstruct a DNA iM structure to obtain an iM reconstruction reaction solution;
(5) adding iM IP Buffer into the iM reconstruction reaction solution, and simultaneously adding iMab antibody for incubation reaction to form iM IP reaction mixed solution containing iMab-iM DNA compound;
(6) separating DNA that does not bind to the iMab antibody by binding Protein G Beads to the iMab-iM DNA complex;
(7) eluting iMab-iM DNA compound from Beads, extracting with phenol, and recovering DNA fragment by alcohol precipitation;
(8) detecting the enrichment degree of the DNA iM by using a qPCR method;
(9) and (3) applying the obviously enriched iM DNA to library construction and Illumina sequencing, and finally, performing bioinformatics analysis on sequencing data to realize iM locus identification at the whole genome level.
2. The method according to claim 1, wherein the process of preparing the plant material in step (1) is: cutting plant material, cleaning with sterilized ultrapure water, fully sucking water on the surface of the leaf, quickly freezing in liquid nitrogen, and storing at-80 deg.C.
3. The method of claim 1, wherein the extracting and purifying the plant material nuclei in the step (2) comprises: fully grinding the plant material into powder by using liquid nitrogen, adding a nuclear extraction buffer solution into the powder, stirring into homogenate, and placing on ice; then filtering, centrifuging, discarding the supernatant to obtain a cell nucleus precipitate, adding a cell nucleus cleaning solution to resuspend the cell nucleus precipitate, centrifuging again, discarding the supernatant, repeating the cell nucleus cleaning process until the cell nucleus is white or light yellow in color, resuspending the purified cell nucleus by using an RSB buffer solution, discarding the supernatant after centrifuging, and finally retaining the precipitate to obtain a purified cell nucleus for a downstream experiment;
the formula of the nuclear extraction buffer solution is as follows: 20mM Tris-HCl, 50mM EDTA, 5mM Spermidine, 0.15mM spermine, 40% Glycerol, 0.1% Mercaptoethanol;
the formula of the cell nucleus cleaning solution is as follows: 20mM Tris-HCl, 50mM EDTA, 5mM Spermidine, 0.15mM spermine, 40% Glycerol, 0.1% Mercaptoethanol, 0.5% Triton X-100;
the formula of the RSB buffer solution is as follows: 10mM Tris-HCl, 10mM NaCl, 3mM MgCl2。
4. The method of claim 1,
the process of fragmenting chromatin in the nuclei in the step (3) comprises the following steps: fully suspending the purified cell nucleus in a lysis buffer solution, treating the cell nucleus suspension for 3-15 cycles by using a non-contact ultrasonic disruptor, and detecting the fragmentation effect by using agarose gel electrophoresis;
the process for recovering the DNA fragments comprises the following steps: if the DNA fragments subjected to fragmentation treatment are uniformly distributed in 100-500bp, putting the corresponding sample in a water bath kettle at 55 ℃ for a cracking reaction overnight; adding RNase A into the reaction solution on the next day, incubating in a water bath at 37 ℃ for 0.5-1 h, then adding Proteinase K, and incubating in a water bath at 55 ℃ for 1-2 h; extracting with equal volume of phenol-chloroform (1:1), centrifuging, retaining supernatant, adding Glycogen, 3M sodium acetate (pH 5.2) with the volume of 1/10 and 2.5 times of ice-cooled absolute ethyl alcohol, mixing uniformly, placing at-20 ℃ for 0.5-1.5 h, centrifuging, recovering DNA precipitate, washing and drying the recovered DNA precipitate with 75% alcohol, and dissolving with EB buffer solution;
the formula of the lysis buffer solution is 50mM Tris-HCl, 10mM EDTA and 1% SDS;
the EB buffer solution comprises the following formula: 10mM Tris-HCl, pH 8.0.
5. The method of claim 1, wherein the renaturation reaction in step (4) is performed by: boiling the DNA fragments recovered in the step (3) in a renaturation Buffer for 3-8 min, stopping heating, and standing overnight to slowly reduce the temperature of the denaturation solution to room temperature;
the formula of the renaturation Buffer is as follows: 50mM Tris-Ac-OH, pH 5.5.
6. The method of claim 1, wherein the detailed step of step (5) is: preparing 2x iM IP Buffer, adding the 2x iM IP Buffer into the iM reconstruction reaction solution prepared in the step (4) according to the proportion, preparing 1x iM IP reaction solution with the final concentration, taking 1/10 volumes of iM IP reaction solution as Input before adding iMab antibody, adding iMab antibody into the iM IP reaction solution, and carrying out rotary incubation at 4 ℃ and 10rpm overnight to obtain iM IP reaction mixed solution containing iMab-iM DNA compound;
the iM IP Buffer formula comprises: 50mM Tris-Ac-OH,1mM MgCl2,130nM CaCl2,1％ BSA(w/v，g/100ml),10mM Complete mini,pH＝5.5。
7. The method of claim 1,
the process for recovering iMab-iM DNA complex by using Protein G beads in the step (6) is as follows: resuspending Protein G Beads stored in a refrigerator, and subpackaging the Beads into new centrifuge tubes; resuspending Beads with 4 ℃ precooled 1 xiM IP Buffer, standing for 1min, then recovering Beads with a magnetic plate, and discarding the supernatant; repeating for 3 times, removing the supernatant for 1 time, adding iM IP reaction mixed liquor containing iMab-iM DNA compound into the cleaned beads, and carrying out rotary reaction for 5h at 4 ℃ and 10rpm on a mixing instrument; beads were collected on a magnetic plate, the iM IP reaction mixture was discarded, and DNA not bound to iMab antibody was separated.
8. The method of claim 1,
the process of eluting iMab-iM DNA complex from Beads and recovering DNA fragment in step (7) is: resuspending beads with a precooling Buffer, standing, collecting the beads with a magnetic plate, discarding the supernatant, and repeating the step for 3 times; finally, 1 time, removing the supernatant as much as possible; eluting iMab-iM DNA compound combined on beads by using an Elution Buffer at 65 ℃ to obtain eluent, taking out Input stored in a refrigerator, adding protease K together with the eluent, digesting for 1h at 55 ℃, extracting by using phenol-imitation with the same volume after the reaction is finished, recovering DNA fragments by using an alcohol precipitation method, dissolving DNA by using an Elution Buffer, and obtaining DNA as Input DNA and iM IPed-DNA;
the Washing Buffer formula comprises: 25mM Tris-HCl, 1% (v/v) Tween20, pH 5.5;
the Elution Buffer formula comprises the following components: 0.1M NaHCO3,1％SDS。
9. The method as claimed in claim 1, wherein the specific process of step (8) is to select 1 iM site and 1 non-iM site to design PCR primers, and the amplified fragment size is set to 100 and 150bp, respectively; from the DNA fragment obtained in step (7), 1. mu.l of Input DNA and 2. mu.l of iM IPed-DNA were taken as templates, diluted 3-fold respectively, subjected to qPCR with positive and negative primers, and subjected to qPCR with 2(ΔΔCt)The method calculates the enrichment times, and selects the reaction with the positive and negative primer times ratio more than 2 to carry out the next experiment.
10. The method according to claim 1, wherein the specific process of step (9) is as follows: and (3) using the iM IPed-DNA meeting the requirements in the step (8) to construct an Illumina sequencing library, and separating and purifying a 200-and 600-bp DNA fragment for 2x150 PE sequencing on an Illumina NovaSeq sequencing platform.
CN202111336972.4A 2021-11-12 2021-11-12 Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level Active CN114410813B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111336972.4A CN114410813B (en) 2021-11-12 2021-11-12 Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111336972.4A CN114410813B (en) 2021-11-12 2021-11-12 Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level

Publications (2)

Publication Number Publication Date
CN114410813A true CN114410813A (en) 2022-04-29
CN114410813B CN114410813B (en) 2023-12-22

Family

ID=81265940

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111336972.4A Active CN114410813B (en) 2021-11-12 2021-11-12 Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level

Country Status (1)

Country Link
CN (1) CN114410813B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0615961D0 (en) * 2006-08-11 2006-09-20 Chembiotech Nanoparticle nucleic acid binding compound conjugates forming I-motifs
CN105648537A (en) * 2016-03-02 2016-06-08 上海易毕恩基因科技有限公司 DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method
WO2017153570A2 (en) * 2016-03-11 2017-09-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) Ph-responsive poly-nucleic acid complexes
CN112941159A (en) * 2020-12-25 2021-06-11 南京农业大学 Method for identifying guanine quadruplet locus of plant genome DNA at whole genome level
CN114276417A (en) * 2021-12-03 2022-04-05 南京农业大学 Method for identifying whole genome DNA guanine quadruplet locus under normal physiological condition of plant

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0615961D0 (en) * 2006-08-11 2006-09-20 Chembiotech Nanoparticle nucleic acid binding compound conjugates forming I-motifs
CN105648537A (en) * 2016-03-02 2016-06-08 上海易毕恩基因科技有限公司 DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method
WO2017153570A2 (en) * 2016-03-11 2017-09-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) Ph-responsive poly-nucleic acid complexes
WO2017153593A1 (en) * 2016-03-11 2017-09-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) Ph-responsive poly-nucleic acid complexes
CN112941159A (en) * 2020-12-25 2021-06-11 南京农业大学 Method for identifying guanine quadruplet locus of plant genome DNA at whole genome level
CN114276417A (en) * 2021-12-03 2022-04-05 南京农业大学 Method for identifying whole genome DNA guanine quadruplet locus under normal physiological condition of plant

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ABOU ASSI H,ET AL.: "i-Motif DNA: structural features and significance to cell biology", 《NUCLEIC ACIDS RES》 *
HÄNSEL-HERTSCH R, ET AL.: "Genome-wide mapping of endogenous G-quadruplex DNA structures by chromatin immunoprecipitation and high-throughput sequencing", 《NAT PROTOC》 *
HÄNSEL-HERTSCH R, ET AL: "Genome-wide mapping of endogenous G-quadruplex DNA structures by chromatin immunoprecipitation and high-throughput sequencing.", 《NAT PROTOC》 *
ZERAATI M,ET AL.: "I-motif DNA structures are formed in the nuclei of human cells", 《NAT CHEM》 *
冯逸龙,张文利: "DNA鸟嘌呤四联体研究进展", 《生物技术通报》 *

Also Published As

Publication number Publication date
CN114410813B (en) 2023-12-22

Similar Documents

Publication Publication Date Title
CN106637422B (en) Method for constructing Hi-C high-throughput sequencing library
CN111733214B (en) High-throughput sequencing and database building technology capable of efficiently capturing three-dimensional chromosome conformation of frozen biological sample
WO2012155577A1 (en) Method for separating and purifying rna from biomaterial
CN112941159A (en) Method for identifying guanine quadruplet locus of plant genome DNA at whole genome level
WO2017066907A1 (en) Method of building hi-c library having high usable data ratio
CN114544925A (en) Kit and method for identifying interaction between transcription factor and chromatin in plant by using CUT & Tag technology
CN108949742B (en) Ultrasonic crushing method of pig adipose tissue and application thereof
CN111778563A (en) Construction method of cell Hi-C sequencing library
WO2000050587A1 (en) Genetically filtered shotgun sequencing of complex eukaryotic genomes
CN114276417B (en) Method for identifying whole genome DNA guanine tetrad site under normal physiological condition of plant
CN113088515A (en) Kit and method for extracting FFPE tissue sample DNA and application thereof
CN107058297B (en) A kind of chaotropic agent and the method using chaotropic agent extraction genomic DNA
CN111560423B (en) Method for detecting RNA m6A with high flux and high sensitivity and single base resolution and application thereof
CN114410813B (en) Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level
CN112430586A (en) VI-B type CRISPR/Cas13 gene editing system and application thereof
CN111440843A (en) Method for preparing chromatin co-immunoprecipitation library by using trace clinical puncture sample and application thereof
CN115851876A (en) Sequencing method for simultaneously obtaining whole genome transcription and protein-DNA binding information
RU2637360C1 (en) Method of dna purification from paraffin blocks with histological biomaterial
CN114703173A (en) Lambda phage DNA extraction kit and extraction method
CN115197997A (en) CUT & Tag method applied to plant pollen
CN113652469A (en) Method and kit for removing ribosomal RNA and/or mitochondrial RNA in sample
WO2022041231A1 (en) Preparation method for cas9 protein able to be used in human primary cell gene editing
CN105274090B (en) A kind of paraffin DNA purification process and its application in genomics
Zhang et al. Conserved noncoding sequences correlate with distant gene contacts in Arabidopsis and Brassica
CN114106196A (en) Antibody-transposase fusion protein and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant