CN114544925A - Kit and method for identifying interaction between transcription factor and chromatin in plant by using CUT & Tag technology - Google Patents

Abstract

The invention discloses a kit and a method for identifying interaction between transcription factors and chromatin in plants by utilizing CUT & Tag technology, wherein the kit comprises: biotinylated Tn5 transposase, cell nucleus extracting solution, antibody hybridization solution, streptavidin washing solution, DNA eluent, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitonin solution, Triton X-100 solution, preloaded Phase Lock Gel, DNA coprecipitator, PCR reaction solution and other reagents. The invention overcomes the defects and shortcomings of the prior CUT & Tag technology in plant application, provides a CUT & Tag-seq and CUT & Tag-qPCR strategy and a corresponding kit which are widely applied to the interaction research of animals and plants, particularly chromatin binding protein with low abundance and DNA, and promotes the development of a new technology and a new means of epigenetic regulation.

Description

Kit and method for identifying interaction between transcription factor and chromatin in plant by CUT & Tag technology

Technical Field

The invention relates to the technical field of biology, in particular to a kit and a method for identifying interaction between a transcription factor and chromatin in a plant by utilizing a CUT & Tag technology.

Background

Gene expression regulation plays a key role in the growth and development of multicellular organisms. In multicellular organisms, all cells have the same genomic sequence. However, genomic regulation, including differential binding of DNA methylation, histone modifications, transcription factors and their recruited protein complexes, results in differences in gene expression in different tissues and at different developmental stages.

Chromatin Immunoprecipitation (ChIP) is a widely used Chromatin analysis method, a gold standard for the study of whole genome DNA-protein interactions. The principle of the ChIP experiment is that the combination of target protein and DNA is fixed by formaldehyde, then chromatin is compositely fragmented by mechanical ultrasound or enzyme digestion, and then the antibody-based co-immunoprecipitation enrichment with the target protein is performed, so that chromatin fragments interacted with the target protein are simultaneously enriched, and further, the enriched chromatin fragments can be used for subsequent high-throughput sequencing research of combination characterization in the whole gene range, or for fluorescent quantitative PCR (qPCR) experiment to verify the combination condition of transcription factors and special DNA candidate sites.

In 2019, CUT & Tag (clean Under Targets and targeting, CUT & Tag) technology developed by seattle verry hardson cancer research center is a new technology for studying epigenomic chromatin analysis strategy. The principle is fundamentally different from ChIP. In principle, CUT & Tag is an enzyme-tethering (enzyme-tethering) strategy, which firstly uses antibodies to recognize target proteins in intact cells or nuclei, and then adds Protein a/G fused Tn5 transposase to recognize antibodies bound to the target proteins, so that Tn5 transposase is tethered near the target proteins and their bound chromatin, and under the action of magnesium ions, Tn5 transposase cleaves adjacent chromatin and adds DNA linkers, and the resulting target fragments are used for subsequent pooling and high-throughput sequencing.

The functionality of the CUT & Tag is the same as that of the conventional ChIP technology, but the CUT & Tag has unique advantages: 1) high resolution and low background signal due to in situ activation of the transposase; 2) because DNA ultrasonic treatment is not needed to fragment chromatin, no joint is needed in the library building process, the experimental operation and the library building process are greatly simplified, and the experimental time is saved; 3) due to the high sensitivity of the process, only small amounts of starting materials are required.

The CUT & Tag technology is a completely new technology and still in the process of rapid development and improvement. The CUT & Tag technique was originally developed for analysis of chromatin state in animal cells. The current procedures/methods of CUT & Tag in histone modification studies have been specifically reported in both animal cells and plants, and even in animals, the study of histone modification using CUT & Tag has been developed to the single cell level. However, the CUT & Tag protocol for specific plant transcription factor binding studies with chromatin remains a challenge due to the influence of plant cell wall tissue and a variety of secondary metabolites.

First, plant cells present cell walls, large vacuoles, and complex secondary metabolites that limit the entry of antibodies and transposases into plant cells. At present, the success of the plant CUT & Tag experiment of extracting the cell nucleus of the plant cell and using the cell nucleus to carry out the CUT & Tag reaction is reported. However, only the histone modified H3K4me3 and H3K27me3 with high abundance of chromatin existing in animals and plants are successfully identified at present, and the CUT & Tag is used for identifying the combination of plant specific transcription factors and DNA, so that no successful case report is found at present. This is probably due to the low starting number of cells that can be used, which is a feature of the CUT & Tag technology. The currently available purification and banking approaches are also based on low cell initial CUT & Tag reactions. Because the chromatin is used in an insufficient amount (not as much as the traditional ChIP), the identification sensitivity of the interaction between the transcription factor with low abundance and the DNA is not high. And once the use amount of chromatin in the reaction system is increased, the excessive uncut DNA affects the subsequent second-generation library-building sequencing. Therefore, how to establish a CUT & Tag flow suitable for the research of plant transcription factors, especially low-abundance transcription factors, is a great challenge.

The ChIP assay in combination with qPCR is a gold standard for identifying the binding of transcription factors to specific DNA regions. Compared with the traditional ChIP, the conventional CUT & Tag has the important defect that the subsequent fluorescent quantitative PCR experiment like the ChIP-qPCR can not be carried out. This is because, in principle, after the CUT & Tag reaction is complete, uncleaved (non-target) chromatin remains in the system and cannot be removed, and total input chromatin and fragmented target chromatin cannot be distinguished from each other, thus making subsequent qPCR experiments impossible. This deficiency greatly limits the utility of CUT & Tag in identifying specific several preselected DNA binding sites for transcription factors. It is conceivable that researchers on the one hand use CUT & Tag in combination with high throughput sequencing to study the overall binding characteristics in the genome-wide range, but additionally perform the conventional ChIP-qPCR experiment to determine the binding of transcription factors to several gene sites of interest individually, which is extremely unscientific and unreasonable in experimental design, experimental manipulation and reagent consumption.

Due to the defects of the CUT & Tag, the reagent boxes for researching the chromatin state based on the CUT & Tag in the market are all suitable for a small amount of samples, are limited to the operations of library construction and high-throughput sequencing, and are only well suitable for the research in a small amount of animal cells. To date, there is no complete efficient CUT & Tag kit for plant transcription factors.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior CUT & Tag technology in plant application, provides a CUT & Tag-seq and CUT & Tag-qPCR strategy and a corresponding kit which are widely applied to the interaction research of animals and plants, particularly chromatin binding protein (such as transcription factor) with low abundance and DNA, and promotes the development of new technology and means for epigenetic regulation.

The specific technical scheme is as follows:

the invention provides a reagent kit for identifying interaction between transcription factors and chromatin in plants by utilizing CUT & Tag technology, which is characterized by comprising the following components: biotinylated Tn5 transposase, cell nucleus extracting solution, washing solution, antibody hybridization solution, streptavidin washing solution, DNA eluent, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitonin solution, ethylene diamine tetraacetic acid solution, sodium chloride solution, magnesium chloride solution, Triton X-100 solution, sodium dodecyl sulfate solution, glycine solution, preloaded Phase Lock Gel, DNA coprecipitator and PCR reaction solution.

Since the kit is Mediated by a Transposase containing a biotin-labeled linker sequence, we call it a Biotinylated Transposase-Mediated CUT & Tag (Biotinylated Tn5 Transposase Mediated CUT & Tag, B-CUT & Tag).

Further, the biotinylated transposase is formed by incubating the transposase with biotinylated DNA adapter primers; the biotinylated DNA joint primer consists of a double-link joint I formed by annealing a primer A and a primer B and a double-link joint II formed by annealing a primer A and a primer C; primer A contains a fragment of Mosaicend (ME) sequence recognized by transposase, 5 'end is phosphorylated, and 3' end is modified by amino (AminolinkerC 7); the 3 'end of the primer B is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; the 3 'end of the primer C is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; one of the primers B or C is labeled with biotin triethylene glycol at the 5' end.

Preferably, the Tn5 transposase is pG-Tn5 transposase or pA-Tn5 transposase; the cell nucleus extracting solution is Tris buffer solution containing 0.5-1% volume concentration Triton X-100; the washing solution is Tris buffer solution containing protease inhibitor and digitonin; the antibody hybridization solution is Tris buffer solution containing EDTA, BSA, protease inhibitor and digitonin; the streptavidin washing solution is Tris buffer solution containing EDTA and Tween-20; the DNA eluent is a solution containing sodium acetate and formamide; the DNA purification magnetic beads are magnetic beads with surface carboxylation modification.

Preferably, the PCR reaction solution includes: primer I, primer II and PCR premix;

the base sequence of the primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO. 15; the base sequence of the primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO. 23.

The invention relates to a set of integral solution method for identifying interaction between plant transcription factors and chromatin and a related kit. Firstly, a conventional primer modification method is utilized to carry out biotin labeling on a joint primer for embedding transposase, so that a biotin-labeled transposon is generated after embedding, the target gene locus is mediated to be cut by the transposon, and meanwhile, a biotinylated joint carried by the transposon is pasted to the cut DNA locus (cut-and-past principle); secondly, after the total DNA of the CUT & Tag reaction is obtained by a conventional plant DNA extraction method, biotin-streptavidin combination characteristics are utilized, streptavidin magnetic beads are adopted to purify biotinylated target gene DNA fragments from the total DNA, and a large amount of genome DNA which is not identified and CUT by transcription factors and transposase is removed; secondly, carrying out extension reaction on the magnetic beads on the biotinylated double-stranded DNA combined on the magnetic beads by using polymerase, and filling the protruding tail ends generated by cutting the transposase into a flat shape; secondly, denaturing the double-stranded DNA combined on the magnetic beads at a specific temperature by using sodium hydroxide with a certain concentration, releasing the single strand which is not biotinylated in the double-stranded DNA into a solution, further adjusting the pH value to be neutral, precipitating, cleaning and the like to obtain the purified single-stranded DNA with a sequencing joint, wherein the purified single-stranded DNA can be used for subsequent second-generation sequencing library building, more importantly, can also be used for identifying the combination state of a transcription factor and a specific candidate site in a fluorescence quantitative PCR (qPCR) experiment; finally, the present invention provides an optimized subsequent qPCR protocol, i.e. a data analysis strategy.

The invention also provides a method for identifying the interaction between the transcription factor and the chromatin in the plant by utilizing the CUT & Tag technology, which comprises the following steps:

(1) a biotinylated DNA adaptor primer is incubated with Tn5 transposase to assemble a biotinylated Tn5 transposase dimer;

(2) fixing the interaction state of the transcription factor and the chromatin in the cell nucleus, and extracting the cell nucleus of the plant tissue to be detected;

(3) recognizing transcription factors combined with chromatin in a cell nucleus by using a primary antibody and a secondary antibody, recognizing the region where an antibody is located by using a biotinylated transposase dimer, and cutting the chromatin to form a biotin-labeled chromatin fragment;

(4) extracting reacted DNA by using a plant genome DNA extracting solution, and purifying a DNA fragment marked by biotin in the DNA fragment by using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture;

(5) performing PCR library construction by taking streptavidin magnetic bead-DNA fragments as templates, and constructing a high-throughput sequencing library of interaction of transcription factors and chromatins;

(6) performing library quality inspection, high-throughput sequencing and bioinformatics analysis;

alternatively, the first and second electrodes may be,

(A) a biotinylated DNA adaptor primer is incubated with Tn5 transposase to assemble a biotinylated Tn5 transposase dimer;

(B) fixing the interaction state of the transcription factor and the chromatin in the cell nucleus, and extracting the cell nucleus of the plant tissue to be detected;

(C) recognizing transcription factors combined with chromatin in a cell nucleus by using a primary antibody and a secondary antibody, recognizing the region where an antibody is located by using a biotinylated transposase dimer, and cutting the chromatin to form a biotin-labeled chromatin fragment;

(D) extracting reacted DNA by using a plant genome DNA extracting solution, taking out a part of DNA in a DNA solution to be used as input DNA of fluorescent quantitative PCR, combining large fragments in the rest DNA by using DNA purification magnetic beads, and recovering a supernatant solution;

(E) performing biotin-avidin purification on the small fragments in the product obtained in the step (D) by using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture;

(F) eluting the DNA fragment combined on the streptavidin magnetic bead by using a DNA eluent; and taking the eluted DNA as a template to perform fluorescence quantitative PCR;

(G) the fluorescence quantitative PCR data was analyzed by the Δ Ct method.

Further, in the step (1), the specific steps include:

a) preparation of biotinylated DNA linker primers: annealing the primer A and the primer B to form a double-link I, and annealing the primer A and the primer C to form a double-link II;

primer A contains a fragment of Mosaicend (ME) sequence recognized by transposase, 5 'end is phosphorylated, and 3' end is modified by amino (AminolinkerC 7); the 3 'end of the primer B is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing adaptor sequence; the 3 'end of the primer C is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; the 5' end of one of primer B or primer C is labeled with biotin triethylene glycol.

b) Preparation of Tn5 transposase dimer: linker I and linker II were mixed at a ratio of 1:1 to form a linker mixture, and the linker mixture was incubated with Tn5 transposase to form a Tn5 transposase dimer.

Preferably, in step (5), the reaction system for PCR comprises: primer I, primer II and PCR premix; the base sequence of the primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO. 15; the base sequence of the primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO. 23. The reaction procedure for PCR was: 3min at 98 ℃ and 30s at 98 ℃; 30s at 98 ℃, 30s at 60 ℃, 30s at 72 ℃,18-20 cycles, and 5min at 72 ℃.

Preferably, in step (D), the DNA eluate is formulated as a solution containing 30mM sodium acetate and 95% formamide at pH 9.0; the DNA purification magnetic Beads are AMpure XP Beads magnetic Beads.

Preferably, in the step (F), the reaction system of the fluorescent quantitative PCR comprises: SYBR Green, a template, an upstream gene specific primer and a downstream gene specific primer; the templates are input DNA in the step (D) and DNA eluted in the step (F) respectively; the target fragment region covered by the upstream and downstream gene specific primers contains a predicted transcription factor binding motif; the reaction procedure is as follows: 3min at 98 ℃, 30s at 60 ℃, 30s at 72 ℃ and 45 cycles.

Further, in the step (G), the Δ Ct method is any one of:

(G-1) Ct value of Δ Ct ═ antibody group sample-Ct value of IgG control group sample, and enrichment multiple of antibody group fragment ═ 2^-ΔC(ii) a The antibody group is used for carrying out CUT by using an antibody of a target transcription factor specific antibody or an antibody of an anti-fusion protein label as a primary antibody&A sample of the Tag reaction; the IgG control group refers to CUT using IgG&A sample of the Tag reaction;

(G-2)ΔCt＝CUT&ct value of Tag sample-1% input Ct value, then CUT&The proportion of the target fragment in the Tag sample accounting for 1% of its input is 2^-ΔCtX 100%. The CUT&The Tag sample refers to the CUT of antibody group or IgG control group&Tag (Tag). The 1% input DNA is from step (D); finally, the difference in the ratio of the target fragment between the antibody group and the IgG control group was compared.

Experiments show that the combination of B-CUT & Tag and high-throughput sequencing (B-CUT & Tag-seq) can be applied to the research of high-abundance histone modification, and the generated signal is highly consistent with the common CUT & Tag signal. The feasibility and the accuracy of the B-CUT & Tag flow are shown.

Then, the B-CUT & Tag and the high-throughput sequencing (B-CUT & Tag-seq) are applied to the research on the interaction between the plant transcription factor and the chromatin, which cannot be successfully completed by the common CUT & Tag, and a good effect is obtained. Taking the SPL9 transcription factor which is a relatively thorough plant research as an example, the research of the SPL9 target gene is carried out by utilizing B-CUT & Tag, and the result shows that the SPL9 targets the small RNA gene miR172 related to the conversion from the young to the adult of the Arabidopsis plant; targeting multiple MADS box genes associated with flowering pathways (including AP1, LFY, FUL, AGL42, SOC1, etc.); targeting the BRC1 gene to regulate plant branching; targeting MYB genes including TCL1, TRY, CPC and ETC3 to participate in epidermal hair development; genes for synthesizing anthocyanin and wax are targeted so as to participate in regulating and controlling the synthesis of plant secondary metabolites; meanwhile, the interaction between hormone responses is regulated by combining the plant hormones gibberellin and methyl jasmonate signal transduction and response pathway genes. The target genes are highly matched with target genes obtained by the traditional chromatin co-immunoprecipitation technology (ChIP), and are further confirmed by experiments such as a promoter and a gel migration Experiment (EMSA), so that the method has the support of high-quality paper research. Therefore, the B-CUT & Tag-seq is proved to have accuracy and stability in the generated result.

Further, the invention develops a subsequent qPCR system suitable for B-CUT & Tag. Firstly, taking modified qPCR of high-abundance histone H3K4me3 as an example, a primer pair with the same design strategy as ChIP-qPCR, namely a gene-specific upstream and downstream primer pair, is found to be successfully used for qPCR research of histone modification of low chromatin input, and compared with an IgG control group, the method achieves a good enrichment effect. It produces an enrichment signal consistent with the signal trend for CUT & Tag-seq. Further, by taking plant transcription factors AtSPL9 and OsPHR2 as examples, the subsequent qPCR process developed by taking modified qPCR of high-abundance histone H3K4me3 as an example is also suitable for B-CUT & Tag-qPCR of the plant transcription factors. Finally, we have defined the method of CUT & Tag-qPCR data analysis and found that the amplification cycle (Ct) of the IgG control group, as well as the sample's own 1% input before purification, can both be used as normalization control for calculating relative enrichment fold or ratio.

The invention of B-CUT & Tag-seq and B-CUT & Tag-qPCR system and the establishment of the whole experimental scheme in the plant are beneficial to the research of transcription factor-chromatin interaction in the plant. According to the principle of B-CUT & Tag, a large amount of uncleaved non-target gene chromatin can be removed by biotin avidin purification without affecting downstream library-building sequencing. Theoretically, the transcription factor with low abundance can also achieve the purpose of target gene analysis by flexibly adjusting the dyeing quality used by the reaction or combining a plurality of experimental chromatin for purification strategies.

Compared with the prior art, the invention has the following beneficial effects:

compared with the existing CUT & Tag technology, the B-CUT & Tag technology connects a biotin-labeled joint to a target site of a transcription factor through Tn5 transposase, eliminates uncut non-target chromatin through a biotin avidin purification step, and purifies a chromatin fragment labeled by biotin, so that the use level of the chromatin in a reaction system can be flexibly expanded according to the requirement without influencing downstream library construction sequencing.

More importantly, compared with the conventional CUT & Tag technology, the establishment of the B-CUT & Tag and a subsequent qPCR system makes up the defect that the conventional CUT & Tag technology cannot carry out qPCR, realizes the same function as the traditional gold standard method for identifying the combination of the transcription factor and the specific site of the chromatin, namely the combination of chromatin immune work precipitation and the qPCR (ChIP-qPCR), and is simpler than the ChIP in experimental operation.

Drawings

FIG. 1 shows the technical principle of the CUT & Tag kit of the present invention.

FIG. 2 is a comparison of the B-CUT & Tag workflow with that of conventional chromatin co-immunoprecipitation (ChIP).

FIG. 3 shows the result of the modification state analysis of the Arabidopsis thaliana plant leaf cell histone H3K4me3 using the B-CUT & Tag technology;

wherein a is the correlation analysis result of sequencing signal distribution among different samples; b is a heat map of the signal of three different CUT & Tag samples in the vicinity of the coding gene.

FIG. 4 is an electrophoretic gel image of the target gene research experiment process of SPL9 using B-CUT & Tag;

wherein, two anti-FLAG samples (anti-FLAG rep1 and anti-FLAG rep2) are two experimental repeats, and two IgG samples are two negative controls; the sample is unbound DNA after streptavidin purification.

FIG. 5 is a distribution heat map of signal generated by analysis of the target gene of SPL9 using B-CUT & Tag-seq; two SPL9 were used for two experimental replicates and two IgG samples were used for two negative controls.

FIG. 6 is a summary of the target genes of some known SPL9 successfully identified using the B-CUT & Tag technique.

FIG. 7 is a graph showing the results of identifying the modification levels of histone H3K4me3 in two different regions of a specific GB _ D10G1774 gene locus by B-CUT & Tag-qPCR.

Wherein a is a schematic representation of the combination of four sticky linkers for Tn5 transposase cleavage of target chromatin; b is an IGV diagram of the CUT & Tag-seq result of GB _ D10G1774 sites from top to bottom by taking a gene GB _ D10G1774 as an example, a statistical diagram of the H3K4me3 experiment group and an IgG control group respectively comparing the number of reads in different regions, and a CUT & Tag-qPCR result diagram of the relative content of fragments in different regions in the H3K4me3 experiment group and the IgG control group; c is the qPCR result of the corresponding region of the same gene locus, wherein the control group is the DNA before the sample self biotin avidin is purified, i.e. input DNA.

FIG. 8 shows that the use of primer P1 in B-CUT & Tag-qPCR results in non-specific amplification.

Wherein a is a schematic diagram of causes of P1 single-primer non-specific amplification in qPCR; b is the qPCR amplification plot of the experimental and control groups in the presence of a single primer of P1.

FIG. 9 is a diagram showing the results of identifying the combination of Arabidopsis SPL9 transcription factor and rice PHR2 transcription factor with their target genes by applying B-CUT & Tag-qPCR.

Wherein a is igv picture of signal enrichment conditions of three target gene loci in the result of Arabidopsis SPL9 transcription factor B-CUT & Tag-seq, and AtACT2 gene is used as a control; panel B is a graph comparing RPM (number of reads per million reads aligned to the region) aligned to the qPCR target region (panel a) in the data for B-CUT & Tag-seq at rSPL9 experimental group to IgG control group; FIG. c is a graph of the B-CUT & Tag-qPCR results of the enrichment degree of the target regions of AtTCL1, AtTRY, AtFUL and AtACT2 when the rSPL9 experimental group is compared with the IgG control group; d is a distribution diagram of the P1BS motif of the known three target gene promoter region of the rice PHR2 transcription factor; the e-diagram shows the B-CUT & Tag-qPCR results of the enrichment degree of the target regions of OsPT2, OsPT8 and OsRAM1 in the PHR2 experimental group compared with the IgG control group under the treatment conditions of different phosphorus deficiency (-P) and sufficiency (+ P).

Detailed Description

The invention is further described with reference to the drawings and specific examples, which are not intended to be limiting in any way. The reagents, methods and apparatus employed in the present invention are conventional in the art, unless otherwise indicated. Unless otherwise indicated, the reagents and materials used in the following examples are all commercial reagent formulations.

Example 1B-CUT & Tag technical principles and operational procedures

First, generation of Tn5 transposase with biotin-labeled linker

The Tn5 transposase fused to protein A used in the experiment was commercially available at a concentration of (500 ng/. mu.L or 7.5 pmol/. mu.L).

1.1 adaptor primer Synthesis:

the primer joint is obtained by synthesizing a conventional primer and a modified primer, and the three primers comprise a primer A, a primer B and a primer C; the base sequence is shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in sequence. Wherein, the primer A is an ME sequence fragment recognized by transposase and modified by 5 '-phospate, 3' -AminolinkerC 7; the 3' end of the primer B is a sequence which is reversely complementary with the primer A, and the 5' end is modified by a sequencing joint sequence 5' end Biotin TEG; the primer C is a common primer, the 3 'end of the primer C is a sequence which is reversely complementary with the primer A, and the 5' end of the primer C is a sequencing joint sequence.

Different sequencing platform linker sequences differ and are not limited to this sequence. The specific sequences of the primers are shown in Table 1.

TABLE 1 list of adapter primers

1.2 primer annealing to form double-stranded linker:

primers were dispensed per tube at 1 OD. The primers were dispensed into a 100 μ M stock solution (which could be stored for long periods at-20 degrees) by adding annealing buffer, and the following reactions were set up in two PCR tubes:

reaction 1 (linker AB), 10. mu.L of primer A (100. mu.M), 10. mu.L of 100. mu.M primer B (100. mu.M);

reaction 2 (linker AC), 10. mu.L of primer A (100. mu.M), 10. mu.L of 100. mu.M primer C (100. mu.M).

The above tube was placed in a PCR instrument and the following procedure was run: using a hot cover, 75 ℃,15 minutes; 10 minutes at 60 ℃; 10 minutes at 50 ℃; 10 minutes at 40 ℃; 25 ℃, 30 minutes). The resulting linker concentration was 50 pmol/. mu.L per linker.

1.3 biotinylated transposase generation (formation of transposase dimers):

embedding of transposase was performed in a 1.5ml centrifuge tube by setting up the following reaction: 10 μ L of pA-Tn5 transposase (500 ng/. mu.L or 7.5 pmol/. mu.L), 0.75 μ L of linker AB (50 pmol/. mu.L), 0.75 μ L of linker AC (50 pmol/. mu.L), 7.25 μ L of embedding buffer, 18.75 μ L in total. Thus, the ratio of linker mixture to transposase in the system is 1: 1. And (3) blowing and beating the mixture by using a gun head for 20 times, uniformly mixing the mixture, placing the mixture in a 30-DEG water bath kettle for 1 hour to obtain the transposase with the concentration of 4 pmol/mu L, and storing the embedded transposase at-20 ℃.

Second, the configuration of each component of the kit

The configuration scheme (taking the optimal composition as an example) of each component of the kit is as follows:

the kit comprises 1 core enzyme (pA-Tn5 or pG-Tn5 transposase), 5 buffer solution stock solutions (10 xIsoB, 10 xWB, 5xAB, 2 xSA WB, EB), 2 magnetic beads, 2 antibodies (IgG negative control antibody and H3K4me3 positive control antibody, and 11 other reagents/consumables, and is prepared to the concentration shown in Table 2, wherein the 5 buffer solution stock solutions are prepared according to the formula shown in Table 3, and before the experiment is started, the working solution is prepared according to the formula provided in Table 4 and is used as the current product.

TABLE 2 kit Components List

TABLE 3 stock solution formulation

TABLE 4 formula of working solution (for ready use)

FIG. 1 is a technical principle of the CUT & Tag kit of the present invention, which shows that a biotin-labeled transposase participates in the CUT & Tag reaction, and the target site chromatin is cleaved and biotinylated linkers are attached to obtain biotinylated chromatin fragments, which are further purified based on biotin avidin to obtain products for subsequent library construction sequencing or fluorescent quantitative PCR.

Third, B-CUT & Tag specific steps

(a) Performing formaldehyde crosslinking treatment on the plant tissue, fixing the interaction state of the transcription factor and the chromatin in the cell nucleus, and extracting the complete cell nucleus of the plant tissue to be detected;

wherein, the key of the extraction is that the cell after cracking is filtered by a 500-mesh filter screen, the cell nucleus passing through the filter screen is collected and is gently washed by WB (C +) buffer solution; WB (C +) buffer diluted 1x WB stock solution provided with kit, and protease inhibitor cocktail added at 1: 1000.

(b) Tn5 transposase with a biotin-labeled linker was generated (see section one).

(c) Primary antibody incubation: resuspending the nuclei in Ab buffer, adding primary antibody for incubation;

wherein the volume ratio of the cell nucleus (volume under centrifugal force of 300 Xg-400 Xg) to AB buffer is 1:20, i.e. 50. mu.L of cell nucleus is resuspended in 1mL Ab (buffer; amount of 250. mu.L of each reaction cell nucleus suspension, content of primary antibody is 2. mu.g (1:125 dilution), AB buffer is 5xAB stock solution provided by kit is diluted to 1X concentration, protease inhibitor cocktail is added at 1:1000, and 5% w/v of digitonin (digitonin) is added at 1:50 (0.1% final concentration) or 1:100 (0.05% final concentration) by volume.

(d) And (3) secondary antibody incubation: the cell nucleus is washed gently to remove the primary antibody which is not combined, and a secondary antibody is added for amplifying the signal; wherein, the content of the secondary antibody is 250 μ L WB (C + D +) buffer containing 1 μ g (1:250 dilution), the WB (C + D +) buffer is 10 XWB mother liquor provided by the kit and diluted to 1X concentration, protease inhibitor cocktail is added at 1:1000, and 5% w/v digitonin (digitonin) is added at 1:100 (0.05% final concentration) volume ratio.

(e) And (3) transposase incubation: washing cell nucleus to eliminate un-combined secondary antibody, adding pA-Tn5 transposase for hatching; wherein, the content of Tn5 transposase is 250. mu.L T IB buffer solution containing 8pmol pA-Tn5 transposase, and the T IB buffer solution is obtained by adding 3M sodium chloride solution into WB (C + D +) in the step (h) in a volume ratio of 1: 20.

(f) Fragmentation: the cell nuclei were washed gently to remove unbound pA-Tn5 transposase, and a TB buffer was added to carry out the fragmentation reaction. Wherein, the TB buffer is obtained by adding 3M sodium chloride solution into WB (C + D +) in the step (h) at a volume ratio of 1:20, adding 1M magnesium chloride solution at a volume ratio of 1:100, and cutting at 37 ℃ for 1 hour.

(g) Biotin avidin purification of DNA: after the reaction in the step (f) is finished, extracting DNA according to a conventional method, and purifying streptavidin magnetic beads; adding DNA into the pre-cleaned streptavidin magnetic beads, rotationally incubating for 30-40 minutes at room temperature, combining biotinylated DNA fragments onto the streptavidin magnetic beads, cleaning to obtain a streptavidin magnetic bead-DNA mixture, and finally suspending in sterile water;

wherein, the concentration of the streptavidin magnetic bead is 10mg/ml, and each mg of the streptavidin magnetic bead can be combined with 3500pmol biotinylated DNA fragment; the dosage of the streptavidin magnetic beads is 5-10 mul; the method for pre-cleaning and activating the streptavidin magnetic beads comprises the following steps: washing streptavidin magnetic beads with 1 × SA WB buffer solution for 2 times, washing with 2 × SA WB buffer solution for 1 time, and finally resuspending in 2 × SA WB buffer solution; 2 XSA WB buffer is provided for the kit, and 1 XSA WB is obtained by diluting 2 XSA WB buffer; the magnetic bead-DNA mixture was finally resuspended in 50. mu.l sterile water.

(h) PCR on magnetic beads: performing PCR library building by taking the product of the step (g) as a template, wherein the reaction system is as follows: the product of step (g) (42. mu.l), 4. mu.l primer N70X, 4. mu.l primer N50X, 50. mu.l PCR mix; the reaction procedure is as follows: 3min at 98 ℃ and 30s at 98 ℃; 30s at 98 ℃, 30s at 60 ℃, 30s at 72 ℃,18-20 cycles, 5min at 72 ℃; wherein, the base sequences of the primers N701-N712 are shown in SEQ ID NO.4-SEQ ID NO. 15; the base sequences of the primers N501-N508 are shown in SEQ ID NO.16-SEQ ID NO. 23.

(i) Library quality inspection, high throughput sequencing and bioinformatics analysis.

The principle of the B-CUT & Tag technology is shown in figure 1, a biotin-labeled transposase DNA linker is utilized, a biotin-labeled primer linker is added into a DNA fragment when the transposase CUTs chromatin, DNA is purified by a subsequent biotin-streptavidin system, and then PCR (polymerase chain reaction) library construction is carried out.

Compared with the conventional CUT & Tag, the B-CUT & Tag joint primer is labeled by biotin; thus, after the embedding is complete, the mature transposon is added with a biotin-labeled linker. In the nucleus, a target protein bound to a piece of chromatin is recognized by its specific antibody or by an antibody to the fusion tag of the protein of interest, followed by recognition and binding of the Tn5 transposase fused to protein a to the antibody, which, upon activation of magnesium ions, activates and cleaves chromatin in situ. Tn5 transposase works by cutting and attaching, cleaving chromatin, and adding a linker sequence to the cleaved site, since the linker is biotin-labeled in B-CUT & Tag, the resulting chromatin fragmentation is finally biotin-labeled.

The second greatest difference between B-CUT & Tag and ordinary CUT & Tag is the subsequent biotin avidin purification and magnetic bead in situ PCR library construction. Fragmented chromatin can be purified using avidin magnetic beads due to the biotin label. Since biotin-avidin binding is a very stable ligand and receptor binding, once binding has occurred, it is very difficult to separate the two. Therefore, B-CUT & Tag developed magnetic bead in situ PCR pooling. Because only one joint primer is marked, one chain of double-chain DNA generated by Tn5 transposase fragmentation is not marked by biotin, the DNA can be denatured under the PCR heating program, and the hydrogen bonds of the base pairs in the nucleic acid double-helix structure are broken, so that the process of changing double chains into single chains is used as an amplification template, thereby greatly reducing the influence of magnetic beads on PCR.

Compared with the traditional ChIP, the B-CUT & Tag technology still has incomparable advantages. FIG. 2 shows a comparison of B-CUT & Tag with the ChIP flow. It can be seen that B-CUT & Tag does not require sonication to break chromatin, and how well sonication breaks chromatin is often a direct decision on the success of the ChIP reaction. For different fixed time and different amounts of chromatin, the condition search for ultrasonic disruption is a very challenging process, and the subsequent decrosslinking verification of the disruption effect also needs a lot of time. In addition, the B-CUT & Tag technology is directly added with a sequencing adaptor primer in the fragmentation process, PCR library construction can be directly carried out subsequently, and library construction can be carried out after the adaptor is added to a corresponding kit for ChIP subsequent library construction.

Example 2 study of chromatin Histone modification Using B-CUT & Tag-seq

This example first investigated the feasibility of the B-CUT & Tag technology and the stability of the signal. Using histone modification H3K4me3 as an example of the study, the consistency and stability of B-CUT & Tag-seq and conventional CUT & Tag-seq in signal were compared according to the experimental system reported in the literature for small amount of input chromatin to histone (reference DOIhttps:// doi.org/10.1186/s 13007-020-00664-8). This example also sets a sample (B-CUT & Tag beads-) obtained by directly subjecting the extracted DNA to PCR as in the conventional CUT & Tag without performing streptavidin magnetic bead purification, and used to detect whether the transposase activity labeled with a biotin linker is affected. In addition, this example also sets up a negative control for IgG to assess the intensity of background shear.

The results show that, for the three samples of CUT & Tag, B-CUT & Tag-and B-CUT & Tag of H3K4me3, the signals have high consistency (correlation coefficient >0.99) among the three samples from the consistency of the signals (FIG. 3 a). Analysis of the enriched peaks was performed using macs2 software, yielding 17076,18632 and 17309 peaks from CUT & Tag, B-CUT & Tag beads-, and B-CUT & Tag samples, respectively, that were similar in number and that were highly consistent in signal intensity and signature near the gene (fig. 3B).

The results show that the B-CUT & Tag is technically feasible, and the biotin labeling and magnetic bead in-situ PCR can not influence the signal, namely the generated signal is highly consistent with the conventional CUT & Tag. This is the basis for further proceeding with the transcription factor B-CUT & Tag.

Example 3 study of transcription factor-DNA interaction Using B-CUT & Tag-seq

This example combines B-CUT & Tag with second generation sequencing (B-CUT & Tag-seq) to be applied to the study of plant transcription factor and DNA interaction for identifying the target gene locus of the transcription factor. This example was conducted by taking the transcription factor SPL9, which is frequently studied in plants, as an example, and it was investigated whether B-CUT & Tag can be used for the gene targeting a plant transcription factor.

SPL9 has been reported to be involved in the regulation of a variety of developmental and metabolic pathways, including juvenile to adult transition, flowering, epidermal hair development, anthocyanin and epidermal wax synthesis, branch development, and plant hormone response through signal transduction key genes targeting methyl jasmonate and gibberellins. The target genes of these pathways have been well validated in various high-level research papers (e.g., by promoter analysis, transgenics, gel-block in vitro experiments, etc.).

The kit and the B-CUT & Tag method provided in example 1 are adopted to analyze and identify SPL9:

the first day:

formaldehyde crosslinking and extraction of cell nuclei (Steps 1 to 11)

1. 0.5 g of pSPL 9:3xflag-rSPL 9 transgenic Arabidopsis inflorescence was placed in a medium containing 25 mlIsoB(F+)And then the mixture is vacuumized and fixed for 10 minutes in a 50 ml centrifuge tube.

2. 2.5 ml of 2M glycine was added, mixed gently and mixed, and the reaction was terminated by continuing to evacuate for 5 minutes.

3. The fixed inflorescence material was washed 3 times with sterile water, and then excess water was removed with absorbent paper.

4. The material was milled in liquid nitrogen to a fine powder.

5. Placing the milled inflorescence into a 50 ml centrifuge tube, adding 25 ml of ice for precoolingIsoBGently mixing, placing on ice and gently shaking for 5 minutes to uniformly resuspend the material, centrifuging at 400x g for 5 minutes at 4 ℃, and collecting the precipitate.

6. The supernatant was removed and the material was resuspended in 10 mlIsoB(T+)And gently mixing, and placing the centrifuge tube on ice to crack for 5-10 minutes.

7. The lysate was filtered through a 500 mesh cell screen, large unlysed tissue would be left on the screen, and the nuclei would be collected in an underlying petri dish through the cell screen pores.

8. The lysate containing the nuclei was collected in 2 ml centrifuge tubes and centrifuged at 400x g for 5 minutes at 4 degrees to collect the nuclei.

9. The supernatant was removed and all nuclei were resuspended and pooled in 1mlWB (C + E +) in400x g centrifugal force, 4 degrees centrifugal 5 minutes, collection of nuclei. Up to this point, nuclei can be collected in a volume of-50. mu.L.

10. The supernatant was removed, and by this time nuclei were collected in a volume of-50. mu.L. Adding 1mlWB(C+E+)Resuspending the nuclei, 400 Xg centrifugationForce, centrifuge at 4 degrees for 5 minutes, and collect nuclei.

11. Repeating the step 10 for three times, finishing the last cleaning, removing the supernatant, continuing to carry out centrifugal force of 400 Xg and 4 ℃ for 2 minutes, and absorbing the residual supernatant as much as possible.

Primary antibody incubation (steps 12 to 17)

12. 50 μ L of nuclei was taken up in 1mlAB(C+D+)Resuspending, placing on ice for use

13. The following reactions were set up in a 1.5ml centrifuge tube: two IgG control groups, each replicate containing 250 μ L nuclear resuspension, 2ug IgG; two antibody panels, each replicate containing 250. mu.L of nuclear resuspension, 2ug anti-Flag antibody. Mix gently, shake horizontally on a rocker at 12rpm at 4 degrees, incubate overnight.

14. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

15. Adding 800 μ LWB(C+D+)Resuspend the nuclei, place on a horizontal rocker, incubate for 5min at room temperature at 12 rpm.

16. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

17.350x g centrifugal force, 4 degrees continue centrifugation for 2 minutes, trying to remove excess supernatant.

Incubation with Secondary antibody (steps 18 to 22)

18. Add 250. mu.L of 1ug secondary antibodyWB(C+D+)Resuspend the nuclei, mix gently, place in horizontal rocker and incubate at room temperature at 12rpm for 1 hour.

19. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

20. Adding 800 μ LWB(C+D+)Resuspending the nuclei, gently mixing, placing on a horizontal rocker shaker, and incubating at room temperature at 12rpm for 5 min.

21. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

22. Repeating the incubation steps 21 to 22 for three times, and after the last washing, performing centrifugal force of 350x g at 4 ℃ for 2 minutes to remove excessive supernatant as much as possible. Transposase incubation steps 23 to 27.

23. Add 250. mu.L containing 8pmol transposaseTIBResuspending the nuclei, gently mixing, placing in a horizontal shaking table, and incubating at room temperature and 12rpm for 3-4 hours.

24. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

25. Adding 800 μ LWB(C+D+)Resuspending the nuclei, gently mixing, placing on a horizontal rocker shaker, and incubating at room temperature at 12rpm for 5 min.

26. The reaction tube was removed from the shaker, centrifuged at 350x g for 4 minutes at 4 degrees, the nuclei were collected, and the supernatant was removed.

27. Repeating the incubation steps 25 to 26 for three times, and after the last washing, performing centrifugal force of 350x g at 4 ℃ for 2 minutes to remove excessive supernatant.

Fragmentation reaction and De-crosslinking (steps 28 to 30)

28. Adding 300 mu LTBResuspend nuclei, incubate in 37 ℃ water bath for 1 hour, and perform fragmentation reaction.

29. The reaction was stopped by adding 15. mu.L EDTA, 15. mu.L 20% SDS to each tube.

30. The reaction tube was placed in a 65 ℃ water bath overnight for decrosslinking.

DNA extraction (Steps 31 to 38)

31. Add 300. mu.L CTAB plant DNA extract and incubate in a 65 ℃ water bath for 39 minutes, during which time mix gently by inversion every 10 minutes.

32. Adding 600 μ L phenol, chloroform and isoamyl alcohol (25: 24; 1), reversing thoroughly and mixing

33. Centrifuge tubes 13000xg pre-loaded with phase gel lock were pre-centrifuged for 2 minutes and then the samples were transferred to the phase gel lock centrifuge tubes for 13000x g, 4 ℃ centrifugation for 10 minutes.

34. The supernatant (ca. 600. mu.L) was transferred to a new 1.5ml centrifuge tube, 600. mu.L chloroform was added, and 13000x g was mixed thoroughly upside down and centrifuged at 4 ℃ for 10 minutes.

35. The supernatant (ca. 600. mu.L) was transferred to a new 1.5ml centrifuge tube, 600. mu.L isopropanol, 2. mu.L coprecipitate was added, mixed well and left to settle at-20 ℃ for 1 hour.

36.13000x g, centrifuge at 4 degrees for 10 minutes.

37. The supernatant was removed, the DNA pellet was washed with 75% ethanol, 13000x g, and centrifuged at 4 ℃ for 5 minutes.

38. The supernatant was removed and then 13000x g, 4 degree distance continued to flash for 30 seconds, trying to remove the supernatant. After drying under vacuum for 2 minutes, the DNA was redissolved in 150. mu.L of sterile water.

Biotin streptavidin purification (steps 39 to 46)

39. Resuspend 5-10. mu.L streptavidin magnetic beads in 500. mu.L1×SA WBAnd (4) mixing uniformly, placing on a magnetic rack for about 5 minutes, and collecting magnetic beads.

40. The supernatant was removed, the centrifuge tube was removed from the magnetic holder, and the magnetic beads were resuspended in 500. mu.L1×SA WBMixing, placing on a magnetic frame for about 5 minutes, and collecting magnetic beads. The supernatant was removed. (second washing).

41. The centrifuge tube was removed from the magnetic rack and the magnetic beads were resuspended in 500. mu.L2×SA WBMixing, placing on a magnetic rack for about 5 minutes, and collecting magnetic beads. The supernatant was removed.

42. The centrifuge tube was removed from the magnetic rack and the magnetic beads were resuspended in 150. mu.L2×SA WBAdding the 150 mu LDNA sample obtained in the step 38, mixing uniformly, and placing the mixture in a hybridization furnace for 20-30 minutes of rotary incubation at normal temperature.

43. After the incubation, the centrifuge tube was placed on a magnetic rack for about 5 minutes to collect the magnetic beads. The supernatant was removed.

44. The centrifuge tube was removed from the magnetic rack and the magnetic beads were resuspended in 500. mu.L1×SA WBMixing, and rotary washing in a hybridization oven at normal temperature for 5 min. The centrifuge tube was then placed on a magnetic rack for about 5 minutes to collect the magnetic beads. The supernatant was removed.

45. The washing step was repeated 3 times in total in step 44.

46. The beads were resuspended in 30. mu.L of sterile water, at which point the product was a mixture of biotinylated DNA fragments bound to streptavidin magnetic beads.

Second generation sequencing library building (steps 47 to 50)

47. The following reactions were set up in a PCR tube: 30 μ L of the DNA product from step 46, 12 μ L of sterile water, 50 μ L of 2 XPCR mix,4 μ L N50X, 4 μ L N70 3870 70X. Mixing, and dripping 50 μ L paraffin oil on the upper layer to prevent evaporation.

48. The following program was set up in the PCR instrument: 72 degrees 3 minutes, 98 degrees 30s, then 98 degrees 30s,60 degrees 30s, 72 degrees 30s,16-18 cycles, and finally a 72 degree extension of 5 minutes.

After the PCR is finished, the product is temporarily placed on ice, 3 μ L of the product is taken out, and the concentration and size distribution of the product are detected by gel electrophoresis. If no significant band enrichment was detected, 2 cycles were added per round as appropriate.

PCR amplification products were purified and recovered using 1.2-fold volume of DNA purification magnetic beads (e.g., commercially available AMPure XP magnetic beads).

In the process of the development of the process, because biotin avidin is difficult to separate again after being combined, the single-stranded DNA is recovered by treating the DNA with 300mM NaOH at 65 ℃ for 10 minutes, and the subsequent pH adjustment and DNA re-precipitation purification are found to be required, so that the final yield is not high.

Therefore, the magnetic bead in-situ PCR method is tried, the streptavidin magnetic bead combined with the biotinylated DNA fragment is used as a template for PCR reaction, paraffin oil is added to the upper layer of a PCR tube, the PCR tube is flicked and mixed uniformly after 2-3 cycles in the PCR process to prevent the magnetic bead from settling, and meanwhile, the using amount of the magnetic bead is strictly controlled to prevent the excessive magnetic bead from inhibiting the PCR.

According to the established protocol, we performed B-CUT & Tag experiments on SPL9 overexpressing plants. FIG. 4 shows the absence of chromatin bound to magnetic beads (chromatin not cleaved by transposase recognition and biotinylated) during the course of the SPL 9B-CUT & Tag-seq experiment following the biotin avidin purification step. These uncleaved chromatin were essentially not the target sites of SPL9 and were removed after the purification step, while the purified biotinylated fragments were subjected to high-throughput sequencing by magnetic bead in situ PCR.

After bioinformatics analysis, 6383 enriched peaks are obtained as a result, and 4476 target genes are related (some target genes are enriched to have more than one enriched peak, so that the number of the peaks in the result is more than that of the target genes). The signals of these enriched peaks were distributed mainly upstream of the gene transcription start site (promoter region) (FIG. 5). Very importantly, similar to ChIP results, B-CUT & Tag accurately identified all the above-mentioned target genes of the relevant developmental and metabolic pathways in which SPL9 participates, including non-coding RNA (miR172), multiple MADS box, MYB, DELLA and JAZ genes, as well as secondary metabolites anthocyanin (F3' H) and key genes for wax synthesis (CER1) (fig. 6).

In addition, a series of unreported target genes are identified, and exist in B-CUT & Tag and the results of the traditional ChIP (shared target genes) at the same time, and the target genes which can be stably identified by different experimental principle technologies can be simultaneously and stably identified, so that the target genes are the research objects which are focused in the subsequent research and have a very good prompting function for researching a new way and a new function of the SPL9 participating in regulation.

Therefore, through the process of the embodiment and the experiment performed by taking the arabidopsis thaliana SPL9 transcription factor as an example, we conclude that the combination of B-CUT & Tag and second-generation sequencing (B-CUT & Tag-seq) can be well applied to the research of the interaction between plant transcription factor and DNA, and is particularly suitable for large-scale screening of the target gene locus of the transcription factor from the genome range.

Example 4 study of the modification level of histone H3K3me3 at a specific gene locus using B-CUT & Tag-qPCR

In this example, experiments were conducted to determine whether the subsequent B-CUT & Tag can be combined with fluorescence quantitative PCR (B-CUT & Tag-qPCR) to perform the same function as the conventional ChIP-qPCR and to identify the combination of transcription factors with specific target sites.

The B-CUT & Tag-qPCR system is explored by taking the modification level of sea island cotton leaf group protein H3K3me3 as a research target.

The procedure of B-CUT & Tag modified by H3K3me3 of Gossypium barbadense was similar to that of example 3, but the difference in the amount of nuclei used was that the amount of buffer, antibody and transposase used in some of the procedures was 100. mu.L modified with H3K3me 3. Also, no secondary antibody is required for signal amplification.

The method comprises the following specific steps:

the procedure of steps 1 to 46 in example 3 was carried out, except that the following steps were varied:

step 13. set up the following reaction in a 1.5ml centrifuge tube: two IgG control groups, each replicate containing 100 μ L nuclear resuspension, 1ug IgG; two anti-H3K4me3 antibody panels, each replicate containing 100. mu.L nuclear resuspension, 1ug anti-H3K4me3 antibody. Mix gently, shake horizontally on a rocker at 12rpm at 4 degrees, incubate overnight.

Secondary antibody incubation steps 18-20 are omitted.

Step 23. Add 100. mu.L TIB containing 4pmol transposase, resuspend the nuclei, mix gently, place on a horizontal rocker shaker, incubate for 3-4 hours at room temperature at 12 rpm.

Step 38, remove the supernatant, then 13000x g, continue the flash 30 seconds apart at 4 degrees, try to remove the supernatant. After drying under vacuum for 2 minutes, the DNA was redissolved in 120. mu.L of sterile water. mu.L of DNA was removed and designated "input", and the remaining 100. mu.L was added to 50. mu.L (1:0.5) of DNA purification Beads (e.g., AMpure XP Beads), bound for 20 minutes at room temperature, the Beads were separated using a magnetic stand, and small fragments (. about.150. mu.L) of the supernatant that were not bound by the Beads were collected.

The product was then purified with biotin avidin as described in steps 39 to 45.

In step 46, 50. mu.L of EB buffer was added to the resultant streptavidin magnetic bead-DNA mixture, and DNA was eluted at 90 ℃ for 10 minutes. Supernatants were collected by magnetic rack separation and products were used for subsequent qPCR analysis.

qPCR and data analysis (Steps 51 to 55)

51. After the step 46, a qPCR primer pair with specific target site sequences is designed according to the similar primer design principle of ChIP-qPCR and is recorded as GSPf and GSPr.

52. The qPCR reaction system was set according to the following principle: the template is DNA of an antibody group and an IgG control group, and 1 mu L of the DNA obtained in the step 46 is added into each tube system; reactions were set for both antibody and IgG control input DNA with 1. mu.L of input DNA in step 38 as template, and recorded as 1% input. 3 technical replicates were set up for each reaction.

53. calculation of amplification cycle number (Ct value) of sample after qPCR reaction

54. The content of the target sequence in different samples is calculated by adopting a delta Ct method, and Ct of an IgG control group is used as normalized control. Ct of the IgG control group was subtracted from Ct of the antibody test group, and Δ Ct ═ Ct_{Antibody test panel}-Ct_IgGThen the enrichment factor of the target sequence in the antibody experimental group compared with the IgG control group is 2^-ΔCt。

55. Alternatively, the Ct of 1% input of the sample itself is used as a normalized control. Δ Ct ═ Ct_Sample(s)–Ct_1％input(ii) a The samples refer to an antibody group and an IgG control group; the ratio of 1% input of the target sequence in the sample is 2^-ΔCtx 100%, the difference in the ratio of the antibody group to the IgG control group was compared.

According to the embedding and working rules of transposase dimers, we conclude that after chromatin target sites are cleaved by transposase, two linker primers in a transposase dimer are combined two by two and then added to the fragmented DNA sequence in four different "sticky" ways (fig. 7a, left).

Therefore, a public joint Primer P1 (with the sequence of ATTACTAGGTCTCGTGGGCTCGG; qPCR, overlap with Primer C) and a qPCR Primer pair with specific target site sequences are designed according to the ChIP-qPCR Primer design principle and are recorded as GSPf and GSPr, and theoretically, the target fragment generated in the scene 1 can be identified through the combination of the primers P1/GSPr; through the combination of the primers P1/GSPf, the target fragment generated in the scene 2 can be identified; the target fragment sum of scene 1, scene 2 and scene 4 can be identified through the combination of the target site specific primer pairs GSPf and GSPr. In scenario 3, since both of the incorporated linkers C were not biotinylated, this partial product was lost during the biotin avidin purification step and is not listed in the range identifiable by qPCR (fig. 7a, right).

We used the target site sequence specific qPCR primer pair (GSPf/GSPr) to perform qPCR after H3K4me3 modified B-CUT & Tag reaction. Taking gene GB _ D10G1774 as an example, the 5 'end (region 1) of the gene with high H3K4me3 modification level and the 3' downstream (region 2) of the gene with high H3K4me3 modification level are respectively selected, two pairs of gene-specific GSPf/GSPr primers are respectively designed, and the primer sequences are shown as SEQ ID NO.24-SEQ ID NO. 27.

The qPCR results showed that the content of the target region in the H3K4me3 experimental group was 10 times higher than the control group at region 1 compared to the IgG control group, while at region 2 there was no significant enrichment compared to the control group, which is consistent with the trend of the statistical results of the fragment readings (reads count) obtained from B-CUT & Tag-seq (fig. 7B). Meanwhile, I also evaluated another normalization method, namely 1% of input DNA before streptomycin affinity purification of a sample is used as a normalization control, and the result shows that the proportion of the target fragment of the H3K4me3 experimental group at the area 1 is 36.6% of that of the 1% of the input control, and the proportion of the target fragment of the IgG control group at the area 1 is 3.59% of that of the 1% of the input control; the H3K4me3 experimental group was significantly enriched in the target fragment of region 1. Whereas in region 2, the proportion of the H3K4me3 experimental group target fragment was 2.45% of its 1% input control, whereas the proportion of the IgG control group target fragment was 2.34% of its 1% input control (fig. 7c), the H3K4me3 experimental group target fragment was not significantly enriched in region 2.

Since gene-specific primers cannot exclude a biotin-labeled large fragment (>1000bp) generated by transposase background cleavage, we tried the feasibility of qPCR after H3K4me 3-modified B-CUT & Tag reaction by pairing the common primer sequence P1 with the target site sequence-specific GSPf and GSPr, respectively. We found that the non-specific PCR amplification occurred during PCR in the presence of only the P1 primer from the cleavage of two overlapping or partially overlapping DNA fragments from scene 1 and scene 2, respectively (fig. 8).

Thus, qPCR using a combination of common primer P1 and specific primers is not recommended.

In order to solve the problem that a gene-specific primer cannot exclude a large fragment (>1000bp) of a biotin label generated by background cleavage of transposase, a step of fragment sorting is added before biotin avidin purification, and the large fragment generated by background cleavage is removed by DNA purification magnetic beads (step 38).

Therefore, we successfully established the B-CUT & Tag-qPCR process.

Example 5 study of transcription factor binding to predicted target Gene site Using B-CUT & Tag-qPCR

Finally, to determine whether the B-CUT & Tag-qPCR process established by the user based on the histone modification level is suitable for verifying the specific binding of the transcription factor, the B-CUT & Tag-qPCR of the plant transcription factor is carried out according to the B-CUT & Tag operation process of the transcription factor in example 1 and the qPCR process in example 4 by taking Arabidopsis SPL9 and an important transcription factor PHR2 related to the phosphorus metabolism of rice as an example. As the AtSPL9 and OsPHR2 overexpressed Arabidopsis and rice used by us are 3xFLAG Tag fusion proteins, the anti-FLAG antibody is still used in the CUT & Tag system.

Specific binding of Arabidopsis SPL9 was first determined using B-CUT & Tag-qPCR. The target genes of AtSPL9, which we have reported and studied in detail in three documents, including AtTCL1, AtTRY (Yu et al, 2010) in Arabidopsis trichome development and AtFUL gene in flowering regulation (Wang et al, 2009), the gene-specific primer pairs for B-CUT & Tag-qPCR were identical to ChIP-qPCR detection primers previously reported in the literature (Wang et al, 2009; Yu et al, 2010), and the sequences were as set forth in SEQ ID NO.28-SEQ ID NO. 35. The ACT2 gene was used as a control. From the data for B-CUT & Tag-seq, we summarized the fragment reads mapped to the qPCR target region (FIGS. 9a and B) with the RPM (number of reads per million reads) ratios of the qPCR target region for AtTCL1, AtTRY, AtFUL, and AtACT2 being 2.45, 2.25, 3.18, and 1.45, respectively, and consistently, the B-CUT & Tag-qPCR results showed that the AtTCL1, AtTRY, AtFUL, and AtACT2 target regions were enriched by 1.78, 1.98, 2.01, and 1.15 fold (FIG. 9c) when the rSPL9 test group was compared to the IgG control group, consistent with the trend of the results from high throughput sequencing.

We further determined the specific binding of OsPHR2 by using rice plants over-expressing OsPHR2 as materials and applying B-CUT & Tag-qPCR. OsPHR2 is an important TF that plays a role in phosphate homeostasis in rice. We selected three target genes of OsPHR2, including the low affinity Pi transporter OsPT2(Liu et al, 2010), which is a direct target of OsPHR2, responsible for excess stem Pi accumulation mediated by OsPHR2 overexpression; high affinity Pi transporter OsPT8, a gene that is also critical for Pi homeostasis (Jia et al, 2011); an AM symbiosis-associated marker gene OsRAM1, which is regulated by a network centered on OsPHR2 in mycorrhizal symbiosis (Shi et al, 2021). We identified the distribution of the PHR1 binding site (P1BS) in the promoters of OsPT2, OsPT8 and OsRAM1, and designed qPCR primers whose product fragments cover the indicated P1BS cis-elements (FIG. 9d), with the sequences as SEQ ID NO.36-SEQ ID NO. 41. Under culture conditions sufficient for phosphorus (+ P), neither the target regions of OsPHR 8 and OsRAM1 were enriched in the OsPHR2 experimental group (anti-FLAG tag antibody) compared to the IgG control group, whereas the target region of OsPT2 was enriched 2.36-fold compared to the IgG control group. In contrast, the target regions of OsPT2, OsPT8, and OsRAM1 were enriched 2.56-fold, 2.13-fold, and 3.47-fold, respectively, under phosphorus deficient (-P) conditions (fig. 9e), which indicates that OsPHR2 has different regulatory effects on phosphorus balance and mycorrhizal symbiosis under phosphorus abundant (+ P) and phosphorus deficient (-P) conditions.

Through the above embodiments, it is shown that the CUT & Tag kit and the process provided by the invention can effectively identify the binding of the transcription factor and the DNA.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> kit and method for identifying interaction between transcription factor and chromatin in plants by CUT & Tag technology

<160> 41

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgtctctta tacacatct 19

<210> 2

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 3

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 4

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aatgatacgg cgaccaccga gatctacact agatcgctcg tcggcagcgt c 51

<210> 5

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aatgatacgg cgaccaccga gatctacacc tctctattcg tcggcagcgt c 51

<210> 6

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aatgatacgg cgaccaccga gatctacact atcctcttcg tcggcagcgt c 51

<210> 7

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aatgatacgg cgaccaccga gatctacaca gagtagatcg tcggcagcgt c 51

<210> 8

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aatgatacgg cgaccaccga gatctacacg taaggagtcg tcggcagcgt c 51

<210> 9

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aatgatacgg cgaccaccga gatctacaca ctgcatatcg tcggcagcgt c 51

<210> 10

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aatgatacgg cgaccaccga gatctacaca aggagtatcg tcggcagcgt c 51

<210> 11

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aatgatacgg cgaccaccga gatctacacc taagccttcg tcggcagcgt c 51

<210> 12

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caagcagaag acggcatacg agattaaggc gagtctcgtg ggctcgg 47

<210> 13

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caagcagaag acggcatacg agatcgtact aggtctcgtg ggctcgg 47

<210> 14

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caagcagaag acggcatacg agataggcag aagtctcgtg ggctcgg 47

<210> 15

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caagcagaag acggcatacg agattcctga gcgtctcgtg ggctcgg 47

<210> 16

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caagcagaag acggcatacg agatggactc ctgtctcgtg ggctcgg 47

<210> 17

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caagcagaag acggcatacg agattaggca tggtctcgtg ggctcgg 47

<210> 18

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

caagcagaag acggcatacg agatctctct acgtctcgtg ggctcgg 47

<210> 19

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

caagcagaag acggcatacg agatcagaga gggtctcgtg ggctcgg 47

<210> 20

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caagcagaag acggcatacg agatgctacg ctgtctcgtg ggctcgg 47

<210> 21

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

caagcagaag acggcatacg agatcgaggc tggtctcgtg ggctcgg 47

<210> 22

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caagcagaag acggcatacg agataagagg cagtctcgtg ggctcgg 47

<210> 23

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

caagcagaag acggcatacg agatgtagag gagtctcgtg ggctcgg 47

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

caaatggggt cgtcggcggt 20

<210> 25

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

agtggatttc ccaggcggcc tta 23

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tttgggtcgc gcctatccac t 21

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

aggggaaaaa ttaagcacca gtcgc 25

<210> 28

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tctttcgccg tagactacag at 22

<210> 29

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gacccattaa actaacgtat ttaat 25

<210> 30

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

gagaaatcaa atcgagggcg ta 22

<210> 31

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

aacccctaga ttgttgaaag ttgaa 25

<210> 32

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

aaaaacttgt ctccatgcaa aaag 24

<210> 33

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ttgtcgagtc ctcattggct act 23

<210> 34

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cttcttccgc tctttctttc caaggt 26

<210> 35

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tggatctctc catcaaggtc aagcca 26

<210> 36

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

accatcagcc acggctaaaa t 21

<210> 37

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

agaatggccc catggattgg c 21

<210> 38

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

cgcgtccatg gctgacagg 19

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tctggtgacg tgttgggacc 20

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

acagcgatcc cctctgctct 20

<210> 41

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ggggtgtgtc catttttaat gcgt 24

Claims (10)

1. A kit for identifying transcription factor and chromatin interaction in plants using CUT & Tag technology, comprising: biotinylated Tn5 transposase, cell nucleus extracting solution, washing solution, antibody hybridization solution, streptavidin washing solution, DNA eluent, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitonin solution, ethylene diamine tetraacetic acid solution, sodium chloride solution, magnesium chloride solution, Triton X-100 solution, sodium dodecyl sulfate solution, glycine solution, preloaded Phase Lock Gel, DNA coprecipitator and PCR reaction solution.

2. The kit of claim 1, wherein the biotinylated transposase is formed by incubating a transposase with a biotinylated DNA adapter primer;

the biotinylated DNA joint primer consists of a double-link joint I formed by annealing a primer A and a primer B and a double-link joint II formed by annealing a primer A and a primer C;

primer A contains a fragment of Mosaicend (ME) sequence recognized by transposase, 5 'end is phosphorylated, and 3' end is modified by amino (AminolinkerC 7); the 3 'end of the primer B is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; the 3 'end of the primer C is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; one of the primers B or C is labeled with biotin triethylene glycol at the 5' end.

3. The kit of claim 1, wherein the Tn5 transposase is a pG-Tn5 transposase or a pA-Tn5 transposase; the cell nucleus extracting solution is Tris buffer solution containing 0.5-1% volume concentration Triton X-100; the washing solution is Tris buffer solution containing protease inhibitor and digitonin; the antibody hybridization solution is Tris buffer solution containing EDTA, BSA, protease inhibitor and digitonin; the streptavidin washing solution is Tris buffer solution containing EDTA and Tween-20; the DNA eluent is a solution containing sodium acetate and formamide; the DNA purification magnetic beads are magnetic beads with surface carboxylation modification.

4. The kit according to claim 1, wherein the PCR reaction solution comprises: primer I, primer II and PCR premix;

the base sequence of the primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO. 15; the base sequence of the primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO. 23.

5. A method for identifying transcription factor-chromatin interaction in plants using CUT & Tag technology, comprising the steps of:

(1) a biotinylated DNA adaptor primer is incubated with Tn5 transposase to assemble a biotinylated Tn5 transposase dimer;

(2) fixing the interaction state of the transcription factor and the chromatin in the cell nucleus, and extracting the cell nucleus of the plant tissue to be detected;

(3) recognizing transcription factors combined with chromatin in a cell nucleus by using a primary antibody and a secondary antibody, recognizing the region where an antibody is located by using a biotinylated transposase dimer, and cutting the chromatin to form a biotin-labeled chromatin fragment;

(4) extracting reacted DNA by using a plant genome DNA extracting solution, and purifying a biotin-labeled DNA fragment by using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture;

(5) performing PCR library construction by taking streptavidin magnetic bead-DNA fragments as templates, and constructing a high-throughput sequencing library of interaction of transcription factors and chromatin;

(6) performing library quality inspection, high-throughput sequencing and bioinformatics analysis;

alternatively, the first and second electrodes may be,

(A) a biotinylated DNA adaptor primer is incubated with Tn5 transposase to assemble a biotinylated Tn5 transposase dimer;

(B) fixing the interaction state of the transcription factor and the chromatin in the cell nucleus, and extracting the cell nucleus of the plant tissue to be detected;

(C) recognizing transcription factors combined with chromatin in a cell nucleus by using a primary antibody and a secondary antibody, recognizing the region where an antibody is located by using a biotinylated transposase dimer, and cutting the chromatin to form a biotin-labeled chromatin fragment;

(D) extracting reacted DNA by using a plant genome DNA extracting solution, taking out a part of DNA in a DNA solution to be used as input DNA of fluorescent quantitative PCR, combining large fragments in the rest DNA by using DNA purification magnetic beads, and recovering a supernatant solution;

(E) performing biotin-avidin purification on the small fragments in the product obtained in the step (D) by using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture;

(F) eluting the DNA fragment combined on the streptavidin magnetic bead by using a DNA eluent; and taking the eluted DNA as a template to perform fluorescence quantitative PCR;

(G) the fluorescence quantitative PCR data was analyzed by the Δ Ct method.

6. The method according to claim 5, wherein in the step (1) or the step (A), the specific steps comprise:

a) preparation of biotinylated DNA linker primers: annealing the primer A and the primer B to form a double-chain connector I, and annealing the primer A and the primer C to form a double-chain connector II;

primer A contains a fragment of Mosaicend (ME) sequence recognized by transposase, 5 'end is phosphorylated, and 3' end is modified by amino (AminolinkerC 7); the 3 'end of the primer B is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; the 3 'end of the primer C is a sequence which is reversely complementary with the primer A, and the 5' end is a sequencing joint sequence; the 5' end of one of primer B or primer C is labeled with biotin triethylene glycol.

b) Preparation of Tn5 transposase dimer: linker I and linker II were mixed at a ratio of 1:1 to form a linker mixture, and the linker mixture was incubated with Tn5 transposase to form a Tn5 transposase dimer.

7. The method of claim 5, wherein in step (5), the reaction system of the PCR comprises: primer I, primer II and PCR premix;

the base sequence of the primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO. 15; the base sequence of the primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO. 23.

The reaction procedure for PCR was: 3min at 98 ℃ and 30s at 98 ℃; 30s at 98 ℃, 30s at 60 ℃, 30s at 72 ℃,18-20 cycles, and 5min at 72 ℃.

8. The method of claim 5 wherein in step (D), the DNA eluate is formulated in a pH 9.0 solution containing 30mM sodium acetate, 95% formamide; the DNA purification magnetic Beads are AMpure XP Beads magnetic Beads.

9. The method of claim 5, wherein in step (F), the reaction system of the fluorescent quantitative PCR comprises: SYBR Green, a template, an upstream gene specific primer and a downstream gene specific primer; the templates are input DNA in the step (D) and DNA eluted in the step (F) respectively; the target fragment region covered by the upstream and downstream gene specific primers contains a predicted transcription factor binding motif;

the reaction procedure is as follows: 3min at 98 ℃, 30s at 60 ℃, 30s at 72 ℃ and 45 cycles.

10. The method of claim 5, wherein in step (G), the Δ Ct method is any one of:

(G-1) Ct value of Δ Ct ═ antibody group sample-Ct value of IgG control group sample, and enrichment factor of antibody group fragment was ═ 2^-ΔC(ii) a The antibody group is used for carrying out CUT by using an antibody of a target transcription factor specific antibody or an antibody of an anti-fusion protein label as a primary antibody&A sample of the Tag reaction; the IgG control group refers to CUT using IgG&A sample of the Tag reaction;

(G-2)ΔCt＝CUT&ct value of Tag sample-1% input Ct value, then CUT&The proportion of the target fragment in the Tag sample accounting for 1% of the input thereof is 2^-ΔCtX100%. The CUT&The Tag sample refers to the CUT of antibody group or IgG control group&Tag (Tag). The 1% input DNA is from step (D); finally, the difference in the ratio of the target fragment between the antibody group and the IgG control group was compared.

Images